Starting /dee2/code/volunteer_pipeline.sh SRR12701857 current disk space = 3057334521856 free memory = 1576540800 SRR12701857 SRAfilesize f40ae44e430024bdc5dbd32300ad0071 SRR12701857.sra SRR12701857.sra file validated SRR12701857 is paired end SRR12701857 is conventional basespace SRR12701857 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45375 37.0 37.0 37.0 37.0 37.0 2 36.48425 37.0 37.0 37.0 37.0 37.0 3 36.505 37.0 37.0 37.0 37.0 37.0 4 36.4635 37.0 37.0 37.0 37.0 37.0 5 36.481 37.0 37.0 37.0 37.0 37.0 6 36.4595 37.0 37.0 37.0 37.0 37.0 7 36.4 37.0 37.0 37.0 37.0 37.0 8 36.587 37.0 37.0 37.0 37.0 37.0 9 36.5855 37.0 37.0 37.0 37.0 37.0 10-14 36.4894 37.0 37.0 37.0 37.0 37.0 15-19 36.4864 37.0 37.0 37.0 37.0 37.0 20-24 36.461400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.416799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.409400000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.320100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3072 37.0 37.0 37.0 37.0 37.0 45-49 36.3282 37.0 37.0 37.0 37.0 37.0 50-54 36.3078 37.0 37.0 37.0 37.0 37.0 55-59 36.2483 37.0 37.0 37.0 37.0 37.0 60-64 36.2547 37.0 37.0 37.0 37.0 37.0 65-69 36.2057 37.0 37.0 37.0 37.0 37.0 70-74 36.1577 37.0 37.0 37.0 37.0 37.0 75-79 36.173500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1749 37.0 37.0 37.0 37.0 37.0 85-89 36.1059 37.0 37.0 37.0 37.0 37.0 90-94 36.0409 37.0 37.0 37.0 37.0 37.0 95-99 36.065999999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.033803225806444 37.0 37.0 37.0 37.0 37.0 105-109 35.9197155963012 37.0 37.0 37.0 37.0 37.0 110-114 35.956309121703605 37.0 37.0 37.0 37.0 37.0 115-119 35.919775405199644 37.0 37.0 37.0 37.0 37.0 120-124 35.82370232314245 37.0 37.0 37.0 37.0 37.0 125-129 35.90678294860685 37.0 37.0 37.0 37.0 37.0 130-134 35.763171948070976 37.0 37.0 37.0 37.0 37.0 135-139 35.69435084254354 37.0 37.0 37.0 37.0 37.0 140-144 35.690747315915516 37.0 37.0 37.0 37.0 37.0 145-149 35.63436317552837 37.0 37.0 37.0 37.0 37.0 150 35.5805138641567 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 6.0 27 13.0 28 21.0 29 32.0 30 39.0 31 54.0 32 57.0 33 62.0 34 108.0 35 312.0 36 2996.0 37 296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.319739804853644 18.663997998498875 17.68826619964974 37.32799599699775 2 22.316737553164874 28.621466099574683 34.92619464598449 14.135601701275958 3 22.375 30.95 27.425 19.25 4 22.05 37.05 21.325 19.575 5 21.125 38.95 22.0 17.925 6 17.125 36.4 26.125 20.349999999999998 7 15.875 16.3 44.5 23.325000000000003 8 18.675 22.650000000000002 29.299999999999997 29.375 9 21.0 22.625 30.025000000000002 26.35 10-14 21.16 28.754999999999995 27.55 22.535 15-19 21.215 28.005000000000003 28.32 22.46 20-24 21.705 28.64 27.200000000000003 22.455 25-29 21.355 29.244999999999997 27.675 21.725 30-34 20.995 29.080000000000002 27.939999999999998 21.985 35-39 21.51 27.939999999999998 28.065 22.485 40-44 21.875 28.599999999999998 27.61 21.915000000000003 45-49 21.505 28.895 27.01 22.59 50-54 21.92 28.854999999999997 27.105 22.12 55-59 22.195 28.62 27.42 21.765 60-64 21.93 28.189999999999998 27.6 22.28 65-69 21.665 28.76 27.450000000000003 22.125 70-74 21.995 28.299999999999997 27.189999999999998 22.515 75-79 21.555 28.665000000000003 27.089999999999996 22.689999999999998 80-84 21.875 28.685 27.474999999999998 21.965 85-89 21.755 28.315 27.060000000000002 22.869999999999997 90-94 22.41 27.650000000000002 27.639999999999997 