Starting /dee2/code/volunteer_pipeline.sh SRR12690202 current disk space = 3057763438592 free memory = 1462500460 SRR12690202 SRAfilesize 571ee3ba17ada5d9a5d3d324b6e1ff8b SRR12690202.sra SRR12690202.sra file validated SRR12690202 is paired end SRR12690202 is conventional basespace SRR12690202 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690202_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6345 37.0 37.0 37.0 37.0 37.0 2 36.455 37.0 37.0 37.0 37.0 37.0 3 36.5855 37.0 37.0 37.0 37.0 37.0 4 36.5905 37.0 37.0 37.0 37.0 37.0 5 36.662 37.0 37.0 37.0 37.0 37.0 6 36.5855 37.0 37.0 37.0 37.0 37.0 7 36.564 37.0 37.0 37.0 37.0 37.0 8 36.5935 37.0 37.0 37.0 37.0 37.0 9 36.622 37.0 37.0 37.0 37.0 37.0 10-14 36.5695 37.0 37.0 37.0 37.0 37.0 15-19 36.5924 37.0 37.0 37.0 37.0 37.0 20-24 36.562799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.527499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.48290000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4911 37.0 37.0 37.0 37.0 37.0 40-44 36.4969 37.0 37.0 37.0 37.0 37.0 45-49 36.4653 37.0 37.0 37.0 37.0 37.0 50-54 36.4418 37.0 37.0 37.0 37.0 37.0 55-59 36.4168 37.0 37.0 37.0 37.0 37.0 60-64 36.428000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.37779999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3245 37.0 37.0 37.0 37.0 37.0 75-79 36.361000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2946 37.0 37.0 37.0 37.0 37.0 85-89 36.2713 37.0 37.0 37.0 37.0 37.0 90-94 36.242399999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2203 37.0 37.0 37.0 37.0 37.0 100-104 36.1656 37.0 37.0 37.0 37.0 37.0 105-109 36.136700000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.116499999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0983 37.0 37.0 37.0 37.0 37.0 120-124 36.020799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.999300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.988299999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9766 37.0 37.0 37.0 37.0 37.0 140-144 35.7966 37.0 37.0 37.0 37.0 37.0 145-149 35.7692 37.0 37.0 37.0 37.0 37.0 150-151 35.59525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 4.0 26 5.0 27 4.0 28 15.0 29 13.0 30 29.0 31 35.0 32 41.0 33 64.0 34 104.0 35 295.0 36 3022.0 37 366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 11.75 6.800000000000001 41.675000000000004 2 18.966382338183642 13.095835423983942 36.85398896136478 31.083793276467635 3 18.175 15.15 29.325000000000003 37.35 4 21.525 23.724999999999998 24.55 30.2 5 22.125 31.1 24.85 21.925 6 20.849999999999998 33.825 23.7 21.625 7 15.299999999999999 26.625 40.425 17.65 8 17.224999999999998 26.75 31.7 24.325 9 17.224999999999998 24.15 36.15 22.475 10-14 19.695 29.145 27.634999999999998 23.525 15-19 20.28 27.589999999999996 28.050000000000004 24.08 20-24 20.29 28.425 27.905 23.380000000000003 25-29 20.32 28.134999999999998 27.639999999999997 23.905 30-34 19.81 28.42 27.985 23.785 35-39 20.28 28.084999999999997 27.735 23.9 40-44 20.0 28.249999999999996 28.215 23.535 45-49 20.48 28.52 27.04 23.96 50-54 20.135 28.310000000000002 27.834999999999997 23.72 55-59 20.580000000000002 27.665 28.095 23.66 60-64 20.36 28.585 27.43 23.625 65-69 20.68 28.225 27.605 23.49 70-74 20.59 28.24 27.650000000000002 23.52 75-79 20.985 27.715 27.455000000000002 23.845 80-84 20.369999999999997 28.22 27.72 23.69 85-89 20.599999999999998 27.725 27.62 24.055 90-94 20.935000000000002 27.339999999999996 28.249999999999996 23.474999999999998 95-99 20.715 28.084999999999997 27.905 23.294999999999998 100-104 20.78 28.48 27.935 22.805 105-109 20.48 28.055000000000003 27.49 23.974999999999998 110-114 20.89 28.565 27.255000000000003 23.29 115-119 21.345 27.74 27.389999999999997 23.525 120-124 21.115000000000002 28.065 27.04 23.78 125-129 21.08 27.91 27.125 23.885 130-134 21.560000000000002 28.544999999999998 26.305 23.59 135-139 21.54 28.275 26.43 23.755000000000003 140-144 21.87 28.265 26.419999999999998 23.445 145-149 21.14 28.34 26.435 24.085 150-151 21.3625 28.1625 26.687499999999996 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 1.5 26 7.0 27 12.5 28 9.5 29 12.5 30 14.0 31 19.5 32 31.5 33 33.5 34 45.5 35 67.5 36 89.5 37 105.0 38 121.0 39 147.0 40 174.5 41 207.5 42 244.5 43 254.5 44 245.5 45 248.0 46 265.5 47 261.5 48 233.0 49 210.5 50 194.5 51 169.0 52 121.5 53 103.5 54 92.5 55 64.5 56 59.0 57 43.5 58 24.0 59 20.5 60 16.0 61 9.5 62 5.5 63 3.0 64 1.0 65 2.