Starting /dee2/code/volunteer_pipeline.sh SRR12701854 current disk space = 3057572696064 free memory = 1221850624 SRR12701854 SRAfilesize b45f513d9e6361aa6c6f27b61669be6f SRR12701854.sra SRR12701854.sra file validated SRR12701854 is paired end SRR12701854 is conventional basespace SRR12701854 read1 length is 101-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3935 37.0 37.0 37.0 37.0 37.0 2 36.37425 37.0 37.0 37.0 37.0 37.0 3 36.4395 37.0 37.0 37.0 37.0 37.0 4 36.371 37.0 37.0 37.0 37.0 37.0 5 36.476 37.0 37.0 37.0 37.0 37.0 6 36.4935 37.0 37.0 37.0 37.0 37.0 7 36.5505 37.0 37.0 37.0 37.0 37.0 8 36.4585 37.0 37.0 37.0 37.0 37.0 9 36.5545 37.0 37.0 37.0 37.0 37.0 10-14 36.5291 37.0 37.0 37.0 37.0 37.0 15-19 36.5154 37.0 37.0 37.0 37.0 37.0 20-24 36.3672 37.0 37.0 37.0 37.0 37.0 25-29 36.363299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3384 37.0 37.0 37.0 37.0 37.0 35-39 36.2971 37.0 37.0 37.0 37.0 37.0 40-44 36.2269 37.0 37.0 37.0 37.0 37.0 45-49 36.2541 37.0 37.0 37.0 37.0 37.0 50-54 36.295 37.0 37.0 37.0 37.0 37.0 55-59 36.2418 37.0 37.0 37.0 37.0 37.0 60-64 36.207800000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.1396 37.0 37.0 37.0 37.0 37.0 70-74 36.1053 37.0 37.0 37.0 37.0 37.0 75-79 36.023 37.0 37.0 37.0 37.0 37.0 80-84 36.059999999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0449 37.0 37.0 37.0 37.0 37.0 90-94 35.9288 37.0 37.0 37.0 37.0 37.0 95-99 35.9776 37.0 37.0 37.0 37.0 37.0 100-104 35.93299219414463 37.0 37.0 37.0 37.0 37.0 105-109 35.930481517487564 37.0 37.0 37.0 37.0 37.0 110-114 35.92444241097512 37.0 37.0 37.0 37.0 37.0 115-119 35.814225478505065 37.0 37.0 37.0 37.0 37.0 120-124 35.73135325146174 37.0 37.0 37.0 37.0 37.0 125-129 35.7197635194183 37.0 37.0 37.0 37.0 37.0 130-134 35.669713194337156 37.0 37.0 37.0 37.0 37.0 135-139 35.64641228158739 37.0 37.0 37.0 37.0 37.0 140-144 35.624213890187306 37.0 37.0 37.0 37.0 37.0 145-149 35.51197087345613 37.0 37.0 37.0 34.6 37.0 150 35.35588842975206 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 0.0 24 2.0 25 4.0 26 8.0 27 13.0 28 14.0 29 33.0 30 27.0 31 49.0 32 51.0 33 97.0 34 127.0 35 374.0 36 2993.0 37 204.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.962443665498245 18.02704056084126 20.030045067601403 36.98047070605909 2 22.01352366641623 29.125970448284498 35.03631354871024 13.82419233658903 3 21.3 32.824999999999996 25.5 20.375 4 21.875 36.425000000000004 21.075 20.625 5 21.3 38.6 22.15 17.95 6 16.975 37.025000000000006 24.375 21.625 7 15.7 17.075000000000003 43.6 23.625 8 21.175 22.2 27.474999999999998 29.15 9 20.025000000000002 23.825 29.025000000000002 27.125 10-14 20.265 29.065 27.439999999999998 23.23 15-19 21.245 27.384999999999998 28.175 23.195 20-24 22.15 28.360000000000003 27.500000000000004 21.990000000000002 25-29 21.87 27.575 28.225 22.33 30-34 20.835 29.185 27.689999999999998 22.29 35-39 21.14 29.01 27.13 22.720000000000002 40-44 21.615000000000002 28.255000000000003 27.88 22.25 45-49 21.23 27.615000000000002 28.444999999999997 22.71 50-54 21.455 27.48 28.13 22.935 55-59 21.73 27.894999999999996 27.794999999999998 22.58 60-64 21.55 28.205000000000002 27.584999999999997 22.66 65-69 21.945 28.165000000000003 27.42 22.470000000000002 70-74 21.625 27.48 28.185 22.71 75-79 21.44 28.585 27.49 22.485 80-84 