Starting /dee2/code/volunteer_pipeline.sh SRR12701855 current disk space = 3057674190848 free memory = 1395144204 SRR12701855 SRAfilesize 042a7f5b92de7249691fcafcdc3300d2 SRR12701855.sra SRR12701855.sra file validated SRR12701855 is paired end SRR12701855 is conventional basespace SRR12701855 read1 length is 103-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 103-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3725 37.0 37.0 37.0 37.0 37.0 2 36.43775 37.0 37.0 37.0 37.0 37.0 3 36.4755 37.0 37.0 37.0 37.0 37.0 4 36.441 37.0 37.0 37.0 37.0 37.0 5 36.537 37.0 37.0 37.0 37.0 37.0 6 36.4335 37.0 37.0 37.0 37.0 37.0 7 36.33325 37.0 37.0 37.0 37.0 37.0 8 36.4395 37.0 37.0 37.0 37.0 37.0 9 36.486 37.0 37.0 37.0 37.0 37.0 10-14 36.490700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4747 37.0 37.0 37.0 37.0 37.0 20-24 36.43710000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.3311 37.0 37.0 37.0 37.0 37.0 30-34 36.2885 37.0 37.0 37.0 37.0 37.0 35-39 36.3057 37.0 37.0 37.0 37.0 37.0 40-44 36.279700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2147 37.0 37.0 37.0 37.0 37.0 50-54 36.1807 37.0 37.0 37.0 37.0 37.0 55-59 36.1699 37.0 37.0 37.0 37.0 37.0 60-64 36.156 37.0 37.0 37.0 37.0 37.0 65-69 36.078199999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.113099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.067699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.027699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.01519999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.98530000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9399 37.0 37.0 37.0 37.0 37.0 100-104 35.983149412353086 37.0 37.0 37.0 37.0 37.0 105-109 35.875556667500625 37.0 37.0 37.0 37.0 37.0 110-114 35.85641823602615 37.0 37.0 37.0 37.0 37.0 115-119 35.859364993368274 37.0 37.0 37.0 37.0 37.0 120-124 35.68229000796762 37.0 37.0 37.0 37.0 37.0 125-129 35.76234407266614 37.0 37.0 37.0 37.0 37.0 130-134 35.72343654876297 37.0 37.0 37.0 37.0 37.0 135-139 35.6423308455645 37.0 37.0 37.0 37.0 37.0 140-144 35.599218248824926 37.0 37.0 37.0 37.0 37.0 145-149 35.55314388855279 37.0 37.0 37.0 37.0 37.0 150 35.63093726187452 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 1.0 23 1.0 24 3.0 25 4.0 26 11.0 27 18.0 28 23.0 29 32.0 30 33.0 31 54.0 32 62.0 33 77.0 34 112.0 35 312.0 36 3006.0 37 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.138069034517258 18.234117058529264 19.78489244622311 35.842921460730366 2 23.19239429572179 27.045283962972228 36.05203902927195 13.710282712034024 3 21.7 32.775 25.95 19.575 4 23.05 36.375 21.025 19.55 5 20.7 38.550000000000004 23.825 16.925 6 17.275 38.975 23.05 20.7 7 15.678919729932483 16.079019754938734 44.06101525381345 24.18104526131533 8 17.974999999999998 23.0 29.599999999999998 29.425 9 21.175 23.025000000000002 29.825000000000003 25.974999999999998 10-14 21.335 28.825 26.82 23.02 15-19 21.584999999999997 27.515 27.560000000000002 23.34 20-24 21.985 29.24 27.169999999999998 21.605 25-29 21.345 29.189999999999998 27.425 22.040000000000003 30-34 20.735 29.23 27.750000000000004 22.285 35-39 21.75 28.525 27.515 22.21 40-44 21.6 28.549999999999997 27.810000000000002 22.040000000000003 45-49 21.085 28.985 27.389999999999997 22.54 50-54 21.915000000000003 28.439999999999998 27.565 22.08 55-59 22.035 27.775 28.294999999999998 21.895 60-64 21.455 28.33 27.63 