Starting /dee2/code/volunteer_pipeline.sh SRR12690200 current disk space = 3057773285376 free memory = 1477513376 SRR12690200 SRAfilesize ab8b2ec8e30edcf317f37971b970c6ca SRR12690200.sra SRR12690200.sra file validated SRR12690200 is paired end SRR12690200 is conventional basespace SRR12690200 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690200_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.591 37.0 37.0 37.0 37.0 37.0 2 36.39975 37.0 37.0 37.0 37.0 37.0 3 36.6265 37.0 37.0 37.0 37.0 37.0 4 36.568 37.0 37.0 37.0 37.0 37.0 5 36.616 37.0 37.0 37.0 37.0 37.0 6 36.6505 37.0 37.0 37.0 37.0 37.0 7 36.533 37.0 37.0 37.0 37.0 37.0 8 36.615 37.0 37.0 37.0 37.0 37.0 9 36.6165 37.0 37.0 37.0 37.0 37.0 10-14 36.609 37.0 37.0 37.0 37.0 37.0 15-19 36.563900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.583099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5497 37.0 37.0 37.0 37.0 37.0 30-34 36.4972 37.0 37.0 37.0 37.0 37.0 35-39 36.5171 37.0 37.0 37.0 37.0 37.0 40-44 36.486000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.5005 37.0 37.0 37.0 37.0 37.0 50-54 36.4963 37.0 37.0 37.0 37.0 37.0 55-59 36.4508 37.0 37.0 37.0 37.0 37.0 60-64 36.4232 37.0 37.0 37.0 37.0 37.0 65-69 36.359 37.0 37.0 37.0 37.0 37.0 70-74 36.3388 37.0 37.0 37.0 37.0 37.0 75-79 36.356500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.282799999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.306999999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2586 37.0 37.0 37.0 37.0 37.0 95-99 36.2975 37.0 37.0 37.0 37.0 37.0 100-104 36.2429 37.0 37.0 37.0 37.0 37.0 105-109 36.2066 37.0 37.0 37.0 37.0 37.0 110-114 36.1948 37.0 37.0 37.0 37.0 37.0 115-119 36.140299999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0792 37.0 37.0 37.0 37.0 37.0 125-129 36.035599999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.019000000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.977000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.787400000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7756 37.0 37.0 37.0 37.0 37.0 150-151 35.71925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 2.0 27 4.0 28 11.0 29 14.0 30 22.0 31 34.0 32 40.0 33 65.0 34 116.0 35 282.0 36 3048.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.45 11.3 7.074999999999999 42.175000000000004 2 19.644199448759707 13.304936106239037 36.53219744424956 30.51866700075169 3 15.4 16.825000000000003 28.025 39.75 4 19.775000000000002 25.0 25.5 29.725 5 23.674999999999997 30.075000000000003 23.7 22.55 6 20.95 34.075 24.125 20.849999999999998 7 16.625 26.8 39.375 17.2 8 17.675 27.775 31.924999999999997 22.625 9 18.65 22.625 36.449999999999996 22.275 10-14 19.365 29.360000000000003 27.944999999999997 23.330000000000002 15-19 19.85 27.57 28.46 24.12 20-24 20.09 28.389999999999997 27.99 23.53 25-29 19.775000000000002 28.799999999999997 27.689999999999998 23.735 30-34 19.470000000000002 28.435 28.155 23.94 35-39 20.169999999999998 28.09 27.815 23.925 40-44 20.150000000000002 28.565 27.445000000000004 23.84 45-49 20.385 28.29 27.83 23.494999999999997 50-54 20.06 28.599999999999998 27.744999999999997 23.595 55-59 19.915 28.605000000000004 27.505000000000003 23.974999999999998 60-64 19.965 28.1 28.415000000000003 23.52 65-69 20.775 28.249999999999996 27.51 23.465 70-74 20.044999999999998 29.125 27.11 23.72 75-79 20.205000000000002 28.74 27.92 23.135 80-84 20.349999999999998 28.425 28.125 23.1 85-89 20.285 28.365000000000002 27.55 23.799999999999997 90-94 20.07 28.08 27.884999999999998 23.965 95-99 20.630000000000003 28.23 28.08 23.06 100-104 20.48 28.425 27.605 23.49 105-109 20.575 28.720000000000002 27.150000000000002 23.555 110-114 20.244999999999997 27.944999999999997 28.115000000000002 23.695 115-119 20.560000000000002 28.110000000000003 27.555000000000003 23.775 120-124 20.560000000000002 