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81125827814569 82.27499999999999 2 8.140176600441501 14.75 3 0.9105960264900662 2.475 4 0.13796909492273732 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 1.9500000000000002 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.125 0.0 0.0 0.0 0.0 120-121 4.4375 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 6.15 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.262499999999999 0.0 0.0 0.0 0.0 132-133 7.7875 0.0 0.0 0.0 0.0 134-135 8.475 0.0 0.0 0.0 0.0 136-137 9.125 0.0 0.0 0.0 0.0 138-139 9.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690202 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690202_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.353 37.0 37.0 37.0 37.0 37.0 2 36.1045 37.0 37.0 37.0 37.0 37.0 3 36.1865 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.425 37.0 37.0 37.0 37.0 37.0 6 36.3275 37.0 37.0 37.0 37.0 37.0 7 36.3965 37.0 37.0 37.0 37.0 37.0 8 36.43 37.0 37.0 37.0 37.0 37.0 9 36.4275 37.0 37.0 37.0 37.0 37.0 10-14 36.3254 37.0 37.0 37.0 37.0 37.0 15-19 36.3404 37.0 37.0 37.0 37.0 37.0 20-24 36.3116 37.0 37.0 37.0 37.0 37.0 25-29 36.2934 37.0 37.0 37.0 37.0 37.0 30-34 36.2618 37.0 37.0 37.0 37.0 37.0 35-39 36.2238 37.0 37.0 37.0 37.0 37.0 40-44 36.2271 37.0 37.0 37.0 37.0 37.0 45-49 36.146300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1665 37.0 37.0 37.0 37.0 37.0 55-59 36.1422 37.0 37.0 37.0 37.0 37.0 60-64 36.0827 37.0 37.0 37.0 37.0 37.0 65-69 36.0589 37.0 37.0 37.0 37.0 37.0 70-74 35.962900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0489 37.0 37.0 37.0 37.0 37.0 80-84 36.031 37.0 37.0 37.0 37.0 37.0 85-89 35.911699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8515 37.0 37.0 37.0 37.0 37.0 95-99 35.8861 37.0 37.0 37.0 37.0 37.0 100-104 35.9082 37.0 37.0 37.0 37.0 37.0 105-109 35.8661 37.0 37.0 37.0 37.0 37.0 110-114 35.839 37.0 37.0 37.0 37.0 37.0 115-119 35.7744 37.0 37.0 37.0 37.0 37.0 120-124 35.653 37.0 37.0 37.0 37.0 37.0 125-129 35.657300000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5848 37.0 37.0 37.0 37.0 37.0 135-139 35.533500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.40650000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.3086 37.0 37.0 37.0 32.2 37.0 150-151 34.757999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 3.0 17 2.0 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 5.0 24 6.0 25 8.0 26 5.0 27 7.0 28 19.0 29 22.0 30 28.0 31 32.0 32 59.0 33 107.0 34 171.0 35 492.0 36 2726.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.55 23.525 9.85 29.075 2 25.35 28.725 29.95 15.975 3 20.525 27.575 30.825000000000003 21.075 4 22.85 33.925 24.0 19.225 5 25.15 36.65 21.2 17.0 6 20.25 39.625 23.400000000000002 16.725 7 19.225 22.975 38.7 19.1 8 21.625 25.5 28.675 24.2 9 21.05 26.6 29.849999999999998 22.5 10-14 23.085 29.775000000000002 26.095000000000002 21.044999999999998 15-19 23.03 27.584999999999997 28.07 21.315 20-24 22.775000000000002 28.610000000000003 27.91 20.705000000000002 25-29 23.275000000000002 27.88 28.305000000000003 20.54 30-34 22.45 28.044999999999998 28.615000000000002 20.89 35-39 22.99 28.205000000000002 27.435 21.37 40-44 22.515 27.765 28.155 21.565 45-49 23.14 28.015 27.705000000000002 21.14 50-54 23.235 27.845 27.49 21.43 55-59 23.0 27.810000000000002 28.275 20.915 60-64 22.770000000000003 27.825 28.125 21.279999999999998 65-69 23.455000000000002 