22.585 65-69 21.8 28.07 28.285 21.845 70-74 22.009999999999998 28.09 27.67 22.23 75-79 22.02 28.525 27.49 21.965 80-84 21.625 29.215000000000003 27.87 21.29 85-89 21.355 28.794999999999998 28.044999999999998 21.805 90-94 22.09 27.96 27.935 22.015 95-99 21.42 27.615000000000002 28.54 22.425 100-104 21.796089804490222 28.241412070603527 28.171408570428518 21.791089554477725 105-109 22.176632474355767 28.786589942456843 26.830122591943955 22.206654991243433 110-114 22.075972173564885 28.45703418247335 27.265902607477106 22.20109103648466 115-119 21.89941895411741 28.596473652574634 27.795031055900623 21.709076337407332 120-124 22.103520914835993 27.600561741398334 27.86137024776808 22.434547095997594 125-129 22.05202892728003 27.95299316994777 28.525512253917235 21.469465648854964 130-134 21.813972216629757 27.290114757398833 29.127239782564928 21.768673243406482 135-139 21.638400969109632 27.654956591964464 28.543307086614174 22.16333535231173 140-144 22.116016790573003 27.355484751934455 28.392252060891117 22.136246396601425 145-149 22.335618177202335 27.875095201827875 27.905559786747908 21.883726834221882 150 23.698247396494793 27.000254000508 27.838455676911355 21.46304292608585 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 4.0 23 5.0 24 4.5 25 9.0 26 12.0 27 10.5 28 10.0 29 12.0 30 21.0 31 38.0 32 43.5 33 43.5 34 58.0 35 76.0 36 107.0 37 127.0 38 146.0 39 168.5 40 182.5 41 222.0 42 249.0 43 264.0 44 263.5 45 245.5 46 259.5 47 239.0 48 187.5 49 172.5 50 164.5 51 143.0 52 115.5 53 94.0 54 67.0 55 48.5 56 39.0 57 32.0 58 26.0 59 13.0 60 10.5 61 13.0 62 10.0 63 6.5 64 6.5 65 5.0 66 2.5 67 1.0 68 1.5 69 3.0 70 2.5 71 2.0 72 3.0 73 2.5 74 1.5 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 103 1.0 104 2.0 105 0.0 106 0.0 107 0.0 108 0.0 109 0.0 110 0.0 111 1.0 112 0.0 113 1.0 114 1.0 115 0.0 116 0.0 117 3.0 118 0.0 119 1.0 120 1.0 121 2.0 122 0.0 123 2.0 124 0.0 125 1.0 126 1.0 127 2.0 128 2.0 129 1.0 130 2.0 131 1.0 132 4.0 133 3.0 134 0.0 135 1.0 136 8.0 137 0.0 138 0.0 139 2.0 140 2.0 141 1.0 142 0.0 143 1.0 144 6.0 145 10.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3937.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.5 #Duplication Level Percentage of deduplicated Percentage of total 1 84.67455621301775 71.55 2 12.633136094674558 21.349999999999998 3 2.366863905325444 6.0 4 0.3254437869822485 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12701855 read2 length is 103-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 103-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6155 37.0 37.0 37.0 37.0 37.0 2 35.6425 37.0 37.0 37.0 37.0 37.0 3 35.908 37.0 37.0 37.0 37.0 37.0 4 35.8125 37.0 37.0 37.0 37.0 37.0 5 35.966 37.0 37.0 37.0 37.0 37.0 6 36.0465 37.0 37.0 37.0 37.0 37.0 7 36.0515 37.0 37.0 37.0 37.0 37.0 8 36.1235 37.0 37.0 37.0 37.0 37.0 9 36.1355 37.0 37.0 37.0 37.0 37.0 10-14 36.06915 37.0 37.0 37.0 37.0 37.0 15-19 35.9787 37.0 37.0 37.0 37.0 37.0 20-24 36.0176 37.0 37.0 37.0 37.0 37.0 25-29 35.968900000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.9409 37.0 37.0 37.0 37.0 37.0 35-39 35.8738 37.0 37.0 37.0 37.0 37.0 40-44 35.8433 37.0 37.0 37.0 37.0 37.0 45-49 35.8408 37.0 37.0 37.0 37.0 37.0 50-54 35.7848 37.0 37.0 37.0 37.0 37.0 55-59 35.735200000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.6332 37.0 37.0 37.0 37.0 37.0 65-69 35.6438 37.0 