21.740000000000002 27.85 28.08 22.33 85-89 20.965 28.315 28.439999999999998 22.28 90-94 22.264999999999997 27.900000000000002 27.76 22.075 95-99 21.995 28.005000000000003 27.985 22.015 100-104 22.426728018405523 27.70331099329799 27.868360508152445 22.00160048014404 105-109 21.949509116409537 27.795031055900623 28.63153676617912 21.62392306151072 110-114 22.39442271040225 27.665763867990773 27.866385795967496 22.073427625639482 115-119 22.293697859081316 27.937481153884814 27.79676349381847 21.9720574932154 120-124 21.329709597866024 28.476521213951383 28.365795963561325 21.82797322462127 125-129 22.326662623812414 27.354962603598143 27.880533656761674 22.437841115827776 130-134 21.825941167504954 28.25788751714678 27.693949093126047 22.22222222222222 135-139 21.887580899964327 27.31998165418132 28.033430158487487 22.759007287366863 140-144 21.97159993848362 28.05146870354232 28.025836879069054 21.95109447890501 145-149 22.16774193548387 28.098064516129035 27.478709677419356 22.255483870967744 150 21.668388429752067 27.530991735537192 27.530991735537192 23.269628099173552 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 3.5 25 7.0 26 8.5 27 11.5 28 12.0 29 11.0 30 14.5 31 27.0 32 42.0 33 43.5 34 50.5 35 70.5 36 101.5 37 126.5 38 143.0 39 177.0 40 209.5 41 218.0 42 227.5 43 244.5 44 262.0 45 269.5 46 246.5 47 235.5 48 234.5 49 199.5 50 149.5 51 117.5 52 111.5 53 88.5 54 69.0 55 56.5 56 36.5 57 29.5 58 26.5 59 22.5 60 16.5 61 17.0 62 12.5 63 6.0 64 5.0 65 3.5 66 3.0 67 3.5 68 5.5 69 7.0 70 3.0 71 2.0 72 2.0 73 0.5 74 1.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 3.0 104-105 2.0 106-107 3.0 108-109 0.0 110-111 3.0 112-113 4.0 114-115 4.0 116-117 1.0 118-119 1.0 120-121 4.0 122-123 5.0 124-125 4.0 126-127 15.0 128-129 6.0 130-131 9.0 132-133 4.0 134-135 3.0 136-137 4.0 138-139 11.0 140-141 12.0 142-143 11.0 144-145 18.0 146-147 0.0 148-149 0.0 150-151 3872.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.45 #Duplication Level Percentage of deduplicated Percentage of total 1 85.72264482153305 73.25 2 11.849034523112932 20.25 3 2.1064950263311877 5.4 4 0.32182562902282036 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12701854 read2 length is 101-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3705 37.0 37.0 37.0 37.0 37.0 2 36.35 37.0 37.0 37.0 37.0 37.0 3 36.3065 37.0 37.0 37.0 37.0 37.0 4 36.3815 37.0 37.0 37.0 37.0 37.0 5 36.298 37.0 37.0 37.0 37.0 37.0 6 36.289 37.0 37.0 37.0 37.0 37.0 7 36.2605 37.0 37.0 37.0 37.0 37.0 8 36.3755 37.0 37.0 37.0 37.0 37.0 9 36.3575 37.0 37.0 37.0 37.0 37.0 10-14 36.3474 37.0 37.0 37.0 37.0 37.0 15-19 36.3478 37.0 37.0 37.0 37.0 37.0 20-24 36.32340000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2882 37.0 37.0 37.0 37.0 37.0 30-34 36.230799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2001 37.0 37.0 37.0 37.0 37.0 40-44 36.2441 37.0 37.0 37.0 37.0 37.0 45-49 36.142599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1551 37.0 37.0 37.0 37.0 37.0 55-59 36.07020000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.0355 37.0 37.0 37.0 37.0 37.0 65-69 36.0223 37.0 37.0 37.0 37.0 37.0 70-74 35.92199999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.814299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.757000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.83969999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.7374 