Starting /dee2/code/volunteer_pipeline.sh SRR12690203 current disk space = 3057619320832 free memory = 1017431664 SRR12690203 SRAfilesize bad327e7022e8efdb29b5c9c0d824bed SRR12690203.sra SRR12690203.sra file validated SRR12690203 is paired end SRR12690203 is conventional basespace SRR12690203 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5675 37.0 37.0 37.0 37.0 37.0 2 36.37725 37.0 37.0 37.0 37.0 37.0 3 36.641 37.0 37.0 37.0 37.0 37.0 4 36.626 37.0 37.0 37.0 37.0 37.0 5 36.6435 37.0 37.0 37.0 37.0 37.0 6 36.627 37.0 37.0 37.0 37.0 37.0 7 36.488 37.0 37.0 37.0 37.0 37.0 8 36.5815 37.0 37.0 37.0 37.0 37.0 9 36.664 37.0 37.0 37.0 37.0 37.0 10-14 36.5954 37.0 37.0 37.0 37.0 37.0 15-19 36.56570000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5678 37.0 37.0 37.0 37.0 37.0 25-29 36.5403 37.0 37.0 37.0 37.0 37.0 30-34 36.5024 37.0 37.0 37.0 37.0 37.0 35-39 36.4794 37.0 37.0 37.0 37.0 37.0 40-44 36.428700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.367599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3467 37.0 37.0 37.0 37.0 37.0 55-59 36.224599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.306599999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2101 37.0 37.0 37.0 37.0 37.0 70-74 36.2474 37.0 37.0 37.0 37.0 37.0 75-79 36.325900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2304 37.0 37.0 37.0 37.0 37.0 85-89 36.2414 37.0 37.0 37.0 37.0 37.0 90-94 36.2211 37.0 37.0 37.0 37.0 37.0 95-99 36.174 37.0 37.0 37.0 37.0 37.0 100-104 36.138999999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1222 37.0 37.0 37.0 37.0 37.0 110-114 36.0595 37.0 37.0 37.0 37.0 37.0 115-119 36.0678 37.0 37.0 37.0 37.0 37.0 120-124 35.96939999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9768 37.0 37.0 37.0 37.0 37.0 130-134 35.947799999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.919399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.7537 37.0 37.0 37.0 37.0 37.0 145-149 35.836200000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.6485 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 1.0 26 2.0 27 3.0 28 9.0 29 22.0 30 28.0 31 41.0 32 48.0 33 86.0 34 132.0 35 298.0 36 3000.0 37 325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 12.325 7.049999999999999 42.4 2 19.37829029832038 13.913261469039858 35.87365254449737 30.834795688142393 3 16.075 15.125 28.799999999999997 40.0 4 20.825 23.625 25.924999999999997 29.625 5 24.925 27.425 25.224999999999998 22.425 6 21.65 32.25 23.525 22.575 7 16.950000000000003 25.5 39.725 17.825 8 17.599999999999998 26.924999999999997 32.225 23.25 9 18.45 23.125 35.949999999999996 22.475 10-14 19.755 29.154999999999998 27.634999999999998 23.455000000000002 15-19 20.150000000000002 27.715 28.155 23.98 20-24 20.05 28.43 27.575 23.945 25-29 19.98 27.575 27.950000000000003 24.495 30-34 19.915 27.41 27.855 24.82 35-39 20.19 26.825 29.15 23.835 40-44 20.150000000000002 28.294999999999998 27.584999999999997 23.97 45-49 20.080000000000002 27.985 27.944999999999997 23.990000000000002 50-54 20.19 28.315 27.555000000000003 23.94 55-59 19.925 27.800000000000004 28.22 24.055 60-64 20.724999999999998 27.725 28.18 23.369999999999997 65-69 20.23 27.82 27.865000000000002 24.085 70-74 21.3 26.86 27.92 23.919999999999998 75-79 20.794999999999998 27.650000000000002 27.715 23.84 80-84 20.424999999999997 28.18 27.250000000000004 24.145 85-89 20.585 27.750000000000004 28.005000000000003 23.66 90-94 20.835 27.555000000000003 27.85 23.76 95-99 21.095 27.944999999999997 26.884999999999998 24.075 100-104 21.355 27.965 27.11 23.57 105-109 21.47 28.02 