27.584999999999997 28.345 23.51 125-129 20.86 27.805000000000003 27.51 23.825 130-134 20.575 28.16 27.63 23.635 135-139 20.880000000000003 28.02 27.815 23.285 140-144 21.02 27.544999999999998 27.525 23.91 145-149 20.995 28.165000000000003 27.165 23.674999999999997 150-151 20.45 27.6375 28.349999999999998 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 2.5 25 3.0 26 3.5 27 5.5 28 9.0 29 12.5 30 15.0 31 22.0 32 31.5 33 37.5 34 47.0 35 62.0 36 87.0 37 117.5 38 137.0 39 155.0 40 184.0 41 219.0 42 244.0 43 270.0 44 273.5 45 261.0 46 264.5 47 263.0 48 228.0 49 205.5 50 186.5 51 133.5 52 118.5 53 101.5 54 74.5 55 64.5 56 50.5 57 35.5 58 22.5 59 17.5 60 13.0 61 6.5 62 3.5 63 2.5 64 1.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 92.0479302832244 84.5 2 7.107843137254902 13.05 3 0.7080610021786492 1.95 4 0.13616557734204793 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.6500000000000004 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.300000000000001 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGG 10 0.006830828 145.0 7 CTCCATA 10 0.006830828 145.0 1 CGAATTC 10 0.006830828 145.0 5 >>END_MODULE SRR12690200 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690200_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29225 37.0 37.0 37.0 37.0 37.0 2 36.197 37.0 37.0 37.0 37.0 37.0 3 36.186 37.0 37.0 37.0 37.0 37.0 4 36.2015 37.0 37.0 37.0 37.0 37.0 5 36.342 37.0 37.0 37.0 37.0 37.0 6 36.1695 37.0 37.0 37.0 37.0 37.0 7 36.306 37.0 37.0 37.0 37.0 37.0 8 36.354 37.0 37.0 37.0 37.0 37.0 9 36.384 37.0 37.0 37.0 37.0 37.0 10-14 36.3119 37.0 37.0 37.0 37.0 37.0 15-19 36.2667 37.0 37.0 37.0 37.0 37.0 20-24 36.25 37.0 37.0 37.0 37.0 37.0 25-29 36.2189 37.0 37.0 37.0 37.0 37.0 30-34 36.182900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1994 37.0 37.0 37.0 37.0 37.0 40-44 36.15689999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1684 37.0 37.0 37.0 37.0 37.0 50-54 36.072 37.0 37.0 37.0 37.0 37.0 55-59 36.0502 37.0 37.0 37.0 37.0 37.0 60-64 36.073 37.0 37.0 37.0 37.0 37.0 65-69 35.98650000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.984100000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9644 37.0 37.0 37.0 37.0 37.0 80-84 35.968900000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.931000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.833999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8745 37.0 37.0 37.0 37.0 37.0 100-104 35.893299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8384 37.0 37.0 37.0 37.0 37.0 110-114 35.822900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7115 37.0 37.0 37.0 37.0 37.0 120-124 35.6596 37.0 37.0 37.0 37.0 37.0 125-129 35.5987 37.0 37.0 37.0 37.0 37.0 130-134 35.5626 37.0 37.0 37.0 37.0 37.0 135-139 35.5154 37.0 37.0 37.0 37.0 37.0 140-144 35.5235 37.0 37.0 37.0 37.0 37.0 145-149 35.4039 37.0 37.0 37.0 34.6 37.0 150-151 34.93825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 2.0 15 2.0 16 0.0 17 1.0 18 1.0 19 2.0 20 2.0 21 1.0 22 1.0 23 4.0 24 6.0 25 5.0 26 7.0 27 3.0 28 17.0 29 20.0 30 25.0 31 45.0 32 51.0 33 91.0 34 193.0 35 550.0 36 2688.0 37 277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.35908977244311 24.731182795698924 8.95223805951488 29.957489372343087 2 27.6 28.15 30.025000000000002 14.224999999999998 3 20.424999999999997 29.349999999999998 30.225 20.0 4 23.599999999999998 34.225 23.200000000000003 18.975 5 25.674999999999997 35.85 22.775000000000002 15.7 6 20.775 39.35 21.675 18.2 7 19.900000000000002 22.55 38.275 19.275000000000002 8 21.3 26.775 29.675 22.25 9 22.375 25.674999999999997 29.175 22.775000000000002 10-14 22.814999999999998 30.385 26.265 20.535 15-19 23.035 28.349999999999998 27.88 20.735 20-24 22.1 28.384999999999998 28.575 20.94 25-29 22.759999999999998 28.59 28.055000000000003 20.595 30-34 22.97 28.715000000000003 27.61 