37.0 37.0 37.0 37.0 70-74 35.6479 37.0 37.0 37.0 37.0 37.0 75-79 35.56 37.0 37.0 37.0 37.0 37.0 80-84 35.452799999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.511399999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.3394 37.0 37.0 37.0 29.8 37.0 95-99 35.4356 37.0 37.0 37.0 37.0 37.0 100-104 35.435618654663664 37.0 37.0 37.0 34.6 37.0 105-109 35.31673755316488 37.0 37.0 37.0 32.2 37.0 110-114 35.2287098964497 37.0 37.0 37.0 32.2 37.0 115-119 35.04058786751915 37.0 37.0 37.0 25.0 37.0 120-124 35.288768158842416 37.0 37.0 37.0 32.2 37.0 125-129 35.08174375308479 37.0 37.0 37.0 25.0 37.0 130-134 35.062242695940824 37.0 37.0 37.0 27.4 37.0 135-139 35.0194409629883 37.0 37.0 37.0 25.0 37.0 140-144 34.84955551652767 37.0 37.0 37.0 25.0 37.0 145-149 35.05254627626053 37.0 37.0 37.0 25.0 37.0 150 35.059436118872235 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 2.0 21 3.0 22 5.0 23 5.0 24 10.0 25 12.0 26 17.0 27 19.0 28 25.0 29 38.0 30 31.0 31 58.0 32 82.0 33 121.0 34 267.0 35 943.0 36 2254.0 37 106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.55 18.4 19.925 37.125 2 21.275 28.175 36.65 13.900000000000002 3 20.4 31.900000000000002 26.375 21.325 4 20.674999999999997 38.775 21.224999999999998 19.325 5 20.474999999999998 37.925 22.975 18.625 6 16.075 37.75 26.05 20.125 7 16.5 17.5 43.375 22.625 8 19.475 23.125 29.4 28.000000000000004 9 20.775 22.35 29.2 27.675 10-14 20.841042052102605 29.13145657282864 27.146357317865892 22.88114405720286 15-19 20.865000000000002 28.18 28.000000000000004 22.955000000000002 20-24 21.265 29.375 27.075 22.285 25-29 21.285 28.444999999999997 28.144999999999996 22.125 30-34 21.125 28.415000000000003 28.575 21.884999999999998 35-39 20.905 28.43 28.244999999999997 22.42 40-44 21.404999999999998 28.335 28.055000000000003 22.205 45-49 21.61 28.67 28.075 21.645 50-54 22.015 28.21 27.195000000000004 22.58 55-59 21.695 28.925 27.075 22.305 60-64 21.955 28.34 27.57 22.134999999999998 65-69 21.740000000000002 28.57 27.644999999999996 22.045 70-74 21.875 28.49 27.375 22.259999999999998 75-79 21.64 28.53 27.715 22.115000000000002 80-84 21.275 28.849999999999998 27.839999999999996 22.035 85-89 22.41 28.865000000000002 27.0 21.725 90-94 21.805 28.139999999999997 27.99 22.065 95-99 21.34 27.965 27.58 23.115 100-104 21.556077803890194 28.05140257012851 27.91639581979099 22.47612380619031 105-109 21.4610958218664 28.066049537152864 27.820865649236925 22.651988991743806 110-114 22.18607677293429 28.1517441569491 27.7113257594715 21.950853310645112 115-119 22.194950911640955 27.534562211981566 28.526347425365657 21.744139451011822 120-124 22.38439161400341 28.202427525328517 27.269535560236736 22.143645300431338 125-129 21.03254319003616 28.932302129369226 28.18903173965448 21.846122940940134 130-134 22.24179585262734 28.467888061203944 27.365613046104286 21.924703040064426 135-139 21.99676963456491 27.52877044215627 28.230365435089844 22.244094488188974 140-144 22.045213169473524 28.817073787487992 26.81434279067415 22.323370252364334 145-149 22.24930185326225 27.529829906067533 27.905559786747908 22.315308453922313 150 23.901447802895607 29.743459486918972 25.933451866903734 20.421640843281686 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.5 18 1.0 19 2.0 20 2.5 21 1.0 22 1.5 23 1.5 24 2.5 25 5.0 26 5.0 27 11.5 28 14.5 29 15.0 30 21.5 31 29.5 32 33.5 33 52.5 34 66.5 35 66.5 36 92.5 37 137.5 38 168.0 39 187.5 40 204.5 41 212.5 42 241.5 43 253.5 44 255.5 45 264.5 46 247.5 47 233.5 48 221.0 49 192.5 50 149.0 51 106.0 52 90.5 53 89.0 54 72.0 55 51.5 56 43.0 57 34.5 58 22.0 59 14.0 60 15.0 61 15.5 62 12.5 63 8.5 64 6.5 65 5.5 66 3.0 67 2.0 68 2.0 69 2.5 70 1.