22.3 95-99 22.07 27.99 27.615000000000002 22.325 100-104 21.839367873574712 28.170634126825366 27.310462092418486 22.679535907181435 105-109 21.744785153318993 28.302736231304088 27.622430093542093 22.330048521834826 110-114 22.47084146768784 28.06727736897432 27.756920458527308 21.70496070481053 115-119 22.393590385578367 27.901852779168753 27.746619929894845 21.957936905358036 120-124 21.77116223124342 28.21129654688518 27.87049566481231 22.14704555705909 125-129 22.08216151064685 28.073523503415025 27.963037364403377 21.881277621534753 130-134 22.396016697681436 27.968616405974956 28.003822360810744 21.631544535532868 135-139 22.44640605296343 27.979823455233294 28.030264817150062 21.543505674653215 140-144 21.989475814612426 28.455778182554138 27.615867233353576 21.938878769479864 145-149 22.27984543420785 28.304860687411022 27.59812894041082 21.817164937970308 150 21.59755787331468 27.906385143729327 29.94149071483083 20.55456626812516 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.5 22 2.0 23 0.5 24 3.0 25 4.0 26 6.0 27 13.0 28 14.0 29 13.0 30 16.0 31 20.5 32 35.0 33 53.0 34 64.5 35 80.5 36 94.0 37 100.5 38 131.0 39 164.5 40 204.5 41 228.5 42 234.0 43 244.5 44 280.0 45 287.5 46 242.0 47 230.5 48 233.5 49 203.0 50 149.0 51 112.0 52 95.5 53 88.0 54 81.5 55 72.5 56 55.5 57 38.5 58 25.0 59 18.0 60 12.5 61 7.0 62 7.5 63 7.5 64 4.5 65 3.0 66 3.0 67 1.5 68 1.5 69 3.5 70 2.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 0.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 2.0 112-113 0.0 114-115 1.0 116-117 0.0 118-119 1.0 120-121 1.0 122-123 5.0 124-125 3.0 126-127 3.0 128-129 3.0 130-131 1.0 132-133 4.0 134-135 6.0 136-137 4.0 138-139 5.0 140-141 5.0 142-143 5.0 144-145 17.0 146-147 0.0 148-149 0.0 150-151 3931.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.05 #Duplication Level Percentage of deduplicated Percentage of total 1 83.75966686496133 70.39999999999999 2 13.86079714455681 23.3 3 2.0820939916716243 5.25 4 0.2379535990481856 0.8 5 0.0594883997620464 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TAGAAAGTACACTTGTATGGTCCGAAGGAAGAAGTGACTGGCAGCCATTG 5 0.125 No Hit CCACATTCTCCAGTAAATACACCCGAATTATATAACTGGAAATTTCTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTGC 10 0.007057572 143.42499 4 >>END_MODULE SRR12701857 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.223 37.0 37.0 37.0 37.0 37.0 2 36.163 37.0 37.0 37.0 37.0 37.0 3 36.246 37.0 37.0 37.0 37.0 37.0 4 36.201 37.0 37.0 37.0 37.0 37.0 5 36.364 37.0 37.0 37.0 37.0 37.0 6 36.305 37.0 37.0 37.0 37.0 37.0 7 36.438 37.0 37.0 37.0 37.0 37.0 8 36.4105 37.0 37.0 37.0 37.0 37.0 9 36.3835 37.0 37.0 37.0 37.0 37.0 10-14 36.3552 37.0 37.0 37.0 37.0 37.0 15-19 36.2562 37.0 37.0 37.0 37.0 37.0 20-24 36.3124 37.0 37.0 37.0 37.0 37.0 25-29 36.1981 37.0 37.0 37.0 37.0 37.0 30-34 36.22769999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.186 37.0 37.0 37.0 37.0 37.0 40-44 36.1719 37.0 37.0 37.0 37.0 37.0 45-49 36.13779999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1339 37.0 37.0 37.0 37.0 37.0 55-59 36.1034 37.0 37.0 37.0 37.0 37.0 60-64 36.0456 37.0 37.0 37.0 37.0 37.0 65-69 36.006 37.0 37.0 37.0 37.0 37.0 70-74 36.011 37.0 37.0 37.0 37.0 37.0 75-79 35.9367 37.0 37.0 37.0 37.0 37.0 80-84 35.8488 37.0 37.0 37.0 37.0 37.0 85-89 35.9505 37.0 37.0 37.0 37.0 37.0 90-94 35.789 37.0 37.0 37.0 37.0 37.0 95-99 35.8057 37.0 37.0 37.0 37.0 37.0 100-104 35.83826834208553 37.0 