Starting /dee2/code/volunteer_pipeline.sh SRR12701856 current disk space = 3057598922752 free memory = 1185104908 SRR12701856 SRAfilesize b6029b008ad1e434660b9268d57397cf SRR12701856.sra SRR12701856.sra file validated SRR12701856 is paired end SRR12701856 is conventional basespace SRR12701856 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29 37.0 37.0 37.0 37.0 37.0 2 36.27875 37.0 37.0 37.0 37.0 37.0 3 36.3045 37.0 37.0 37.0 37.0 37.0 4 36.344 37.0 37.0 37.0 37.0 37.0 5 36.337 37.0 37.0 37.0 37.0 37.0 6 36.5295 37.0 37.0 37.0 37.0 37.0 7 36.479 37.0 37.0 37.0 37.0 37.0 8 36.3005 37.0 37.0 37.0 37.0 37.0 9 36.551 37.0 37.0 37.0 37.0 37.0 10-14 36.5099 37.0 37.0 37.0 37.0 37.0 15-19 36.4657 37.0 37.0 37.0 37.0 37.0 20-24 36.4012 37.0 37.0 37.0 37.0 37.0 25-29 36.408100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3282 37.0 37.0 37.0 37.0 37.0 35-39 36.32899999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.1542 37.0 37.0 37.0 37.0 37.0 45-49 36.2392 37.0 37.0 37.0 37.0 37.0 50-54 36.196000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1919 37.0 37.0 37.0 37.0 37.0 60-64 36.14790000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.0655 37.0 37.0 37.0 37.0 37.0 70-74 36.0837 37.0 37.0 37.0 37.0 37.0 75-79 36.0246 37.0 37.0 37.0 37.0 37.0 80-84 36.0874 37.0 37.0 37.0 37.0 37.0 85-89 35.9898 37.0 37.0 37.0 37.0 37.0 90-94 35.928399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.91160000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.89241550007311 37.0 37.0 37.0 37.0 37.0 105-109 35.91020519016075 37.0 37.0 37.0 37.0 37.0 110-114 35.87945959469602 37.0 37.0 37.0 37.0 37.0 115-119 35.84469219483695 37.0 37.0 37.0 37.0 37.0 120-124 35.75669630187696 37.0 37.0 37.0 37.0 37.0 125-129 35.653779908430586 37.0 37.0 37.0 37.0 37.0 130-134 35.6829371631991 37.0 37.0 37.0 37.0 37.0 135-139 35.60240987633144 37.0 37.0 37.0 34.6 37.0 140-144 35.62619848923799 37.0 37.0 37.0 37.0 37.0 145-149 35.460492826004625 37.0 37.0 37.0 37.0 37.0 150 35.222278609489976 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 3.0 25 9.0 26 7.0 27 10.0 28 14.0 29 26.0 30 32.0 31 37.0 32 68.0 33 84.0 34 148.0 35 426.0 36 2933.0 37 200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.337668834417208 19.43471735867934 19.5847923961981 35.64282141070535 2 23.20580145036259 28.982245561390346 34.7586896724181 13.053263315828959 3 19.675 33.225 25.55 21.55 4 22.25 37.724999999999994 20.575 19.45 5 21.65 38.05 21.625 18.675 6 16.975 37.375 24.45 21.2 7 15.125 16.675 44.925 23.275000000000002 8 19.375 21.125 30.3 29.2 9 21.125 20.45 31.25 27.175 10-14 20.085 28.660000000000004 27.85 23.405 15-19 20.655 28.26 27.650000000000002 23.435 20-24 21.605 28.58 27.82 21.995 25-29 21.240000000000002 28.565 28.025 22.17 30-34 21.2 28.970000000000002 27.474999999999998 22.355 35-39 21.505 28.345 27.605 22.545 40-44 21.83 27.875 27.66 22.634999999999998 45-49 21.75 28.665000000000003 28.51 21.075 50-54 21.44 28.194999999999997 28.24 22.125 55-59 21.98 28.444999999999997 27.55 22.025 60-64 21.205 29.035 27.73 22.03 65-69 22.27 28.285 27.72 21.725 70-74 21.099999999999998 28.73 27.68 22.49 75-79 21.23 28.325 27.339999999999996 23.105 80-84 22.64 27.894999999999996 27.495000000000005 21.97 85-89 21.68 28.265 27.375 22.68 90-94 21.625 27.57 28.444999999999997 22.36 95-99 21.529999999999998 27.6 28.04 22.830000000000002 100-104 22.057720202070723 