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 103 1.0 104 2.0 105 0.0 106 0.0 107 0.0 108 0.0 109 0.0 110 0.0 111 1.0 112 0.0 113 1.0 114 1.0 115 0.0 116 0.0 117 3.0 118 0.0 119 1.0 120 1.0 121 2.0 122 0.0 123 2.0 124 0.0 125 1.0 126 1.0 127 2.0 128 2.0 129 1.0 130 2.0 131 1.0 132 4.0 133 3.0 134 0.0 135 1.0 136 8.0 137 0.0 138 0.0 139 2.0 140 2.0 141 1.0 142 0.0 143 1.0 144 6.0 145 10.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3937.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.975 #Duplication Level Percentage of deduplicated Percentage of total 1 85.23095027949397 72.425 2 12.180052956751986 20.7 3 2.26537216828479 5.775 4 0.3236245954692557 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGGA 10 0.0069845165 143.925 7 >>END_MODULE Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163970 spots for SRR12701855.sra Written 1163970 spots for SRR12701855.sra Read 1163986 spots for SRR12701855.sra Written 1163986 spots for SRR12701855.sra SRR ids: ['SRR12701855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_551yt13h SRR12701855.sra spots: 23279416 blocks: [[1, 1163970], [1163971, 2327940], [2327941, 3491910], [3491911, 4655880], [4655881, 5819850], [5819851, 6983820], [6983821, 8147790], [8147791, 9311760], [9311761, 10475730], [10475731, 11639700], [11639701, 12803670], [12803671, 13967640], [13967641, 15131610], [15131611, 16295580], [16295581, 17459550], [17459551, 18623520], [18623521, 19787490], [19787491, 20951460], [20951461, 22115430], [22115431, 23279416]] SRR12701855 file size 7829536 SRR12701855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701855 SRR12701855_1.fastq SRR12701855_2.fastq Input file: SRR12701855_1.fastq Paired file: SRR12701855_2.fastq trimmed: SRR12701855-trimmed-pair1.fastq, SRR12701855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:24:08 2025 >> started Mon Feb 10 23:24:44 2025 >> done (35.557s) 23279416 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 14 ( 0.00%) empty read pairs filtered out after trimming by size control 23279402 (100.00%) read pairs available; of these: 76512 ( 0.33%) trimmed read pairs available after processing 23202890 (99.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 7 0.00% 23 1 0.00% 24 1 0.00% 25 7 0.00% 26 4 0.00% 27 4 0.00% 28 8 0.00% 29 5 0.00% 30 6 0.00% 31 12 0.00% 32 7 0.00% 33 12 0.00% 34 5 0.00% 35 11 0.00% 36 9 0.00% 37 16 0.00% 38 7 0.00% 39 12 0.00% 40 7 0.00% 41 16 0.00% 42 10 0.00% 43 12 0.00% 44 7 0.00% 45 13 0.00% 46 11 0.00% 47 14 0.00% 48 12 0.00% 49 18 0.00% 50 15 0.00% 51 10 0.00% 52 17 0.00% 53 20 0.00% 54 10 0.00% 55 9 0.00% 56 20 0.00% 57 19 0.00% 58 20 0.00% 59 14 0.00% 60 14 0.00% 61 26 0.00% 62 21 0.00% 63 19 0.00% 64 13 0.00% 65 18 0.00% 66 15 0.00% 67 18 0.00% 68 12 0.00% 69 11 0.00% 70 20 0.00% 71 22 0.00% 72 20 0.00% 73 23 0.00% 74 11 0.00% 75 15 0.00% 76 9 0.00% 77 19 0.00% 78 10 0.00% 79 21 0.00% 80 25 0.00% 81 28 0.00% 82 20 0.00% 83 16 0.00% 84 19 0.00% 85 22 0.00% 86 18 0.00% 87 17 0.00% 88 19 0.00% 89 15 0.00% 90 18 0.00% 91 17 0.00% 92 23 0.00% 93 20 0.00% 94 30 0.00% 