27.189999999999998 23.32 110-114 21.0 27.765 28.110000000000003 23.125 115-119 21.63 27.589999999999996 27.315 23.465 120-124 21.12 27.625 27.445000000000004 23.810000000000002 125-129 21.654999999999998 27.88 26.695 23.77 130-134 20.919999999999998 27.815 27.445000000000004 23.82 135-139 21.305 27.73 26.634999999999998 24.33 140-144 21.97 27.42 27.32 23.29 145-149 21.43 27.36 26.755000000000003 24.455 150-151 21.8875 27.375 26.825 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 3.0 26 3.5 27 4.0 28 6.0 29 8.5 30 12.5 31 17.0 32 27.5 33 39.5 34 40.5 35 55.0 36 79.0 37 104.5 38 133.0 39 151.0 40 173.5 41 206.5 42 239.0 43 249.5 44 237.0 45 261.5 46 277.5 47 247.0 48 237.5 49 225.5 50 187.0 51 152.5 52 124.0 53 101.5 54 90.5 55 75.5 56 60.0 57 46.5 58 30.0 59 19.5 60 14.0 61 8.0 62 5.5 63 3.5 64 3.0 65 7.0 66 9.0 67 6.0 68 4.0 69 2.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64835164835165 83.39999999999999 2 7.362637362637363 13.4 3 0.7967032967032966 2.175 4 0.10989010989010989 0.4 5 0.054945054945054944 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027472527472527472 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCATACGTATCTCGTAT 15 0.375 TruSeq Adapter, Index 2 (97% over 37bp) GGAACGCAAACAGGATTCTCATATTTCTTTCAGATACACAGCTAGTTAGA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCATACGTATCGCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.037500000000000006 0.0 0.0 0.025 0.0 58-59 0.05 0.0 0.0 0.025 0.0 60-61 0.05 0.0 0.0 0.025 0.0 62-63 0.05 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.0625 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.0875 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.175 0.0 0.0 0.025 0.0 88-89 0.225 0.0 0.0 0.025 0.0 90-91 0.2625 0.0 0.0 0.025 0.0 92-93 0.35 0.0 0.0 0.025 0.0 94-95 0.4375 0.0 0.0 0.025 0.0 96-97 0.6 0.0 0.0 0.025 0.0 98-99 0.6875 0.0 0.0 0.025 0.0 100-101 0.75 0.0 0.0 0.025 0.0 102-103 0.825 0.0 0.0 0.025 0.0 104-105 0.925 0.0 0.0 0.025 0.0 106-107 1.15 0.0 0.0 0.025 0.0 108-109 1.35 0.0 0.0 0.025 0.0 110-111 1.65 0.0 0.0 0.025 0.0 112-113 2.0 0.0 0.0 0.025 0.0 114-115 2.3375000000000004 0.0 0.0 0.025 0.0 116-117 2.5875 0.0 0.0 0.025 0.0 118-119 2.9375 0.0 0.0 0.025 0.0 120-121 3.3125 0.0 0.0 0.025 0.0 122-123 3.5625 0.0 0.0 0.025 0.0 124-125 3.8 0.0 0.0 0.025 0.0 126-127 4.1125 0.0 0.0 0.025 0.0 128-129 4.5 0.0 0.0 0.025 0.0 130-131 4.862500000000001 0.0 0.0 0.025 0.0 132-133 5.3375 0.0 0.0 0.025 0.0 134-135 5.95 0.0 0.0 0.025 0.0 136-137 6.525 0.0 0.0 0.025 0.0 138-139 7.275 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAA 10 0.006830828 145.0 6 >>END_MODULE SRR12690203 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.273 37.0 37.0 37.0 37.0 37.0 2 36.053 37.0 37.0 37.0 37.0 37.0 3 36.1305 37.0 37.0 37.0 37.0 37.0 4 36.128 37.0 37.0 37.0 37.0 37.0 5 36.205 37.0 37.0 37.0 37.0 37.0 6 36.1175 37.0 37.0 37.0 37.0 37.0 7 36.2 37.0 37.0 37.0 37.0 37.0 8 36.176 37.0 37.0 37.0 37.0 37.0 9 36.205 37.0 37.0 37.0 37.0 37.0 10-14 36.1818 37.0 37.0 37.0 37.0 37.0 15-19 36.125800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0737 37.0 37.0 37.0 37.0 37.0 25-29 36.047700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.0269 37.0 37.0 37.0 37.0 37.0 35-39 36.0192 37.0 37.0 37.0 37.0 37.0 40-44 35.923199999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.98909999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.94350000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9477 37.0 37.0 37.0 37.0 37.0 60-64 35.8487 37.0 37.0 37.0 37.0 37.0 65-69 35.8583 37.0 37.0 37.0 37.0 37.0 70-74 35.7317 37.0 37.0 