20.705000000000002 35-39 22.88 28.665000000000003 28.084999999999997 20.369999999999997 40-44 22.575 28.375 28.375 20.674999999999997 45-49 22.89 28.804999999999996 27.744999999999997 20.560000000000002 50-54 23.255 28.49 27.395000000000003 20.86 55-59 22.685 27.63 28.34 21.345 60-64 22.64 27.994999999999997 27.800000000000004 21.565 65-69 23.215 27.985 28.144999999999996 20.655 70-74 23.025000000000002 27.884999999999998 27.750000000000004 21.34 75-79 23.21 27.584999999999997 28.389999999999997 20.815 80-84 22.99 28.23 27.47 21.310000000000002 85-89 23.064999999999998 28.225 27.66 21.05 90-94 23.75 27.755000000000003 27.634999999999998 20.86 95-99 23.580000000000002 27.91 27.025 21.485000000000003 100-104 22.725 28.04 27.79 21.445 105-109 23.0 28.49 28.165000000000003 20.345 110-114 24.055 28.1 27.575 20.27 115-119 24.025 28.884999999999998 26.875 20.215 120-124 23.474999999999998 28.134999999999998 27.355 21.035 125-129 23.7 28.110000000000003 27.644999999999996 20.544999999999998 130-134 23.630000000000003 28.945 26.884999999999998 20.54 135-139 23.695 28.03 27.815 20.46 140-144 24.605 27.98 27.18 20.235 145-149 24.65 27.72 27.450000000000003 20.18 150-151 24.5625 27.775 27.287499999999998 20.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 2.0 24 5.0 25 7.0 26 7.0 27 9.0 28 10.0 29 11.5 30 15.5 31 23.0 32 31.5 33 40.5 34 50.5 35 65.5 36 95.0 37 123.5 38 142.5 39 181.5 40 208.5 41 212.5 42 244.0 43 268.0 44 284.0 45 276.0 46 244.5 47 234.0 48 226.0 49 189.0 50 162.0 51 137.5 52 91.5 53 74.5 54 73.0 55 64.5 56 48.0 57 41.0 58 32.0 59 18.0 60 9.5 61 3.5 62 5.5 63 4.5 64 1.5 65 1.5 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.77856947108796 83.72500000000001 2 7.152644560153466 13.05 3 0.7947382844614962 2.175 4 0.2466429158673609 0.8999999999999999 5 0.0 0.0 6 0.027404768429706773 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.6624999999999996 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.675 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.324999999999999 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390623 spots for SRR12690200.sra Written 390623 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra Read 390604 spots for SRR12690200.sra Written 390604 spots for SRR12690200.sra SRR ids: ['SRR12690200.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i9nlrotp SRR12690200.sra spots: 7812099 blocks: [[1, 390604], [390605, 781208], [781209, 1171812], [1171813, 1562416], [1562417, 1953020], [1953021, 2343624], [2343625, 2734228], [2734229, 3124832], [3124833, 3515436], [3515437, 3906040], [3906041, 4296644], [4296645, 4687248], [4687249, 5077852], [5077853, 5468456], [5468457, 5859060], [5859061, 6249664], [6249665, 6640268], [6640269, 7030872], [7030873, 7421476], [7421477, 7812099]] SRR12690200 file size 2637465 SRR12690200 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690200 SRR12690200_1.fastq SRR12690200_2.fastq Input file: SRR12690200_1.fastq Paired file: SRR12690200_2.fastq trimmed: SRR12690200-trimmed-pair1.fastq, SRR12690200-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:11:40 2025 >> started Mon Feb 10 23:11:48 2025 >> done (8.365s) 7812099 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 531 ( 0.01%) empty read pairs filtered out after trimming by size control 7811551 (99.99%) read pairs available; of these: 600214 ( 7.68%) trimmed read pairs available after processing 7211337 (92.