27.89476316710849 27.794728154854198 22.25278847596659 105-109 22.042123167742258 28.05042773525439 27.965380959527742 21.942068137475612 110-114 21.92144108081061 28.461346009507132 27.565674255691768 22.051538653990495 115-119 22.32858861267041 27.806736166800324 27.866880513231756 21.997794707297512 120-124 21.45115158813789 27.939184103567666 28.53128606553264 22.078378242761804 125-129 22.07707380796865 28.28719288549465 27.19188062101191 22.443852685524796 130-134 21.964240745404183 27.992948879375472 27.806597834298664 22.23621254092168 135-139 21.834964188439425 27.94310501361848 28.41722990013114 21.804700897810957 140-144 22.414838774891336 27.322349135752553 28.21692105529162 22.04589103406449 145-149 22.602079634795842 28.318539183362923 27.517118944965762 21.562262236875476 150 22.151738137528547 27.810200456736865 28.140065973103273 21.897995432631312 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 3.0 25 5.5 26 5.5 27 9.0 28 15.0 29 21.5 30 28.5 31 30.5 32 38.5 33 52.5 34 61.0 35 72.5 36 93.5 37 113.0 38 130.0 39 160.5 40 200.5 41 224.5 42 237.0 43 261.5 44 264.0 45 260.5 46 260.0 47 243.5 48 207.5 49 179.0 50 174.5 51 145.5 52 109.0 53 83.5 54 70.0 55 62.0 56 44.0 57 27.5 58 18.0 59 16.5 60 15.5 61 10.0 62 7.0 63 5.0 64 7.0 65 6.5 66 3.5 67 3.0 68 3.0 69 2.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 1.0 100-101 0.0 102-103 1.0 104-105 0.0 106-107 0.0 108-109 1.0 110-111 0.0 112-113 0.0 114-115 4.0 116-117 4.0 118-119 2.0 120-121 2.0 122-123 0.0 124-125 3.0 126-127 4.0 128-129 3.0 130-131 3.0 132-133 5.0 134-135 1.0 136-137 1.0 138-139 6.0 140-141 0.0 142-143 6.0 144-145 12.0 146-147 0.0 148-149 0.0 150-151 3941.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.05 #Duplication Level Percentage of deduplicated Percentage of total 1 84.95002939447383 72.25 2 12.815990593768372 21.8 3 1.9988242210464433 5.1 4 0.1763668430335097 0.6 5 0.058788947677836566 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAGGAAACAATCTCAAATGGAGCAAGGCCTGCCTGTCCATCTAAATTGA 5 0.125 No Hit CAAGTTCTAGCCAGAACATAAAACACGCGTTGCAGGAATTGGAGACTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTTA 10 0.006973645 144.0 5 CCTACTG 10 0.006973645 144.0 2 GCCTACT 10 0.006973645 144.0 1 TACTGTT 10 0.006973645 144.0 4 CTGTTAT 10 0.006973645 144.0 6 CTACTGT 10 0.006973645 144.0 3 >>END_MODULE SRR12701856 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9085 37.0 37.0 37.0 37.0 37.0 2 35.923 37.0 37.0 37.0 37.0 37.0 3 35.999 37.0 37.0 37.0 37.0 37.0 4 35.998 37.0 37.0 37.0 37.0 37.0 5 35.974 37.0 37.0 37.0 37.0 37.0 6 35.9945 37.0 37.0 37.0 37.0 37.0 7 36.09 37.0 37.0 37.0 37.0 37.0 8 35.9545 37.0 37.0 37.0 37.0 37.0 9 36.2285 37.0 37.0 37.0 37.0 37.0 10-14 35.9985 37.0 37.0 37.0 37.0 37.0 15-19 36.0837 37.0 37.0 37.0 37.0 37.0 20-24 36.0613 37.0 37.0 37.0 37.0 37.0 25-29 35.9541 37.0 37.0 37.0 37.0 37.0 30-34 35.986399999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.8805 37.0 37.0 37.0 37.0 37.0 40-44 35.8966 37.0 37.0 37.0 37.0 37.0 45-49 35.79109999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.73 37.0 37.0 37.0 37.0 37.0 55-59 35.6613 37.0 37.0 37.0 37.0 37.0 60-64 35.69500000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.6506 37.0 37.0 37.0 37.0 37.0 70-74 35.534800000000004 37.0 37.0 37.0 34.6 37.0 75-79 35.44029999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.3822 37.0 37.0 37.0 32.2 