37.0 37.0 37.0 37.0 105-109 35.751028744742754 37.0 37.0 37.0 37.0 37.0 110-114 35.67136324709114 37.0 37.0 37.0 37.0 37.0 115-119 35.598413055971854 37.0 37.0 37.0 37.0 37.0 120-124 35.710774143526386 37.0 37.0 37.0 37.0 37.0 125-129 35.51527949532897 37.0 37.0 37.0 37.0 37.0 130-134 35.4925104575275 37.0 37.0 37.0 34.6 37.0 135-139 35.47391905120479 37.0 37.0 37.0 37.0 37.0 140-144 35.30424237170085 37.0 37.0 37.0 32.2 37.0 145-149 35.4938685220665 37.0 37.0 37.0 37.0 37.0 150 35.40396845586365 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 5.0 25 7.0 26 8.0 27 11.0 28 18.0 29 15.0 30 25.0 31 39.0 32 65.0 33 90.0 34 184.0 35 687.0 36 2659.0 37 182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.025 18.65 18.5 37.824999999999996 2 22.05 29.375 34.8 13.775 3 20.674999999999997 32.1 26.5 20.724999999999998 4 21.125 36.175000000000004 21.075 21.625 5 20.3 37.8 24.349999999999998 17.549999999999997 6 16.075 37.55 24.825 21.55 7 15.65 16.975 43.15 24.224999999999998 8 20.349999999999998 23.125 29.325000000000003 27.200000000000003 9 21.15 23.425 28.925 26.5 10-14 20.13 28.465 27.875 23.53 15-19 21.05 27.534999999999997 28.415000000000003 23.0 20-24 20.785 28.615000000000002 28.07 22.53 25-29 21.13 28.685 27.700000000000003 22.485 30-34 20.25 28.57 28.405 22.775000000000002 35-39 21.23 29.005 27.415 22.35 40-44 20.93 28.365000000000002 27.994999999999997 22.71 45-49 21.38 28.975 27.36 22.285 50-54 21.195 28.345 28.249999999999996 22.21 55-59 20.865000000000002 29.115000000000002 27.575 22.445 60-64 21.125 28.12 28.42 22.335 65-69 21.07 28.560000000000002 27.855 22.515 70-74 21.105 28.689999999999998 26.965 23.24 75-79 21.404999999999998 28.305000000000003 27.6 22.689999999999998 80-84 22.009999999999998 28.435 27.089999999999996 22.465 85-89 21.705 28.455000000000002 27.815 22.025 90-94 21.73 28.675 27.21 22.384999999999998 95-99 21.654999999999998 28.685 27.575 22.085 100-104 21.729345869173837 28.675735147029407 27.375475095019002 22.219443888777757 105-109 22.019908959031564 28.532839777900055 27.257265769596316 22.18998549347206 110-114 21.870150673274267 27.711868648946286 28.00220253291285 22.415778144866596 115-119 22.819228843264895 27.621432148222336 27.30595893840761 22.25338007010516 120-124 21.525585125043854 28.476920763794915 27.299153009572496 22.698341101588735 125-129 21.715548413017277 28.219164323021296 28.16894335074327 21.89634391321816 130-134 21.747221244279032 27.91832218478097 28.295528843735855 22.038927727204143 135-139 22.330390920554855 27.364438839848678 27.843631778058008 22.46153846153846 140-144 21.974296701072657 28.445658773527626 27.367941712204008 22.21210281319571 145-149 21.390075249135652 27.969290217612365 28.248932275777918 22.39170225747407 150 21.444924955482065 28.873060290002545 28.796743831086236 20.885270923429154 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 3.5 25 5.0 26 5.5 27 7.0 28 12.5 29 20.0 30 22.0 31 25.0 32 30.5 33 46.5 34 68.0 35 81.5 36 103.5 37 127.0 38 154.5 39 179.0 40 183.0 41 212.0 42 259.5 43 263.0 44 262.0 45 271.5 46 256.5 47 224.0 48 197.0 49 191.0 50 155.0 51 124.0 52 115.5 53 91.0 54 72.0 55 52.5 56 44.5 57 40.5 58 27.5 59 20.5 60 14.5 61 12.5 62 8.5 63 1.5 64 1.5 65 1.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 0.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 2.0 112-113 0.0 114-115 1.0 116-117 0.0 118-119 1.0 120-121 1.0 122-123 5.0 124-125 3.0 126-127 3.0 128-129 3.0 130-131 1.0 132-133 4.0 134-135 6.0 136-137 4.0 138-139 5.0 140-141 5.0 142-143 5.0 144-145 17.0 146-147 0.0 148-149 0.0 150-151 3931.