37.0 37.0 37.0 37.0 37.0 95-99 35.7354 37.0 37.0 37.0 37.0 37.0 100-104 35.61498844178011 37.0 37.0 37.0 37.0 37.0 105-109 35.70059959025126 37.0 37.0 37.0 37.0 37.0 110-114 35.646414431655124 37.0 37.0 37.0 37.0 37.0 115-119 35.51381014095236 37.0 37.0 37.0 37.0 37.0 120-124 35.36561651702609 37.0 37.0 37.0 32.2 37.0 125-129 35.42176478802195 37.0 37.0 37.0 32.2 37.0 130-134 35.41697549141643 37.0 37.0 37.0 34.6 37.0 135-139 35.34343632306929 37.0 37.0 37.0 34.6 37.0 140-144 35.4035632861961 37.0 37.0 37.0 32.2 37.0 145-149 35.32541851201398 37.0 37.0 37.0 29.8 37.0 150 35.02737603305785 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 5.0 25 5.0 26 9.0 27 16.0 28 15.0 29 24.0 30 22.0 31 44.0 32 57.0 33 108.0 34 217.0 35 689.0 36 2608.0 37 175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.650000000000002 19.225 19.975 35.15 2 22.85 26.950000000000003 36.05 14.149999999999999 3 23.35 31.374999999999996 24.474999999999998 20.8 4 21.875 37.15 20.3 20.674999999999997 5 21.875 38.25 21.125 18.75 6 16.425 36.775000000000006 25.025 21.775 7 16.25 17.424999999999997 42.6 23.724999999999998 8 19.625 21.475 29.599999999999998 29.299999999999997 9 19.6 22.975 29.225 28.199999999999996 10-14 20.515 29.185 27.605 22.695 15-19 21.785 27.85 27.815 22.55 20-24 21.65 29.14 26.97 22.24 25-29 21.245 29.310000000000002 27.35 22.095000000000002 30-34 21.27 28.749999999999996 27.675 22.305 35-39 21.7 28.035 28.025 22.24 40-44 21.415 28.21 27.92 22.455 45-49 21.92 29.005 27.445000000000004 21.63 50-54 21.88 29.095 27.275 21.75 55-59 22.175 28.17 27.900000000000002 21.755 60-64 21.875 28.705000000000002 27.365000000000002 22.055 65-69 22.275 28.155 27.01 22.56 70-74 21.54 28.49 27.889999999999997 22.08 75-79 21.475 28.535 27.939999999999998 22.05 80-84 21.89 28.360000000000003 27.595 22.155 85-89 22.625 28.470000000000002 27.134999999999998 21.77 90-94 21.805 28.275 27.62 22.3 95-99 22.220000000000002 28.26 27.555000000000003 21.965 100-104 22.656797039111733 28.32349704911473 26.97809342802841 22.041612483745123 105-109 21.944500100180324 28.866960528952113 27.25405730314566 21.9344820677219 110-114 21.637074932290098 28.0318988865483 27.931587922559935 22.399438258601663 115-119 22.17810835259825 28.52547994773344 27.50025128153583 21.796160418132477 120-124 21.953797372791787 28.07388393980573 27.39946650561176 22.57285218179073 125-129 22.134627046694966 28.042247826965838 27.850212249848393 21.972912876490803 130-134 22.633744855967077 27.74983488289387 27.582177513590405 22.034242747548646 135-139 22.341130306273254 28.48188350405137 27.885644396881208 21.291341792794167 140-144 22.96098836315169 27.564464038550263 28.077100528015585 21.397447070282464 145-149 22.08516129032258 27.70064516129032 27.979354838709675 22.23483870967742 150 21.84917355371901 27.944214876033058 27.530991735537192 22.675619834710744 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 4.5 25 6.0 26 8.5 27 12.0 28 10.5 29 12.0 30 18.0 31 26.5 32 40.5 33 53.0 34 56.0 35 66.5 36 84.5 37 115.5 38 154.5 39 187.0 40 199.5 41 219.0 42 244.0 43 267.0 44 274.0 45 256.0 46 243.5 47 231.5 48 212.5 49 187.5 50 163.5 51 129.0 52 100.0 53 74.5 54 69.5 55 60.0 56 41.0 57 35.0 58 25.5 59 21.0 60 16.0 61 11.5 62 9.0 63 7.0 64 6.5 65 4.5 66 1.5 67 1.5 68 6.0 69 7.0 70 3.5 71 1.5 72 1.0 73 2.5 74 2.