37.0 85-89 35.484500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.369099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.3914 37.0 37.0 37.0 32.2 37.0 100-104 35.187570679563336 37.0 37.0 37.0 27.4 37.0 105-109 35.256034872577644 37.0 37.0 37.0 29.8 37.0 110-114 35.310432824618466 37.0 37.0 37.0 32.2 37.0 115-119 35.048355132740305 37.0 37.0 37.0 25.0 37.0 120-124 34.971609739180565 37.0 37.0 37.0 25.0 37.0 125-129 34.992739958080705 37.0 37.0 37.0 25.0 37.0 130-134 34.916891545033565 37.0 37.0 37.0 25.0 37.0 135-139 34.90508953454139 37.0 37.0 37.0 25.0 37.0 140-144 35.010783590992475 37.0 37.0 37.0 25.0 37.0 145-149 34.805954225740834 37.0 37.0 37.0 25.0 37.0 150 34.869068764273024 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 2.0 22 0.0 23 5.0 24 12.0 25 8.0 26 14.0 27 14.0 28 17.0 29 26.0 30 35.0 31 63.0 32 85.0 33 166.0 34 334.0 35 1012.0 36 2104.0 37 99.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.2 20.1 18.175 36.525 2 23.875 28.95 33.75 13.425 3 21.575 32.925 25.025 20.474999999999998 4 21.15 37.35 19.975 21.525 5 21.9 38.025 22.425 17.65 6 16.35 38.3 22.925 22.425 7 15.825 16.25 43.125 24.8 8 19.5 21.45 28.849999999999998 30.2 9 20.375 22.5 28.050000000000004 29.075 10-14 20.34 28.689999999999998 28.189999999999998 22.78 15-19 20.549999999999997 28.375 28.15 22.925 20-24 21.26 28.715000000000003 27.224999999999998 22.8 25-29 20.775 29.599999999999998 27.735 21.89 30-34 20.47 28.310000000000002 28.044999999999998 23.175 35-39 21.17 29.299999999999997 27.985 21.545 40-44 21.97 28.485 26.86 22.685 45-49 21.61 29.38 26.91 22.1 50-54 21.355 29.2 27.089999999999996 22.355 55-59 21.695 28.810000000000002 27.71 21.785 60-64 21.66 28.425 26.845000000000002 23.07 65-69 21.38 29.744999999999997 26.805 22.07 70-74 22.3 28.955 26.884999999999998 21.86 75-79 22.27 28.310000000000002 27.575 21.845 80-84 21.775 28.37 27.63 22.225 85-89 22.09 27.685 28.444999999999997 21.78 90-94 21.94 28.685 27.229999999999997 22.145 95-99 21.785 28.065 27.750000000000004 22.400000000000002 100-104 21.887660681238433 27.72970539688891 28.15985594958235 22.222777972290302 105-109 22.342288258542197 27.885336935314424 27.565160838461157 22.207213967682225 110-114 21.78633975481611 28.10607955966975 28.016012009006758 22.091568676507382 115-119 21.6369286287089 28.11748195669607 27.70148356054531 22.54410585404972 120-124 22.389482663455265 28.777158914145218 26.910532389984443 21.922826032415074 125-129 21.428930312013264 28.19172988996634 28.106315630809426 22.273024167210973 130-134 21.73759758247293 28.546965499874087 27.574918156635608 22.140518761017375 135-139 22.33430848380914 28.119640875617876 27.584989407848283 21.961061232724706 140-144 22.071161427271807 28.075406853330637 27.863135550389163 21.99029616900839 145-149 22.424549835150902 28.33375602333249 27.65407050469186 21.587623636824752 150 23.471200202994165 26.389241309312357 28.089317432123828 22.050241055569654 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 3.5 24 5.0 25 3.5 26 4.0 27 9.0 28 14.0 29 20.0 30 25.0 31 27.5 32 36.5 33 52.5 34 58.0 35 71.0 36 90.0 37 124.5 38 158.5 39 170.0 40 200.5 41 226.0 42 238.0 43 265.5 44 305.0 45 275.5 46 231.5 47 216.0 48 187.5 49 167.5 50 156.5 51 145.5 52 109.5 53 77.0 54 65.5 55 60.0 56 46.5 57 30.5 58 24.5 59 21.0 60 14.5 61 8.0 62 7.5 63 7.0 64 6.0 65 7.0 66 4.5 67 2.5 68 1.5 69 2.0 70 2.0 71 3.0 72 3.0 73 0.5 74 1.0 75 1.