95 15 0.00% 96 28 0.00% 97 20 0.00% 98 31 0.00% 99 1810 0.01% 100 2100 0.01% 101 2101 0.01% 102 2398 0.01% 103 2523 0.01% 104 2851 0.01% 105 2873 0.01% 106 3061 0.01% 107 3136 0.01% 108 3483 0.01% 109 3557 0.02% 110 3787 0.02% 111 3872 0.02% 112 4191 0.02% 113 4324 0.02% 114 4785 0.02% 115 4875 0.02% 116 5055 0.02% 117 5362 0.02% 118 5485 0.02% 119 5887 0.03% 120 6075 0.03% 121 6503 0.03% 122 6943 0.03% 123 7025 0.03% 124 7481 0.03% 125 7672 0.03% 126 7994 0.03% 127 8341 0.04% 128 8734 0.04% 129 9340 0.04% 130 9337 0.04% 131 10046 0.04% 132 10514 0.05% 133 10931 0.05% 134 11373 0.05% 135 11948 0.05% 136 12367 0.05% 137 114 0.00% 138 13029 0.06% 139 13286 0.06% 140 13469 0.06% 141 14312 0.06% 142 15327 0.07% 143 17075 0.07% 144 23110 0.10% 145 74107 0.32% 146 17475 0.08% 147 18058 0.08% 148 18389 0.08% 149 19596 0.08% 150 22790765 97.90% 23279402 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=143.50 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=24.8 sequence=AAAAGAAAAGGTA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=11 fanout-score=137.34 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=23.4 sequence=AAAAGAAAAGGTA SRR12701855 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:25:32 Started mapping on | Feb 10 23:25:32 Finished on | Feb 10 23:29:58 Mapping speed, Million of reads per hour | 315.06 Number of input reads | 23279402 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20929567 Uniquely mapped reads % | 89.91% Average mapped length | 295.00 Number of splices: Total | 18443967 Number of splices: Annotated (sjdb) | 17802522 Number of splices: GT/AG | 18044243 Number of splices: GC/AG | 238958 Number of splices: AT/AC | 23400 Number of splices: Non-canonical | 137366 Mismatch rate per base, % | 1.26% Deletion rate per base | 0.11% Deletion average length | 3.31 Insertion rate per base | 0.08% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1145948 % of reads mapped to multiple loci | 4.92% Number of reads mapped to too many loci | 129791 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.29% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1203887 1203887 1203887 N_multimapping 1145948 1145948 1145948 N_noFeature 879110 10777119 10930519 N_ambiguous 267421 84345 83120 UnstrandedReadsAssigned:19783036 PositiveStrandReadsAssigned:10068103 NegativeStrandReadsAssigned:9915928 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12701855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701855-trimmed-pair1.fastq SRR12701855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,279,402 reads, 19,639,127 reads pseudoaligned [quant] estimated average fragment length: 248.982 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR12701855.ke.tsv 34699 SRR12701855.se.tsv 87100 total ==> SRR12701855.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.02 1776 41.2247 Potri.005G024800.1.v4.1 1035 787.018 11180 583.645 Potri.004G059700.1.v4.1 961 713.018 41 2.36252 Potri.007G009000.2.v4.1 1416 1168.02 0 0 Potri.003G141000.2.v4.1 2943 2695.02 1063.89 16.2192 Potri.016G087400.1.v4.1 270 52.2884 922 724.465 Potri.015G069301.1.v4.1 564 316.249 0 0 Potri.010G195200.1.v4.1 1773 1525.02 56.6231 1.52549 Potri.012G127500.1.v4.1 977 729.018 8594 484.338 ==> SRR12701855.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 556 SRR12701855 completed mapping pipeline successfully