37.0 37.0 37.0 75-79 35.7587 37.0 37.0 37.0 37.0 37.0 80-84 35.8233 37.0 37.0 37.0 37.0 37.0 85-89 35.8233 37.0 37.0 37.0 37.0 37.0 90-94 35.7654 37.0 37.0 37.0 37.0 37.0 95-99 35.808499999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.81849999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.879 37.0 37.0 37.0 37.0 37.0 110-114 35.7235 37.0 37.0 37.0 37.0 37.0 115-119 35.6692 37.0 37.0 37.0 37.0 37.0 120-124 35.6549 37.0 37.0 37.0 37.0 37.0 125-129 35.684000000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.534499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.533699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.35979999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.3099 37.0 37.0 37.0 29.8 37.0 150-151 34.81375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 4.0 16 0.0 17 0.0 18 4.0 19 0.0 20 4.0 21 5.0 22 5.0 23 12.0 24 7.0 25 10.0 26 9.0 27 10.0 28 13.0 29 27.0 30 30.0 31 48.0 32 59.0 33 109.0 34 198.0 35 543.0 36 2649.0 37 253.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.35 24.45 10.25 29.95 2 26.5 28.225 28.925 16.35 3 20.424999999999997 27.325 32.675 19.575 4 22.475 34.625 23.05 19.85 5 25.3 35.65 21.475 17.575 6 19.950000000000003 40.325 21.75 17.974999999999998 7 20.75 21.6 36.85 20.8 8 19.5 27.575 28.449999999999996 24.474999999999998 9 22.125 24.5 29.925 23.45 10-14 23.695 29.115000000000002 26.035000000000004 21.154999999999998 15-19 23.32 29.165000000000003 26.345000000000002 21.17 20-24 23.615 28.51 26.735 21.14 25-29 23.115 28.375 27.725 20.785 30-34 23.169999999999998 28.54 27.91 20.380000000000003 35-39 23.150000000000002 28.02 27.529999999999998 21.3 40-44 22.465 29.03 27.375 21.13 45-49 23.29 27.935 27.794999999999998 20.979999999999997 50-54 23.395 28.485 27.395000000000003 20.724999999999998 55-59 24.099999999999998 27.750000000000004 27.315 20.835 60-64 23.580000000000002 28.155 27.744999999999997 20.52 65-69 23.61 27.26 27.700000000000003 21.43 70-74 23.294999999999998 27.85 27.474999999999998 21.38 75-79 23.189999999999998 27.91 27.715 21.185000000000002 80-84 23.905 28.525 27.005000000000003 20.565 85-89 23.305 27.775 27.265 21.654999999999998 90-94 23.685000000000002 28.199999999999996 27.1 21.015 95-99 23.82 27.92 27.075 21.185000000000002 100-104 23.599999999999998 27.87 27.61 20.919999999999998 105-109 23.765 28.175 26.919999999999998 21.14 110-114 23.735 27.575 27.96 20.73 115-119 25.064999999999998 27.88 26.56 20.495 120-124 24.755 27.855 26.715 20.674999999999997 125-129 25.705 27.265 26.534999999999997 20.495 130-134 24.945 28.4 26.724999999999998 19.93 135-139 25.89 27.889999999999997 26.195 20.025000000000002 140-144 25.230000000000004 27.77 27.065 19.935 145-149 25.814999999999998 27.575 26.924999999999997 19.685 150-151 25.662499999999998 27.8125 26.35 20.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 0.5 22 0.5 23 2.5 24 2.0 25 1.5 26 2.5 27 4.0 28 6.5 29 9.0 30 13.5 31 19.5 32 23.5 33 30.5 34 49.0 35 67.0 36 91.0 37 124.0 38 137.5 39 156.5 40 201.5 41 229.0 42 244.0 43 256.0 44 272.0 45 277.5 46 257.5 47 251.5 48 241.5 49 192.5 50 159.5 51 141.0 52 117.0 53 94.5 54 73.0 55 57.0 56 44.0 57 34.0 58 16.0 59 10.0 60 12.5 61 12.5 62 9.5 63 6.5 64 3.0 65 2.0 66 3.5 67 3.5 68 2.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 2.0 88 2.0 89 0.5 90 0.5 91 0.5 92 0.5 93 2.0 94 2.