Starting /dee2/code/volunteer_pipeline.sh SRR12701858 current disk space = 3057682362368 free memory = 1164963044 SRR12701858 SRAfilesize 0a1aed67af8c921df31bcd18a9662a10 SRR12701858.sra SRR12701858.sra file validated SRR12701858 is paired end SRR12701858 is conventional basespace SRR12701858 read1 length is 101-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33425 37.0 37.0 37.0 37.0 37.0 2 36.39325 37.0 37.0 37.0 37.0 37.0 3 36.4325 37.0 37.0 37.0 37.0 37.0 4 36.4085 37.0 37.0 37.0 37.0 37.0 5 36.4775 37.0 37.0 37.0 37.0 37.0 6 36.504 37.0 37.0 37.0 37.0 37.0 7 36.41725 37.0 37.0 37.0 37.0 37.0 8 36.535 37.0 37.0 37.0 37.0 37.0 9 36.5885 37.0 37.0 37.0 37.0 37.0 10-14 36.515100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4476 37.0 37.0 37.0 37.0 37.0 20-24 36.432399999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4216 37.0 37.0 37.0 37.0 37.0 30-34 36.347899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.313900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2758 37.0 37.0 37.0 37.0 37.0 45-49 36.227199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2485 37.0 37.0 37.0 37.0 37.0 55-59 36.21489999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1897 37.0 37.0 37.0 37.0 37.0 65-69 36.214 37.0 37.0 37.0 37.0 37.0 70-74 36.1549 37.0 37.0 37.0 37.0 37.0 75-79 36.1289 37.0 37.0 37.0 37.0 37.0 80-84 36.0951 37.0 37.0 37.0 37.0 37.0 85-89 36.108399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.0548 37.0 37.0 37.0 37.0 37.0 95-99 36.0215 37.0 37.0 37.0 37.0 37.0 100-104 36.02966389319941 37.0 37.0 37.0 37.0 37.0 105-109 35.90548348787661 37.0 37.0 37.0 37.0 37.0 110-114 35.93408485490246 37.0 37.0 37.0 37.0 37.0 115-119 35.89407616088208 37.0 37.0 37.0 37.0 37.0 120-124 35.88488196885987 37.0 37.0 37.0 37.0 37.0 125-129 35.9277032213193 37.0 37.0 37.0 37.0 37.0 130-134 35.77144560906978 37.0 37.0 37.0 37.0 37.0 135-139 35.67165896122371 37.0 37.0 37.0 37.0 37.0 140-144 35.62778425405667 37.0 37.0 37.0 37.0 37.0 145-149 35.67403546336827 37.0 37.0 37.0 37.0 37.0 150 35.59134860050891 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 3.0 25 3.0 26 8.0 27 13.0 28 14.0 29 25.0 30 38.0 31 47.0 32 53.0 33 84.0 34 109.0 35 328.0 36 3002.0 37 268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.356589147286826 18.204551137784446 19.4048512128032 36.03400850212553 2 23.028785982478098 27.359198998748436 36.02002503128911 13.591989987484354 3 22.125 31.65 27.075 19.15 4 22.475 36.5 20.974999999999998 20.05 5 22.2 38.1 22.975 16.725 6 17.45 38.45 24.825 19.275000000000002 7 16.754188547136785 16.204051012753187 44.18604651162791 22.85571392848212 8 20.674999999999997 22.225 28.199999999999996 28.9 9 21.55 23.400000000000002 29.375 25.674999999999997 10-14 21.345 28.785 27.26 22.61 15-19 21.525 28.084999999999997 27.279999999999998 23.11 20-24 21.065 28.67 28.02 22.245 25-29 21.044999999999998 29.165000000000003 27.915 21.875 30-34 21.02 28.93 27.57 22.48 35-39 21.515 28.694999999999997 28.005000000000003 21.785 40-44 20.925 28.79 27.735 22.55 45-49 21.515 28.044999999999998 27.77 22.67 50-54 21.39 28.075 27.889999999999997 22.645 55-59 21.755 28.799999999999997 27.955000000000002 21.490000000000002 60-64 21.465 28.455000000000002 27.750000000000004 22.33 65-69 22.075 27.685 28.144999999999996 22.095000000000002 70-74 22.53 27.889999999999997 27.21 22.37 75-79 21.485000000000003 28.025 27.794999999999998 22.695 80-84 22.02 28.265 27.565 22.15 85-89 22.025 29.21 26.69 22.075 90-94 21.625 29.015 27.37 21.990000000000002 95-99 21.935 28.439999999999998 26.99 22.634999999999998 100-104 22.015503875968992 27.73693423355839 28.107026756689173 22.140535133783445 105-109 21.96427677990694 27.788062240456295 27.607945164356835 22.63971581527993 110-114 22.377447298582943 28.30103650292925 27.71518702118071 21.606329177307096 115-119 21.872020075282308 27.904642409033876 28.130489335006274 22.092848180677542 120-124 22.089402310396785 27.553992968357612 27.900552486187845 22.45605223505776 125-129 21.980894922071393 28.195072900955253 27.74258421317245 22.081447963800905 130-134 22.15559810541167 27.607578353320566 28.318048977123855 21.91877456414391 135-139 22.047681583998383 28.79583796343065 27.401757753308413 21.75472269926255 140-144 21.792147338595427 28.319166160696213 27.560210483707753 22.328476017000607 145-149 22.122768651782536 28.6019427350862 27.818745867873673 21.45654274525759 150 21.984732824427482 28.77862595419847 28.422391857506362 20.814249363867685 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 3.5 25 5.0 26 11.5 27 11.5 28 12.5 29 18.0 30 20.5 31 23.5 32 31.5 33 40.5 34 51.5 35 75.5 36 98.0 37 122.0 38 149.0 39 172.0 40 215.0 41 227.0 42 217.5 43 258.5 44 273.0 45 257.0 46 241.5 47 239.0 48 233.0 49 181.5 50 155.5 51 138.5 52 96.5 53 86.5 54 83.5 55 56.0 56 50.0 57 39.5 58 19.0 59 24.0 60 17.5 61 7.0 62 8.0 63 6.0 64 2.0 65 1.5 66 2.0 67 2.0 68 1.5 69 1.