27.77 27.6 21.175 70-74 22.93 27.41 27.61 22.05 75-79 23.07 28.74 27.334999999999997 20.855 80-84 23.445 28.365000000000002 26.634999999999998 21.555 85-89 22.835 28.705000000000002 27.24 21.22 90-94 23.79 28.345 27.315 20.549999999999997 95-99 23.549999999999997 28.055000000000003 27.245 21.15 100-104 24.104999999999997 28.275 26.775 20.845 105-109 23.94 27.825 27.555000000000003 20.68 110-114 23.375 28.49 27.765 20.369999999999997 115-119 23.995 27.725 27.41 20.87 120-124 24.6 28.549999999999997 26.565 20.285 125-129 24.529999999999998 28.134999999999998 26.63 20.705000000000002 130-134 25.314999999999998 27.955000000000002 26.474999999999998 20.255000000000003 135-139 25.25 28.439999999999998 26.790000000000003 19.52 140-144 25.4 28.53 26.21 19.86 145-149 26.775 27.565 26.340000000000003 19.32 150-151 26.237500000000004 27.6875 26.237500000000004 19.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 2.0 20 2.0 21 0.5 22 0.0 23 1.0 24 1.5 25 3.0 26 4.5 27 8.0 28 13.0 29 14.0 30 11.5 31 17.0 32 31.5 33 41.0 34 60.0 35 72.0 36 74.5 37 96.0 38 137.5 39 167.0 40 185.5 41 214.0 42 249.0 43 268.5 44 281.5 45 275.0 46 270.0 47 269.0 48 223.5 49 188.0 50 162.0 51 141.5 52 112.0 53 86.5 54 77.5 55 56.5 56 46.5 57 35.0 58 20.0 59 16.5 60 15.0 61 11.5 62 8.5 63 5.0 64 1.5 65 0.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 1.0 96 0.5 97 0.5 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.83333333333333 81.75 2 7.777777777777778 14.000000000000002 3 1.0555555555555556 2.85 4 0.25 0.8999999999999999 5 0.027777777777777776 0.125 6 0.027777777777777776 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027777777777777776 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.35 0.0 0.0 0.0 0.0 116-117 3.775 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.4875 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 6.1875 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 7.824999999999999 0.0 0.0 0.0 0.0 134-135 8.6 0.0 0.0 0.0 0.0 136-137 9.3 0.0 0.0 0.0 0.0 138-139 10.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 30-34 >>END_MODULE Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683552 spots for SRR12690202.sra Written 683552 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra Read 683549 spots for SRR12690202.sra Written 683549 spots for SRR12690202.sra SRR ids: ['SRR12690202.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qzzwo30o SRR12690202.sra spots: 13670983 blocks: [[1, 683549], [683550, 1367098], [1367099, 2050647], [2050648, 2734196], [2734197, 3417745], [3417746, 4101294], [4101295, 4784843], [4784844, 5468392], [5468393, 6151941], [6151942, 6835490], [6835491, 7519039], [7519040, 8202588], [8202589, 8886137], [8886138, 9569686], [9569687, 10253235], [10253236, 10936784], [10936785, 11620333], [11620334, 12303882], [12303883, 12987431], [12987432, 13670983]] SRR12690202 file size 4624297 SRR12690202 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690202 SRR12690202_1.fastq SRR12690202_2.fastq Input file: SRR12690202_1.fastq Paired file: SRR12690202_2.fastq trimmed: SRR12690202-trimmed-pair1.fastq, SRR12690202-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:14:56 2025 >> started Mon Feb 10 23:15:13 2025 >> done (16.605s) 13670983 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 1109 ( 0.01%) empty read pairs filtered out after trimming by size control 13669863 (99.99%) read pairs available; of these: 1990434 (14.56%) trimmed read pairs available after processing 11679429 (85.