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.40259024524663 82.92500000000001 2 7.302287131441168 13.25 3 1.1297878203361806 3.075 4 0.08266740148801323 0.3 5 0.055111600992008826 0.25 6 0.0 0.0 7 0.0 0.0 8 0.027555800496004413 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 5 0.125 No Hit CAGAAGCAATCGAAGATGGAAACATGGTAAAGGGGGCGCTTCCAGATGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.0625 0.025 0.0 0.0 0.0 74-75 0.075 0.025 0.0 0.0 0.0 76-77 0.075 0.025 0.0 0.0 0.0 78-79 0.0875 0.025 0.0 0.0 0.0 80-81 0.1 0.025 0.0 0.0 0.0 82-83 0.125 0.025 0.0 0.0 0.0 84-85 0.16249999999999998 0.025 0.0 0.0 0.0 86-87 0.175 0.025 0.0 0.0 0.0 88-89 0.225 0.025 0.0 0.0 0.0 90-91 0.2625 0.025 0.0 0.0 0.0 92-93 0.35 0.025 0.0 0.0 0.0 94-95 0.4375 0.025 0.0 0.0 0.0 96-97 0.6 0.025 0.0 0.0 0.0 98-99 0.6875 0.025 0.0 0.0 0.0 100-101 0.75 0.025 0.0 0.0 0.0 102-103 0.825 0.025 0.0 0.0 0.0 104-105 0.925 0.025 0.0 0.0 0.0 106-107 1.15 0.025 0.0 0.0 0.0 108-109 1.35 0.025 0.0 0.0 0.0 110-111 1.65 0.025 0.0 0.0 0.0 112-113 2.0 0.025 0.0 0.0 0.0 114-115 2.3375000000000004 0.025 0.0 0.0 0.0 116-117 2.575 0.025 0.0 0.0 0.0 118-119 2.9125 0.025 0.0 0.0 0.0 120-121 3.2750000000000004 0.025 0.0 0.0 0.0 122-123 3.5125 0.025 0.0 0.0 0.0 124-125 3.75 0.025 0.0 0.0 0.0 126-127 4.0625 0.025 0.0 0.0 0.0 128-129 4.45 0.025 0.0 0.0 0.0 130-131 4.8125 0.025 0.0 0.0 0.0 132-133 5.275 0.025 0.0 0.0 0.0 134-135 5.875 0.025 0.0 0.0 0.0 136-137 6.475 0.025 0.0 0.0 0.0 138-139 7.225 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTACCA 10 0.006830828 145.0 1 CTTCTGT 10 0.006830828 145.0 8 >>END_MODULE Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041942 spots for SRR12690203.sra Written 1041942 spots for SRR12690203.sra Read 1041945 spots for SRR12690203.sra Written 1041945 spots for SRR12690203.sra SRR ids: ['SRR12690203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ez1507jy SRR12690203.sra spots: 20838843 blocks: [[1, 1041942], [1041943, 2083884], [2083885, 3125826], [3125827, 4167768], [4167769, 5209710], [5209711, 6251652], [6251653, 7293594], [7293595, 8335536], [8335537, 9377478], [9377479, 10419420], [10419421, 11461362], [11461363, 12503304], [12503305, 13545246], [13545247, 14587188], [14587189, 15629130], [15629131, 16671072], [16671073, 17713014], [17713015, 18754956], [18754957, 19796898], [19796899, 20838843]] SRR12690203 file size 7060250 SRR12690203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690203 SRR12690203_1.fastq SRR12690203_2.fastq Input file: SRR12690203_1.fastq Paired file: SRR12690203_2.fastq trimmed: SRR12690203-trimmed-pair1.fastq, SRR12690203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:09:17 2025 >> started Mon Feb 10 23:09:40 2025 >> done (23.134s) 20838843 read pairs processed; of these: 52 ( 0.00%) short read pairs filtered out after trimming by size control 116483 ( 0.56%) empty read pairs filtered out after trimming by size control 20722308 (99.44%) read pairs available; of these: 2176024 (10.50%) trimmed read pairs available after processing 18546284 (89.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 7 0.00% 23 15 0.00% 24 7 0.00% 25 18 0.00% 26 15 0.00% 27 13 0.00% 28 12 0.00% 29 24 0.00% 30 28 0.00% 31 28 0.00% 32 16 0.00% 33 24 0.00% 34 19 0.00% 35 27 0.00% 36 32 0.00% 37 26 0.00% 38 32 0.00% 39 28 0.00% 40 40 0.00% 41 40 0.00% 42 52 0.00% 43 39 0.00% 44 50 0.00% 45 48 0.00% 46 64 0.00% 47 49 0.00% 48 47 0.00% 49 87 0.00% 50 96 0.00% 51 106 0.00% 52 108 0.00% 53 108 0.00% 54 132 0.00% 55 127 0.00% 56 144 0.00% 57 150 0.00% 58 195 0.00% 59 205 0.00% 60 254 0.00% 61 273 0.00% 62 307 0.00% 63 339 0.00% 64 346 0.00% 65 408 0.00% 66 454 0.00% 67 555 0.00% 68 561 0.00% 69 654 0.00% 70 738 0.00% 71 887 0.00% 72 937 0.00% 73 1027 0.00% 74 1182 0.01% 75 1408 0.01% 76 1501 0.01% 77 1638 0.01% 78 1730 0.01% 