Starting /dee2/code/volunteer_pipeline.sh SRR12690201 current disk space = 3057575821312 free memory = 1073612960 SRR12690201 SRAfilesize 3cbc97ac1b586dd295ea714841dd0f5b SRR12690201.sra SRR12690201.sra file validated SRR12690201 is paired end SRR12690201 is conventional basespace SRR12690201 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5365 37.0 37.0 37.0 37.0 37.0 2 36.3415 37.0 37.0 37.0 37.0 37.0 3 36.517 37.0 37.0 37.0 37.0 37.0 4 36.5005 37.0 37.0 37.0 37.0 37.0 5 36.62 37.0 37.0 37.0 37.0 37.0 6 36.6075 37.0 37.0 37.0 37.0 37.0 7 36.5375 37.0 37.0 37.0 37.0 37.0 8 36.6075 37.0 37.0 37.0 37.0 37.0 9 36.643 37.0 37.0 37.0 37.0 37.0 10-14 36.6062 37.0 37.0 37.0 37.0 37.0 15-19 36.5868 37.0 37.0 37.0 37.0 37.0 20-24 36.5468 37.0 37.0 37.0 37.0 37.0 25-29 36.4996 37.0 37.0 37.0 37.0 37.0 30-34 36.4637 37.0 37.0 37.0 37.0 37.0 35-39 36.4584 37.0 37.0 37.0 37.0 37.0 40-44 36.4975 37.0 37.0 37.0 37.0 37.0 45-49 36.4697 37.0 37.0 37.0 37.0 37.0 50-54 36.4156 37.0 37.0 37.0 37.0 37.0 55-59 36.4159 37.0 37.0 37.0 37.0 37.0 60-64 36.358799999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.342 37.0 37.0 37.0 37.0 37.0 70-74 36.359500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3868 37.0 37.0 37.0 37.0 37.0 80-84 36.224199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2352 37.0 37.0 37.0 37.0 37.0 90-94 36.2236 37.0 37.0 37.0 37.0 37.0 95-99 36.200900000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1681 37.0 37.0 37.0 37.0 37.0 105-109 36.1596 37.0 37.0 37.0 37.0 37.0 110-114 36.0786 37.0 37.0 37.0 37.0 37.0 115-119 36.0379 37.0 37.0 37.0 37.0 37.0 120-124 35.980000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9819 37.0 37.0 37.0 37.0 37.0 130-134 35.928399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9402 37.0 37.0 37.0 37.0 37.0 140-144 35.7639 37.0 37.0 37.0 37.0 37.0 145-149 35.686800000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.410250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 4.0 27 4.0 28 10.0 29 21.0 30 21.0 31 40.0 32 47.0 33 84.0 34 118.0 35 335.0 36 2971.0 37 341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35 12.975 6.525 38.15 2 19.383149448345037 12.738214643931794 37.036108324974926 30.842527582748247 3 17.224999999999998 15.950000000000001 28.025 38.800000000000004 4 21.224999999999998 23.200000000000003 25.7 29.875 5 23.275000000000002 28.749999999999996 25.0 22.975 6 20.599999999999998 33.324999999999996 23.0 23.075000000000003 7 15.825 27.224999999999998 40.025 16.925 8 17.4 25.674999999999997 31.35 25.575 9 17.675 24.275 34.8 23.25 10-14 19.625 29.12 27.82 23.435 15-19 19.900000000000002 27.54 28.42 24.14 20-24 20.085 27.474999999999998 28.155 24.285 25-29 20.080000000000002 27.725 27.97 24.224999999999998 30-34 19.965 27.700000000000003 27.875 24.46 35-39 20.165 28.01 27.900000000000002 23.925 40-44 20.085 28.349999999999998 27.639999999999997 23.925 45-49 20.69 27.73 27.74 23.84 50-54 20.244999999999997 27.615000000000002 28.035 24.104999999999997 55-59 19.915 27.375 28.494999999999997 24.215 60-64 21.584999999999997 26.875 27.839999999999996 23.7 65-69 20.685000000000002 27.644999999999996 28.249999999999996 23.419999999999998 70-74 20.64 28.125 27.525 23.71 75-79 20.06 28.044999999999998 28.044999999999998 23.849999999999998 80-84 21.035 28.189999999999998 27.54 23.235 85-89 20.919999999999998 27.595 27.389999999999997 24.095 90-94 20.65 27.735 27.91 23.705000000000002 95-99 20.835 28.04 27.544999999999998 23.580000000000002 100-104 21.33 27.189999999999998 27.634999999999998 23.845 105-109 21.25 27.975 27.134999999999998 23.64 110-114 21.17 27.71 27.425 23.695 115-119 21.349999999999998 26.85 27.79 24.01 120-124 20.72 27.785 27.775 23.72 125-129 21.915000000000003 27.650000000000002 27.11 23.325000000000003 130-134 21.54 27.779999999999998 27.49 23.189999999999998 135-139 21.36 27.805000000000003 27.47 23.365 140-144 21.345 28.055000000000003 26.77 23.830000000000002 145-149 21.88 27.155 27.495000000000005 23.47 150-151 21.837500000000002 27.9125 26.275 23.