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 6 0.00% 22 4 0.00% 23 6 0.00% 24 9 0.00% 25 6 0.00% 26 7 0.00% 27 7 0.00% 28 7 0.00% 29 10 0.00% 30 8 0.00% 31 12 0.00% 32 10 0.00% 33 17 0.00% 34 10 0.00% 35 12 0.00% 36 11 0.00% 37 14 0.00% 38 26 0.00% 39 21 0.00% 40 23 0.00% 41 23 0.00% 42 24 0.00% 43 22 0.00% 44 26 0.00% 45 41 0.00% 46 48 0.00% 47 41 0.00% 48 60 0.00% 49 72 0.00% 50 73 0.00% 51 86 0.00% 52 116 0.00% 53 109 0.00% 54 119 0.00% 55 117 0.00% 56 149 0.00% 57 177 0.00% 58 189 0.00% 59 209 0.00% 60 280 0.00% 61 316 0.00% 62 357 0.00% 63 383 0.00% 64 449 0.00% 65 506 0.00% 66 550 0.00% 67 591 0.00% 68 707 0.01% 69 769 0.01% 70 928 0.01% 71 1058 0.01% 72 1246 0.01% 73 1416 0.01% 74 1547 0.01% 75 1791 0.01% 76 1989 0.01% 77 2162 0.02% 78 2319 0.02% 79 2693 0.02% 80 2906 0.02% 81 3373 0.02% 82 3809 0.03% 83 4109 0.03% 84 4540 0.03% 85 5174 0.04% 86 5551 0.04% 87 6051 0.04% 88 6735 0.05% 89 7153 0.05% 90 7572 0.06% 91 8417 0.06% 92 8747 0.06% 93 9660 0.07% 94 10415 0.08% 95 11086 0.08% 96 12172 0.09% 97 12499 0.09% 98 13289 0.10% 99 13648 0.10% 100 15031 0.11% 101 15188 0.11% 102 16072 0.12% 103 16846 0.12% 104 17900 0.13% 105 18842 0.14% 106 19706 0.14% 107 20489 0.15% 108 21122 0.15% 109 22034 0.16% 110 22641 0.17% 111 23496 0.17% 112 24330 0.18% 113 25257 0.18% 114 26425 0.19% 115 27532 0.20% 116 28137 0.21% 117 28643 0.21% 118 30015 0.22% 119 30396 0.22% 120 31762 0.23% 121 32662 0.24% 122 33181 0.24% 123 34302 0.25% 124 35226 0.26% 125 35787 0.26% 126 37160 0.27% 127 37732 0.28% 128 38199 0.28% 129 39302 0.29% 130 40255 0.29% 131 40321 0.29% 132 41277 0.30% 133 42538 0.31% 134 43424 0.32% 135 43958 0.32% 136 44738 0.33% 137 45312 0.33% 138 45721 0.33% 139 47854 0.35% 140 47627 0.35% 141 48759 0.36% 142 49769 0.36% 143 50460 0.37% 144 51436 0.38% 145 51651 0.38% 146 52218 0.38% 147 52674 0.39% 148 54194 0.40% 149 54668 0.40% 150 55270 0.40% 151 11679429 85.44% 13669863 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=11 prefix-density=0.66 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=18.35 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.2 sequence=GAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=0.83 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=52.49 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATC SRR12690202 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:16:01 Started mapping on | Feb 10 23:16:01 Finished on | Feb 10 23:17:48 Mapping speed, Million of reads per hour | 459.92 Number of input reads | 13669863 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13019049 Uniquely mapped reads % | 95.24% Average mapped length | 293.67 Number of splices: Total | 13094193 Number of splices: Annotated (sjdb) | 12816651 Number of splices: GT/AG | 12813362 Number of splices: GC/AG | 222768 Number of splices: AT/AC | 8055 Number of splices: Non-canonical | 50008 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338080 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 53505 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 312734 312734 312734 N_multimapping 338080 338080 338080 N_noFeature 487052 12844005 544982 N_ambiguous 206510 731 89013 UnstrandedReadsAssigned:12325487 PositiveStrandReadsAssigned:174313 NegativeStrandReadsAssigned:12385054 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690202 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690202-trimmed-pair1.fastq SRR12690202-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,669,863 reads, 12,373,881 reads pseudoaligned [quant] estimated average fragment length: 233.835 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR12690202.ke.tsv 34699 SRR12690202.se.tsv 87100 total ==> SRR12690202.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.16 757 29.6879 Potri.005G024800.1.v4.1 1035 802.165 434 37.8781 Potri.004G059700.1.v4.1 961 728.257 29 2.78789 Potri.007G009000.2.v4.1 1416 1183.16 0 0 Potri.003G141000.2.v4.1 2943 2710.16 548.447 14.1678 Potri.016G087400.1.v4.1 270 88.299 593 470.177 Potri.015G069301.1.v4.1 564 339.88 0 0 Potri.010G195200.1.v4.1 1773 1540.16 29 1.31824 Potri.012G127500.1.v4.1 977 744.204 116 10.9126 ==> SRR12690202.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 88 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12690202 completed mapping pipeline successfully