79 1930 0.01% 80 2314 0.01% 81 2616 0.01% 82 2935 0.01% 83 3391 0.02% 84 3694 0.02% 85 4034 0.02% 86 4306 0.02% 87 4930 0.02% 88 5231 0.03% 89 5729 0.03% 90 6283 0.03% 91 6692 0.03% 92 7279 0.04% 93 8061 0.04% 94 8798 0.04% 95 9561 0.05% 96 10154 0.05% 97 11022 0.05% 98 11645 0.06% 99 12349 0.06% 100 13157 0.06% 101 13810 0.07% 102 14929 0.07% 103 15609 0.08% 104 16335 0.08% 105 17263 0.08% 106 18624 0.09% 107 19449 0.09% 108 20399 0.10% 109 21116 0.10% 110 21927 0.11% 111 23024 0.11% 112 23993 0.12% 113 24789 0.12% 114 26096 0.13% 115 27384 0.13% 116 28484 0.14% 117 29718 0.14% 118 30825 0.15% 119 31610 0.15% 120 32954 0.16% 121 33930 0.16% 122 35123 0.17% 123 36121 0.17% 124 37384 0.18% 125 38358 0.19% 126 40559 0.20% 127 41380 0.20% 128 42298 0.20% 129 43813 0.21% 130 45780 0.22% 131 46018 0.22% 132 47888 0.23% 133 49727 0.24% 134 49766 0.24% 135 51202 0.25% 136 52356 0.25% 137 53257 0.26% 138 54766 0.26% 139 56601 0.27% 140 57155 0.28% 141 58645 0.28% 142 60121 0.29% 143 61004 0.29% 144 62366 0.30% 145 63601 0.31% 146 64755 0.31% 147 65250 0.31% 148 67290 0.32% 149 67931 0.33% 150 69661 0.34% 151 18546284 89.50% 20722308 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=35.44 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=10.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=35.91 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=3.8 sequence=AAAGAAAGCTTCTTGTTGAGAAGAGAGTAGAGAGGGCAGGAGCGAAGATCAGAGAAACAAATGGCTTCAACTTCAGCTGTTTCAATGGCCTTGCCATTAACTTATGCAAGCCAAAAGAGGATTCCAGCCTCTGAGGCTTTCTTCAAGCCACTCCCAGCGAGGCCATCTAAGGCTATGTCAGCATCAAAATCCAGTGGT SRR12690203 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:10:23 Started mapping on | Feb 10 23:10:23 Finished on | Feb 10 23:12:23 Mapping speed, Million of reads per hour | 621.67 Number of input reads | 20722308 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19690124 Uniquely mapped reads % | 95.02% Average mapped length | 296.23 Number of splices: Total | 19908523 Number of splices: Annotated (sjdb) | 19470516 Number of splices: GT/AG | 19509717 Number of splices: GC/AG | 331892 Number of splices: AT/AC | 14469 Number of splices: Non-canonical | 52445 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443955 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 153531 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 588229 588229 588229 N_multimapping 443955 443955 443955 N_noFeature 680907 19439762 749929 N_ambiguous 306591 1265 124511 UnstrandedReadsAssigned:18702626 PositiveStrandReadsAssigned:249097 NegativeStrandReadsAssigned:18815684 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690203-trimmed-pair1.fastq SRR12690203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,722,308 reads, 18,872,125 reads pseudoaligned [quant] estimated average fragment length: 251.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR12690203.ke.tsv 34699 SRR12690203.se.tsv 87100 total ==> SRR12690203.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.82 502 13.3176 Potri.005G024800.1.v4.1 1035 784.822 192 11.4733 Potri.004G059700.1.v4.1 961 710.965 123 8.11365 Potri.007G009000.2.v4.1 1416 1165.82 0 0 Potri.003G141000.2.v4.1 2943 2692.82 864 15.0475 Potri.016G087400.1.v4.1 270 82.484 901 512.288 Potri.015G069301.1.v4.1 564 325.357 0 0 Potri.010G195200.1.v4.1 1773 1522.82 11 0.338769 Potri.012G127500.1.v4.1 977 726.918 491 31.6778 ==> SRR12690203.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 641 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 17 Potri.001G452600.v4.1 21 SRR12690203 completed mapping pipeline successfully