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 3.0 104-105 2.0 106-107 3.0 108-109 0.0 110-111 3.0 112-113 4.0 114-115 4.0 116-117 1.0 118-119 1.0 120-121 4.0 122-123 5.0 124-125 4.0 126-127 15.0 128-129 6.0 130-131 9.0 132-133 4.0 134-135 3.0 136-137 4.0 138-139 11.0 140-141 12.0 142-143 11.0 144-145 18.0 146-147 0.0 148-149 0.0 150-151 3872.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.6 #Duplication Level Percentage of deduplicated Percentage of total 1 85.83528037383178 73.475 2 11.857476635514018 20.3 3 1.9859813084112148 5.1 4 0.29205607476635514 1.0 5 0.02920560747663551 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCTATAATGCACATGGCAATAATGGAAGGAAATACCTGCTCCCTGCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGTTG 10 0.0070008645 143.8125 3 >>END_MODULE Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207969 spots for SRR12701854.sra Written 1207969 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra Read 1207968 spots for SRR12701854.sra Written 1207968 spots for SRR12701854.sra SRR ids: ['SRR12701854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l742g9eg SRR12701854.sra spots: 24159361 blocks: [[1, 1207968], [1207969, 2415936], [2415937, 3623904], [3623905, 4831872], [4831873, 6039840], [6039841, 7247808], [7247809, 8455776], [8455777, 9663744], [9663745, 10871712], [10871713, 12079680], [12079681, 13287648], [13287649, 14495616], [14495617, 15703584], [15703585, 16911552], [16911553, 18119520], [18119521, 19327488], [19327489, 20535456], [20535457, 21743424], [21743425, 22951392], [22951393, 24159361]] SRR12701854 file size 8115159 SRR12701854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701854 SRR12701854_1.fastq SRR12701854_2.fastq Input file: SRR12701854_1.fastq Paired file: SRR12701854_2.fastq trimmed: SRR12701854-trimmed-pair1.fastq, SRR12701854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:02:21 2025 >> started Mon Feb 10 23:02:51 2025 >> done (29.237s) 24159361 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 20 ( 0.00%) empty read pairs filtered out after trimming by size control 24159341 (100.00%) read pairs available; of these: 117773 ( 0.49%) trimmed read pairs available after processing 24041568 (99.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 8 0.00% 28 4 0.00% 29 4 0.00% 30 9 0.00% 31 11 0.00% 32 5 0.00% 33 6 0.00% 34 6 0.00% 35 9 0.00% 36 6 0.00% 37 11 0.00% 38 7 0.00% 39 11 0.00% 40 13 0.00% 41 4 0.00% 42 12 0.00% 43 14 0.00% 44 9 0.00% 45 11 0.00% 46 10 0.00% 47 14 0.00% 48 14 0.00% 49 12 0.00% 50 9 0.00% 51 12 0.00% 52 16 0.00% 53 14 0.00% 54 15 0.00% 55 14 0.00% 56 7 0.00% 57 18 0.00% 58 15 0.00% 59 11 0.00% 60 7 0.00% 61 17 0.00% 62 12 0.00% 63 16 0.00% 64 12 0.00% 65 18 0.00% 66 11 0.00% 67 11 0.00% 68 15 0.00% 69 10 0.00% 70 16 0.00% 71 11 0.00% 72 15 0.00% 73 14 0.00% 74 13 0.00% 75 11 0.00% 76 11 0.00% 77 21 0.00% 78 11 0.00% 79 14 0.00% 80 13 0.00% 81 14 0.00% 82 15 0.00% 83 21 0.00% 84 17 0.00% 85 5 0.00% 86 8 0.00% 87 11 0.00% 88 6 0.00% 89 16 0.00% 90 16 0.00% 91 16 0.00% 92 8 0.00% 93 10 0.00% 94 25 0.00% 95 21 0.00% 96 29 0.00% 97 19 0.00% 98 29 0.00% 99 4210 0.02% 100 4409 0.02% 101 4743 0.02% 102 5066 0.02% 103 5456 0.02% 104 