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 84.39255099024534 71.375 2 13.331362695832102 22.55 3 1.9804906887378066 5.025 4 0.23647650014779784 0.8 5 0.05911912503694946 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTTCTCAAACTCATCTTCATCATCGTTGGAAGACACTAAAGTAGAA 5 0.125 No Hit GGTAGATGTGACACGTACAGGAAAAATGCCAAAGTTGTTTCAATCGATTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCCAA 10 0.007057572 143.42499 8 >>END_MODULE Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274838 spots for SRR12701857.sra Written 1274838 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra Read 1274828 spots for SRR12701857.sra Written 1274828 spots for SRR12701857.sra SRR ids: ['SRR12701857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m5bza4mq SRR12701857.sra spots: 25496570 blocks: [[1, 1274828], [1274829, 2549656], [2549657, 3824484], [3824485, 5099312], [5099313, 6374140], [6374141, 7648968], [7648969, 8923796], [8923797, 10198624], [10198625, 11473452], [11473453, 12748280], [12748281, 14023108], [14023109, 15297936], [15297937, 16572764], [16572765, 17847592], [17847593, 19122420], [19122421, 20397248], [20397249, 21672076], [21672077, 22946904], [22946905, 24221732], [24221733, 25496570]] SRR12701857 file size 8579774 SRR12701857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701857 SRR12701857_1.fastq SRR12701857_2.fastq Input file: SRR12701857_1.fastq Paired file: SRR12701857_2.fastq trimmed: SRR12701857-trimmed-pair1.fastq, SRR12701857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:27:10 2025 >> started Tue Feb 11 00:27:48 2025 >> done (38.534s) 25496570 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 25496567 (100.00%) read pairs available; of these: 74519 ( 0.29%) trimmed read pairs available after processing 25422048 (99.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 4 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 6 0.00% 26 9 0.00% 27 4 0.00% 28 5 0.00% 29 10 0.00% 30 9 0.00% 31 10 0.00% 32 9 0.00% 33 8 0.00% 34 11 0.00% 35 9 0.00% 36 18 0.00% 37 14 0.00% 38 12 0.00% 39 15 0.00% 40 15 0.00% 41 11 0.00% 42 11 0.00% 43 9 0.00% 44 13 0.00% 45 18 0.00% 46 23 0.00% 47 9 0.00% 48 11 0.00% 49 18 0.00% 50 12 0.00% 51 9 0.00% 52 14 0.00% 53 22 0.00% 54 12 0.00% 55 22 0.00% 56 15 0.00% 57 11 0.00% 58 18 0.00% 59 14 0.00% 60 13 0.00% 61 10 0.00% 62 15 0.00% 63 12 0.00% 64 10 0.00% 65 22 0.00% 66 13 0.00% 67 13 0.00% 68 13 0.00% 69 23 0.00% 70 21 0.00% 71 12 0.00% 72 15 0.00% 73 18 0.00% 74 15 0.00% 75 17 0.00% 76 18 0.00% 77 13 0.00% 78 20 0.00% 79 16 0.00% 80 17 0.00% 81 17 0.00% 82 21 0.00% 83 12 0.00% 84 21 0.00% 85 20 0.00% 86 28 0.00% 87 12 0.00% 88 22 0.00% 89 21 0.00% 90 32 0.00% 91 23 0.00% 92 21 0.00% 93 20 0.00% 94 30 0.00% 95 14 0.00% 96 20 0.00% 97 16 0.00% 98 25 0.00% 99 1705 0.01% 100 1838 0.01% 101 1955 0.01% 102 2160 0.01% 103 2283 0.01% 104 2405 0.01% 105 2482 0.01% 106 2751 0.01% 107 2847 0.01% 108 2899 0.01% 109 3156 0.01% 110 3486 0.01% 111 3568 0.01% 112 3635 0.01% 113 3930 0.02% 114 4235 0.02% 115 4480 0.02% 116 4498 0.02% 117 4897 0.02% 118 5188 0.02% 119 5307 0.02% 120 5557 0.02% 121 6160 0.02% 122 6105 0.02% 123 6648 0.03% 124 6944 0.03% 125 7093 0.03% 126 7451 0.03% 127 7915 0.03% 128 7934 0.03% 129 8535 0.03% 130 8896 0.03% 131 9242 0.04% 132 9785 0.04% 133 10446 