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 1.0 100-101 0.0 102-103 1.0 104-105 0.0 106-107 0.0 108-109 1.0 110-111 0.0 112-113 0.0 114-115 4.0 116-117 4.0 118-119 2.0 120-121 2.0 122-123 0.0 124-125 3.0 126-127 4.0 128-129 3.0 130-131 3.0 132-133 5.0 134-135 1.0 136-137 1.0 138-139 6.0 140-141 0.0 142-143 6.0 144-145 12.0 146-147 0.0 148-149 0.0 150-151 3941.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.375 #Duplication Level Percentage of deduplicated Percentage of total 1 85.35871156661786 72.875 2 12.474377745241581 21.3 3 1.903367496339678 4.875 4 0.20497803806734993 0.7000000000000001 5 0.05856515373352855 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTCGACATGAGCACCTTCACCCAACTGCCTCTGCCTTGAAACAAAAGAT 5 0.125 No Hit AAGCACAAGAGAAGAGAAGAGAAGAGAAGTGAAGATGGGATTTGAAGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGTC 10 0.006973645 144.0 6 GAATCAT 10 0.006973645 144.0 6 ATCATGG 10 0.006973645 144.0 8 TGAATCA 10 0.006973645 144.0 5 TAGATTT 10 0.006973645 144.0 5 >>END_MODULE Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073838 spots for SRR12701856.sra Written 1073838 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra Read 1073836 spots for SRR12701856.sra Written 1073836 spots for SRR12701856.sra SRR ids: ['SRR12701856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3g35qbso SRR12701856.sra spots: 21476722 blocks: [[1, 1073836], [1073837, 2147672], [2147673, 3221508], [3221509, 4295344], [4295345, 5369180], [5369181, 6443016], [6443017, 7516852], [7516853, 8590688], [8590689, 9664524], [9664525, 10738360], [10738361, 11812196], [11812197, 12886032], [12886033, 13959868], [13959869, 15033704], [15033705, 16107540], [16107541, 17181376], [17181377, 18255212], [18255213, 19329048], [19329049, 20402884], [20402885, 21476722]] SRR12701856 file size 7224274 SRR12701856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701856 SRR12701856_1.fastq SRR12701856_2.fastq Input file: SRR12701856_1.fastq Paired file: SRR12701856_2.fastq trimmed: SRR12701856-trimmed-pair1.fastq, SRR12701856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:36:26 2025 >> started Mon Feb 10 23:36:51 2025 >> done (24.738s) 21476722 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 8 ( 0.00%) empty read pairs filtered out after trimming by size control 21476714 (100.00%) read pairs available; of these: 53959 ( 0.25%) trimmed read pairs available after processing 21422755 (99.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 0 0.00% 29 4 0.00% 30 1 0.00% 31 3 0.00% 32 5 0.00% 33 3 0.00% 34 7 0.00% 35 7 0.00% 36 3 0.00% 37 6 0.00% 38 7 0.00% 39 6 0.00% 40 5 0.00% 41 8 0.00% 42 2 0.00% 43 10 0.00% 44 4 0.00% 45 9 0.00% 46 5 0.00% 47 5 0.00% 48 3 0.00% 49 10 0.00% 50 1 0.00% 51 3 0.00% 52 5 0.00% 53 6 0.00% 54 6 0.00% 55 1 0.00% 56 3 0.00% 57 6 0.00% 58 9 0.00% 59 7 0.00% 60 7 0.00% 61 8 0.00% 62 8 0.00% 63 10 0.00% 64 7 0.00% 65 6 0.00% 66 7 0.00% 67 13 0.00% 68 11 0.00% 69 9 0.00% 70 6 0.00% 71 13 0.00% 72 10 0.00% 73 9 0.00% 74 2 0.00% 75 7 0.00% 76 6 0.00% 77 7 0.00% 78 6 0.00% 79 5 0.00% 80 12 0.00% 81 12 0.00% 82 13 0.00% 83 7 0.00% 84 14 0.00% 85 11 0.00% 86 12 0.00% 87 11 0.00% 88 8 0.00% 89 6 0.00% 90 13 0.00% 91 14 0.00% 92 11 0.00% 93 14 0.00% 94 14 0.00% 95 9 0.00% 96 7 0.00% 97 20 0.00% 98 12 0.00% 99 1502 0.01% 100 1680 0.01% 101 1769 0.01% 102 1855 0.01% 103 1907 0.01% 104 2025 