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 3 0.00% 21 0 0.00% 22 5 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 8 0.00% 28 10 0.00% 29 9 0.00% 30 9 0.00% 31 14 0.00% 32 8 0.00% 33 5 0.00% 34 10 0.00% 35 8 0.00% 36 6 0.00% 37 15 0.00% 38 17 0.00% 39 15 0.00% 40 12 0.00% 41 18 0.00% 42 14 0.00% 43 15 0.00% 44 20 0.00% 45 20 0.00% 46 14 0.00% 47 17 0.00% 48 26 0.00% 49 19 0.00% 50 27 0.00% 51 30 0.00% 52 42 0.00% 53 38 0.00% 54 42 0.00% 55 37 0.00% 56 42 0.00% 57 50 0.00% 58 60 0.00% 59 64 0.00% 60 71 0.00% 61 104 0.00% 62 100 0.00% 63 100 0.00% 64 115 0.00% 65 139 0.00% 66 139 0.00% 67 148 0.00% 68 179 0.00% 69 175 0.00% 70 227 0.00% 71 212 0.00% 72 264 0.00% 73 316 0.00% 74 354 0.00% 75 368 0.00% 76 426 0.01% 77 457 0.01% 78 537 0.01% 79 597 0.01% 80 686 0.01% 81 809 0.01% 82 851 0.01% 83 890 0.01% 84 1022 0.01% 85 1083 0.01% 86 1184 0.02% 87 1310 0.02% 88 1415 0.02% 89 1561 0.02% 90 1611 0.02% 91 1778 0.02% 92 2016 0.03% 93 2100 0.03% 94 2385 0.03% 95 2557 0.03% 96 2628 0.03% 97 2872 0.04% 98 2989 0.04% 99 3180 0.04% 100 3352 0.04% 101 3470 0.04% 102 3847 0.05% 103 4150 0.05% 104 4266 0.05% 105 4471 0.06% 106 4855 0.06% 107 5092 0.07% 108 5050 0.06% 109 5333 0.07% 110 5754 0.07% 111 5789 0.07% 112 6179 0.08% 113 6317 0.08% 114 6811 0.09% 115 7014 0.09% 116 7435 0.10% 117 7705 0.10% 118 8084 0.10% 119 8263 0.11% 120 8584 0.11% 121 8868 0.11% 122 9314 0.12% 123 9546 0.12% 124 9859 0.13% 125 10105 0.13% 126 10732 0.14% 127 11180 0.14% 128 11298 0.14% 129 11517 0.15% 130 12154 0.16% 131 12583 0.16% 132 12661 0.16% 133 13419 0.17% 134 13619 0.17% 135 14086 0.18% 136 14681 0.19% 137 14998 0.19% 138 15207 0.19% 139 16213 0.21% 140 16232 0.21% 141 16790 0.21% 142 17497 0.22% 143 17766 0.23% 144 18045 0.23% 145 18586 0.24% 146 19204 0.25% 147 19492 0.25% 148 20439 0.26% 149 20400 0.26% 150 21180 0.27% 151 7211337 92.32% 7811551 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.42 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=66.31 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=27 prefix-density=0.54 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=72.91 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690200 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:12:30 Started mapping on | Feb 10 23:12:30 Finished on | Feb 10 23:13:18 Mapping speed, Million of reads per hour | 585.87 Number of input reads | 7811551 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 7462642 Uniquely mapped reads % | 95.53% Average mapped length | 297.59 Number of splices: Total | 7530328 Number of splices: Annotated (sjdb) | 7359428 Number of splices: GT/AG | 7380364 Number of splices: GC/AG | 120445 Number of splices: AT/AC | 5476 Number of splices: Non-canonical | 24043 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 172635 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 28446 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 176274 176274 176274 N_multimapping 172635 172635 172635 N_noFeature 310528 7368677 342262 N_ambiguous 106072 595 43494 UnstrandedReadsAssigned:7046042 PositiveStrandReadsAssigned:93370 NegativeStrandReadsAssigned:7076886 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690200 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690200-trimmed-pair1.fastq SRR12690200-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,811,551 reads, 7,062,602 reads pseudoaligned [quant] estimated average fragment length: 259.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR12690200.ke.tsv 34699 SRR12690200.se.tsv 87100 total ==> SRR12690200.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.99 340 23.9707 Potri.005G024800.1.v4.1 1035 776.988 158 25.2321 Potri.004G059700.1.v4.1 961 703.052 3 0.529474 Potri.007G009000.2.v4.1 1416 1157.99 0 0 Potri.003G141000.2.v4.1 2943 2684.99 381 17.6073 Potri.016G087400.1.v4.1 270 75.5379 341 560.145 Potri.015G069301.1.v4.1 564 317.075 0 0 Potri.010G195200.1.v4.1 1773 1514.99 13 1.06474 Potri.012G127500.1.v4.1 977 719.035 79 13.6329 ==> SRR12690200.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 125 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 110 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 15 SRR12690200 completed mapping pipeline successfully