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 2.5 26 2.5 27 6.5 28 9.0 29 12.0 30 12.5 31 18.5 32 28.0 33 35.5 34 48.5 35 63.0 36 74.5 37 92.5 38 124.5 39 145.5 40 175.0 41 208.0 42 223.5 43 231.0 44 237.5 45 261.5 46 274.5 47 265.5 48 252.0 49 231.5 50 204.5 51 167.0 52 144.5 53 110.0 54 71.5 55 67.5 56 52.0 57 33.5 58 29.0 59 28.0 60 20.5 61 8.0 62 4.5 63 6.0 64 4.0 65 3.5 66 2.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2888156086837 83.05 2 7.639461390491893 13.900000000000002 3 0.9618026930475405 2.625 4 0.08244023083264633 0.3 5 0.02748007694421544 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCTGAGCTATGGTTGAGCCAATGCCTCCGAGCAATGATCCACCACCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 1.9625000000000001 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.1500000000000004 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.262499999999999 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.137499999999999 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.375 0.0 0.0 0.0 0.0 134-135 7.050000000000001 0.0 0.0 0.0 0.0 136-137 7.45 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAGCA 10 0.006830828 145.0 8 GGCCTTT 10 0.006830828 145.0 1 AACTACA 10 0.006830828 145.0 6 TTAGCAT 10 0.006830828 145.0 9 >>END_MODULE SRR12690201 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690201_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.395 37.0 37.0 37.0 37.0 37.0 2 36.087 37.0 37.0 37.0 37.0 37.0 3 36.079 37.0 37.0 37.0 37.0 37.0 4 36.1925 37.0 37.0 37.0 37.0 37.0 5 36.2905 37.0 37.0 37.0 37.0 37.0 6 36.1975 37.0 37.0 37.0 37.0 37.0 7 36.1825 37.0 37.0 37.0 37.0 37.0 8 36.3835 37.0 37.0 37.0 37.0 37.0 9 36.3805 37.0 37.0 37.0 37.0 37.0 10-14 36.3183 37.0 37.0 37.0 37.0 37.0 15-19 36.298500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.3046 37.0 37.0 37.0 37.0 37.0 25-29 36.2488 37.0 37.0 37.0 37.0 37.0 30-34 36.1954 37.0 37.0 37.0 37.0 37.0 35-39 36.178900000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.1085 37.0 37.0 37.0 37.0 37.0 45-49 36.1759 37.0 37.0 37.0 37.0 37.0 50-54 36.1038 37.0 37.0 37.0 37.0 37.0 55-59 36.0998 37.0 37.0 37.0 37.0 37.0 60-64 36.0594 37.0 37.0 37.0 37.0 37.0 65-69 36.019800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.95309999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.994099999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9333 37.0 37.0 37.0 37.0 37.0 85-89 35.9643 37.0 37.0 37.0 37.0 37.0 90-94 35.8849 37.0 37.0 37.0 37.0 37.0 95-99 35.9071 37.0 37.0 37.0 37.0 37.0 100-104 35.93370000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.8701 37.0 37.0 37.0 37.0 37.0 110-114 35.8295 37.0 37.0 37.0 37.0 37.0 115-119 35.716 37.0 37.0 37.0 37.0 37.0 120-124 35.6058 37.0 37.0 37.0 37.0 37.0 125-129 35.5728 37.0 37.0 37.0 37.0 37.0 130-134 35.417500000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.382000000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.3198 37.0 37.0 37.0 37.0 37.0 145-149 35.1089 37.0 37.0 37.0 29.8 37.0 150-151 34.5445 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 0.0 19 0.0 20 4.0 21 2.0 22 5.0 23 1.0 24 7.0 25 5.0 26 7.0 27 12.0 28 14.0 29 28.0 30 19.0 31 50.0 32 54.0 33 94.0 34 213.0 35 592.0 36 2618.0 37 269.