0.01% 105 2095 0.01% 106 2194 0.01% 107 2416 0.01% 108 2557 0.01% 109 2514 0.01% 110 2711 0.01% 111 2974 0.01% 112 3090 0.01% 113 3213 0.01% 114 3372 0.02% 115 3647 0.02% 116 3725 0.02% 117 3841 0.02% 118 4184 0.02% 119 4229 0.02% 120 4544 0.02% 121 4623 0.02% 122 4849 0.02% 123 5008 0.02% 124 5338 0.02% 125 5750 0.03% 126 5698 0.03% 127 6045 0.03% 128 6289 0.03% 129 6672 0.03% 130 6873 0.03% 131 7015 0.03% 132 7486 0.03% 133 7845 0.04% 134 8205 0.04% 135 8560 0.04% 136 8846 0.04% 137 90 0.00% 138 8941 0.04% 139 9400 0.04% 140 9840 0.05% 141 10265 0.05% 142 11025 0.05% 143 12539 0.06% 144 17771 0.08% 145 64167 0.30% 146 12330 0.06% 147 12720 0.06% 148 13301 0.06% 149 13814 0.06% 150 21112816 98.31% 21476714 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=38 prefix-density=0.28 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=170.84 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=25.0 sequence=CAGCAGCAGCAA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.0 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=168.92 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=25.5 sequence=CAGCAGCAGCAA SRR12701856 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:38:06 Started mapping on | Feb 10 23:38:06 Finished on | Feb 10 23:41:41 Mapping speed, Million of reads per hour | 359.61 Number of input reads | 21476714 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19319456 Uniquely mapped reads % | 89.96% Average mapped length | 287.55 Number of splices: Total | 16826204 Number of splices: Annotated (sjdb) | 16278812 Number of splices: GT/AG | 16470065 Number of splices: GC/AG | 215612 Number of splices: AT/AC | 22995 Number of splices: Non-canonical | 117532 Mismatch rate per base, % | 1.24% Deletion rate per base | 0.10% Deletion average length | 3.36 Insertion rate per base | 0.08% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1013236 % of reads mapped to multiple loci | 4.72% Number of reads mapped to too many loci | 106312 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.57% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1144022 1144022 1144022 N_multimapping 1013236 1013236 1013236 N_noFeature 791659 9951090 10071026 N_ambiguous 249745 80820 81095 UnstrandedReadsAssigned:18278052 PositiveStrandReadsAssigned:9287546 NegativeStrandReadsAssigned:9167335 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR12701856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701856-trimmed-pair1.fastq SRR12701856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,476,714 reads, 18,196,361 reads pseudoaligned [quant] estimated average fragment length: 250.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR12701856.ke.tsv 34699 SRR12701856.se.tsv 87100 total ==> SRR12701856.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.73 1405 36.5446 Potri.005G024800.1.v4.1 1035 785.726 10272 601.439 Potri.004G059700.1.v4.1 961 711.726 39 2.52092 Potri.007G009000.2.v4.1 1416 1166.73 0 0 Potri.003G141000.2.v4.1 2943 2693.73 1120.33 19.1338 Potri.016G087400.1.v4.1 270 53.0732 810.183 702.29 Potri.015G069301.1.v4.1 564 314.963 0 0 Potri.010G195200.1.v4.1 1773 1523.73 44 1.32848 Potri.012G127500.1.v4.1 977 727.726 5758 364.009 ==> SRR12701856.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 92 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 507 SRR12701856 completed mapping pipeline successfully