0.04% 134 10599 0.04% 135 11156 0.04% 136 11952 0.05% 137 101 0.00% 138 12181 0.05% 139 12423 0.05% 140 13204 0.05% 141 14069 0.06% 142 14693 0.06% 143 16149 0.06% 144 22886 0.09% 145 75082 0.29% 146 16993 0.07% 147 17693 0.07% 148 18175 0.07% 149 18980 0.07% 150 25030664 98.17% 25496567 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=29 prefix-density=0.32 prefix-fanout=2.1 sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=191.19 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=14.0 sequence=CTTCTCTCTGTCTTCTTGATTCCTTGTTTTTTCTTCTGTTTATTACAGCAGTCATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGCAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCAGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTGATAATACCAATATTTACTATGTGGAACTGTGTTCTACTGGGTTATAGTTTG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=33 prefix-density=0.33 prefix-fanout=2.1 sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=234.31 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=14.5 sequence=CTTCTCTCTGTCTTCTTGATTCCTTGTTTTTTCTTCTGTTTATTACAGCAGTCATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGCAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCAGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTGATAATACCAATATTTACTATGTGGAACTGTGTTCTACTGGGTTATAGTTTG SRR12701857 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:29:13 Started mapping on | Feb 11 00:29:13 Finished on | Feb 11 00:33:08 Mapping speed, Million of reads per hour | 390.59 Number of input reads | 25496567 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 23263544 Uniquely mapped reads % | 91.24% Average mapped length | 287.69 Number of splices: Total | 22958031 Number of splices: Annotated (sjdb) | 22267923 Number of splices: GT/AG | 22437325 Number of splices: GC/AG | 359374 Number of splices: AT/AC | 18807 Number of splices: Non-canonical | 142525 Mismatch rate per base, % | 1.23% Deletion rate per base | 0.10% Deletion average length | 3.45 Insertion rate per base | 0.08% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1116404 % of reads mapped to multiple loci | 4.38% Number of reads mapped to too many loci | 46297 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1116619 1116619 1116619 N_multimapping 1116404 1116404 1116404 N_noFeature 844435 11886854 11985057 N_ambiguous 425937 95762 95137 UnstrandedReadsAssigned:21993172 PositiveStrandReadsAssigned:11280928 NegativeStrandReadsAssigned:11183350 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR12701857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701857-trimmed-pair1.fastq SRR12701857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,496,567 reads, 21,655,314 reads pseudoaligned [quant] estimated average fragment length: 242.511 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR12701857.ke.tsv 34699 SRR12701857.se.tsv 87100 total ==> SRR12701857.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.49 1230 23.3688 Potri.005G024800.1.v4.1 1035 793.489 496 21.0977 Potri.004G059700.1.v4.1 961 719.509 10 0.469092 Potri.007G009000.2.v4.1 1416 1174.49 0 0 Potri.003G141000.2.v4.1 2943 2701.49 832.345 10.3991 Potri.016G087400.1.v4.1 270 54.5167 1502 929.897 Potri.015G069301.1.v4.1 564 322.736 0 0 Potri.010G195200.1.v4.1 1773 1531.49 61 1.34434 Potri.012G127500.1.v4.1 977 735.504 31 1.42256 ==> SRR12701857.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 85 SRR12701857 completed mapping pipeline successfully