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 27.375 9.0 25.75 2 26.825 28.299999999999997 29.775000000000002 15.1 3 19.75 29.625 30.425 20.200000000000003 4 22.5 34.275 24.025 19.2 5 25.05 36.85 21.325 16.775000000000002 6 21.475 40.225 20.9 17.4 7 20.25 24.125 36.975 18.65 8 21.7 27.450000000000003 28.375 22.475 9 22.85 24.75 29.725 22.675 10-14 22.89 30.19 25.545 21.375 15-19 22.665 28.825 27.235 21.275 20-24 23.195 29.020000000000003 26.255 21.529999999999998 25-29 23.015 28.415000000000003 27.37 21.2 30-34 22.830000000000002 28.294999999999998 27.905 20.97 35-39 23.119999999999997 28.365000000000002 27.295 21.22 40-44 22.96 28.345 27.665 21.029999999999998 45-49 23.3 27.915 27.400000000000002 21.385 50-54 22.770000000000003 28.345 27.495000000000005 21.39 55-59 23.31 27.565 27.694999999999997 21.43 60-64 22.665 28.125 28.075 21.135 65-69 23.115 27.875 27.305 21.705 70-74 23.16 27.785 27.025 22.03 75-79 22.975 27.74 27.565 21.72 80-84 22.95 28.08 26.840000000000003 22.13 85-89 23.525 28.32 26.36 21.795 90-94 22.465 28.37 27.139999999999997 22.025 95-99 23.115 27.79 27.395000000000003 21.7 100-104 23.46 28.215 27.315 21.01 105-109 23.485 27.935 27.384999999999998 21.195 110-114 23.595 28.21 27.22 20.974999999999998 115-119 23.89 28.215 26.845000000000002 21.05 120-124 24.395 27.525 26.740000000000002 21.34 125-129 24.925 27.834999999999997 26.695 20.544999999999998 130-134 24.675 27.12 27.025 21.18 135-139 24.485 28.52 26.479999999999997 20.515 140-144 25.355 27.525 27.04 20.080000000000002 145-149 26.22 27.345000000000002 26.8 19.634999999999998 150-151 25.25 28.1625 26.525 20.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.5 19 1.0 20 1.0 21 2.5 22 2.5 23 2.5 24 2.5 25 1.5 26 2.0 27 3.5 28 4.5 29 7.5 30 12.0 31 18.0 32 27.5 33 37.5 34 45.5 35 54.5 36 79.5 37 116.5 38 136.5 39 141.5 40 180.0 41 229.5 42 254.5 43 253.0 44 259.5 45 283.5 46 270.5 47 240.0 48 234.5 49 235.5 50 186.0 51 130.0 52 112.0 53 99.0 54 75.5 55 55.0 56 49.0 57 36.5 58 26.5 59 23.0 60 13.0 61 8.0 62 9.5 63 9.0 64 5.0 65 2.0 66 0.5 67 2.5 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.48351648351648 83.25 2 7.417582417582418 13.5 3 0.9065934065934067 2.475 4 0.10989010989010989 0.4 5 0.08241758241758242 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit CGCCGCCTATCTCATCATCCATCATGCCTCGCCGAAGCTCTGGAGGAAGA 5 0.125 No Hit AAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.5875000000000004 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.112500000000001 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.325 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 7.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664430 spots for SRR12690201.sra Written 664430 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra Read 664423 spots for SRR12690201.sra Written 664423 spots for SRR12690201.sra SRR ids: ['SRR12690201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_trc9o2kj SRR12690201.sra spots: 13288467 blocks: [[1, 664423], [664424, 1328846], [1328847, 1993269], [1993270, 2657692], [2657693, 3322115], [3322116, 3986538], [3986539, 4650961], [4650962, 5315384], [5315385, 5979807], [5979808, 6644230], [6644231, 7308653], [7308654, 7973076], [7973077, 8637499], [8637500, 9301922], [9301923, 9966345], [9966346, 10630768], [10630769, 11295191], [11295192, 11959614], [11959615, 12624037], [12624038, 13288467]] SRR12690201 file size 4494302 SRR12690201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690201 SRR12690201_1.fastq SRR12690201_2.fastq Input file: SRR12690201_1.fastq Paired file: SRR12690201_2.fastq trimmed: SRR12690201-trimmed-pair1.fastq, SRR12690201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:01:32 2025 >> started Mon Feb 10 23:01:47 2025 >> done (14.654s) 13288467 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 2452 ( 0.02%) empty read pairs filtered out after trimming by size control 13285996 (99.98%) read pairs available; of these: 1556149 (11.71%) trimmed read pairs available after processing 11729847 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 15 0.00% 24 7 0.00% 25 8 0.00% 26 17 0.00% 27 17 0.00% 28 21 0.00% 29 25 0.00% 30 14 0.00% 31 10 0.00% 32 25 0.00% 33 15 0.00% 34 31 0.00% 35 28 0.00% 36 23 0.00% 37 25 0.00% 38 21 0.00% 39 31 0.00% 40 21 0.00% 41 34 0.00% 42 24 0.00% 43 35 0.00% 44 39 0.00% 45 46 0.00% 46 49 0.00% 47 40 0.00% 48 61 0.00% 49 56 0.00% 50 81 0.00% 51 81 0.00% 