5603 0.02% 105 5958 0.02% 106 6179 0.03% 107 6354 0.03% 108 6855 0.03% 109 7217 0.03% 110 7445 0.03% 111 7745 0.03% 112 8156 0.03% 113 8434 0.03% 114 8954 0.04% 115 9242 0.04% 116 9656 0.04% 117 10058 0.04% 118 10376 0.04% 119 10792 0.04% 120 11174 0.05% 121 11699 0.05% 122 12356 0.05% 123 12962 0.05% 124 13306 0.06% 125 13840 0.06% 126 14224 0.06% 127 14800 0.06% 128 15150 0.06% 129 15969 0.07% 130 16205 0.07% 131 17076 0.07% 132 18060 0.07% 133 18574 0.08% 134 18953 0.08% 135 19734 0.08% 136 20512 0.08% 137 167 0.00% 138 21152 0.09% 139 21716 0.09% 140 22306 0.09% 141 23141 0.10% 142 24375 0.10% 143 26397 0.11% 144 32297 0.13% 145 85704 0.35% 146 27706 0.11% 147 28413 0.12% 148 29051 0.12% 149 29864 0.12% 150 23368622 96.73% 24159341 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=169.05 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=25.6 sequence=AAAAGAAAAGGTA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=170.79 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=25.6 sequence=AAAAGAAAAGGTA SRR12701854 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:03:42 Started mapping on | Feb 10 23:03:42 Finished on | Feb 10 23:08:02 Mapping speed, Million of reads per hour | 334.51 Number of input reads | 24159341 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21811171 Uniquely mapped reads % | 90.28% Average mapped length | 294.79 Number of splices: Total | 19574609 Number of splices: Annotated (sjdb) | 18863003 Number of splices: GT/AG | 19150531 Number of splices: GC/AG | 250661 Number of splices: AT/AC | 24670 Number of splices: Non-canonical | 148747 Mismatch rate per base, % | 1.22% Deletion rate per base | 0.11% Deletion average length | 3.36 Insertion rate per base | 0.08% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1129934 % of reads mapped to multiple loci | 4.68% Number of reads mapped to too many loci | 177519 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.96% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1218236 1218236 1218236 N_multimapping 1129934 1129934 1129934 N_noFeature 931899 11252749 11384275 N_ambiguous 269478 82979 81538 UnstrandedReadsAssigned:20609794 PositiveStrandReadsAssigned:10475443 NegativeStrandReadsAssigned:10345358 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12701854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701854-trimmed-pair1.fastq SRR12701854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,159,341 reads, 20,481,673 reads pseudoaligned [quant] estimated average fragment length: 237.481 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR12701854.ke.tsv 34699 SRR12701854.se.tsv 87100 total ==> SRR12701854.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.52 1850 40.0701 Potri.005G024800.1.v4.1 1035 798.519 13517 653.181 Potri.004G059700.1.v4.1 961 724.534 68 3.6215 Potri.007G009000.2.v4.1 1416 1179.52 0 0 Potri.003G141000.2.v4.1 2943 2706.52 1137.94 16.2237 Potri.016G087400.1.v4.1 270 57.0601 1073 725.614 Potri.015G069301.1.v4.1 564 327.781 0 0 Potri.010G195200.1.v4.1 1773 1536.52 50 1.25566 Potri.012G127500.1.v4.1 977 740.534 7092 369.541 ==> SRR12701854.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 123 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 457 SRR12701854 completed mapping pipeline successfully