52 75 0.00% 53 89 0.00% 54 100 0.00% 55 96 0.00% 56 98 0.00% 57 131 0.00% 58 125 0.00% 59 165 0.00% 60 188 0.00% 61 256 0.00% 62 244 0.00% 63 278 0.00% 64 341 0.00% 65 356 0.00% 66 409 0.00% 67 433 0.00% 68 466 0.00% 69 496 0.00% 70 580 0.00% 71 694 0.01% 72 791 0.01% 73 890 0.01% 74 1012 0.01% 75 1084 0.01% 76 1290 0.01% 77 1407 0.01% 78 1517 0.01% 79 1715 0.01% 80 1910 0.01% 81 2269 0.02% 82 2480 0.02% 83 2822 0.02% 84 3035 0.02% 85 3341 0.03% 86 3725 0.03% 87 4055 0.03% 88 4179 0.03% 89 4577 0.03% 90 4990 0.04% 91 5484 0.04% 92 6008 0.05% 93 6467 0.05% 94 6943 0.05% 95 7509 0.06% 96 8222 0.06% 97 8502 0.06% 98 8908 0.07% 99 9463 0.07% 100 10137 0.08% 101 10869 0.08% 102 11594 0.09% 103 12035 0.09% 104 12602 0.09% 105 13322 0.10% 106 14169 0.11% 107 14583 0.11% 108 15378 0.12% 109 16340 0.12% 110 16320 0.12% 111 17416 0.13% 112 17841 0.13% 113 18479 0.14% 114 19387 0.15% 115 20435 0.15% 116 21097 0.16% 117 21751 0.16% 118 22287 0.17% 119 23126 0.17% 120 24061 0.18% 121 24961 0.19% 122 25398 0.19% 123 26026 0.20% 124 27286 0.21% 125 27873 0.21% 126 28433 0.21% 127 30066 0.23% 128 30397 0.23% 129 31108 0.23% 130 31773 0.24% 131 32362 0.24% 132 33456 0.25% 133 34400 0.26% 134 35296 0.27% 135 35947 0.27% 136 36501 0.27% 137 37026 0.28% 138 37561 0.28% 139 39360 0.30% 140 39639 0.30% 141 40308 0.30% 142 41159 0.31% 143 41151 0.31% 144 42931 0.32% 145 44038 0.33% 146 43600 0.33% 147 45297 0.34% 148 45533 0.34% 149 45770 0.34% 150 47132 0.35% 151 11729847 88.29% 13285996 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=11 prefix-density=0.63 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=31.15 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=10.7 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=1.01 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=26.43 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR12690201 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:02:31 Started mapping on | Feb 10 23:02:31 Finished on | Feb 10 23:04:07 Mapping speed, Million of reads per hour | 498.22 Number of input reads | 13285996 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12566196 Uniquely mapped reads % | 94.58% Average mapped length | 295.43 Number of splices: Total | 12690511 Number of splices: Annotated (sjdb) | 12415331 Number of splices: GT/AG | 12428340 Number of splices: GC/AG | 216959 Number of splices: AT/AC | 9520 Number of splices: Non-canonical | 35692 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285481 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 89543 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 434319 434319 434319 N_multimapping 285481 285481 285481 N_noFeature 404972 12411856 452700 N_ambiguous 181411 639 74446 UnstrandedReadsAssigned:11979813 PositiveStrandReadsAssigned:153701 NegativeStrandReadsAssigned:12039050 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690201 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690201-trimmed-pair1.fastq SRR12690201-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,285,996 reads, 12,091,451 reads pseudoaligned [quant] estimated average fragment length: 247.532 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52401 SRR12690201.ke.tsv 34699 SRR12690201.se.tsv 87100 total ==> SRR12690201.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.47 354 15.1611 Potri.005G024800.1.v4.1 1035 788.468 139 13.3749 Potri.004G059700.1.v4.1 961 714.573 35 3.71606 Potri.007G009000.2.v4.1 1416 1169.47 0 0 Potri.003G141000.2.v4.1 2943 2696.47 686.496 19.3154 Potri.016G087400.1.v4.1 270 84.545 558 500.734 Potri.015G069301.1.v4.1 564 328.738 0 0 Potri.010G195200.1.v4.1 1773 1526.47 8 0.397615 Potri.012G127500.1.v4.1 977 730.541 185 19.2127 ==> SRR12690201.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 180 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12690201 completed mapping pipeline successfully