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.5 75 1.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 1.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 1.0 112-113 4.0 114-115 5.0 116-117 2.0 118-119 2.0 120-121 0.0 122-123 0.0 124-125 1.0 126-127 5.0 128-129 3.0 130-131 4.0 132-133 4.0 134-135 5.0 136-137 1.0 138-139 3.0 140-141 2.0 142-143 6.0 144-145 18.0 146-147 0.0 148-149 0.0 150-151 3930.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.875 #Duplication Level Percentage of deduplicated Percentage of total 1 83.75558867362146 70.25 2 13.68107302533532 22.95 3 2.1460506706408347 5.4 4 0.4172876304023845 1.4000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAAC 10 0.007024571 143.65001 1 >>END_MODULE SRR12701858 read2 length is 101-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9455 37.0 37.0 37.0 37.0 37.0 2 35.84175 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 35.97 37.0 37.0 37.0 37.0 37.0 5 36.2435 37.0 37.0 37.0 37.0 37.0 6 36.09575 37.0 37.0 37.0 37.0 37.0 7 36.2135 37.0 37.0 37.0 37.0 37.0 8 36.29325 37.0 37.0 37.0 37.0 37.0 9 36.21775 37.0 37.0 37.0 37.0 37.0 10-14 36.214 37.0 37.0 37.0 37.0 37.0 15-19 36.1733 37.0 37.0 37.0 37.0 37.0 20-24 36.177499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.2034 37.0 37.0 37.0 37.0 37.0 30-34 36.214 37.0 37.0 37.0 37.0 37.0 35-39 36.0839 37.0 37.0 37.0 37.0 37.0 40-44 36.053599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.07449999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.055699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.064499999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9812 37.0 37.0 37.0 37.0 37.0 65-69 35.957899999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9401 37.0 37.0 37.0 37.0 37.0 75-79 35.9012 37.0 37.0 37.0 37.0 37.0 80-84 35.732 37.0 37.0 37.0 37.0 37.0 85-89 35.8774 37.0 37.0 37.0 37.0 37.0 90-94 35.6058 37.0 37.0 37.0 37.0 37.0 95-99 35.7781 37.0 37.0 37.0 37.0 37.0 100-104 35.744570501342196 37.0 37.0 37.0 37.0 37.0 105-109 35.694186662322224 37.0 37.0 37.0 37.0 37.0 110-114 35.52072918219726 37.0 37.0 37.0 37.0 37.0 115-119 35.502056372837885 37.0 37.0 37.0 34.6 37.0 120-124 35.68006027122049 37.0 37.0 37.0 37.0 37.0 125-129 35.472365244647136 37.0 37.0 37.0 37.0 37.0 130-134 35.4653529324062 37.0 37.0 37.0 34.6 37.0 135-139 35.375585931033186 37.0 37.0 37.0 37.0 37.0 140-144 35.27573917040538 37.0 37.0 37.0 29.8 37.0 145-149 35.4135292549879 37.0 37.0 37.0 32.2 37.0 150 35.29007633587786 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 4.0 25 7.0 26 10.0 27 16.0 28 14.0 29 30.0 30 27.0 31 55.0 32 50.0 33 103.0 34 220.0 35 761.0 36 2536.0 37 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.25 18.275 19.35 36.125 2 23.53088272068017 26.93173293323331 35.83395848962241 13.703425856464117 3 21.65 32.35 26.174999999999997 19.825 4 22.725 37.974999999999994 19.525000000000002 19.775000000000002 5 20.5 38.65 22.525000000000002 18.325 6 15.128782195548887 39.784946236559136 24.50612653163291 20.580145036259065 7 15.9 18.425 42.9 22.775000000000002 8 20.005001250312578 21.655413853463365 29.43235808952238 28.907226806701676 9 18.95473868467117 23.58089522380595 30.207551887971995 27.25681420355089 10-14 21.477147714771476 28.79287928792879 27.21272127212721 22.517251725172517 15-19 21.435000000000002 27.575 28.499999999999996 22.49 20-24 21.21 28.665000000000003 28.08 22.045 25-29 21.465 28.599999999999998 27.650000000000002 22.285 30-34 21.310000000000002 28.28 27.900000000000002 22.509999999999998 35-39 20.91709170917092 28.297829782978294 28.127812781278127 22.657265726572657 40-44 22.215 28.7 27.27 21.815 45-49 21.565 28.15 28.265 22.02 50-54 21.535 28.515 27.79 22.16 55-59 21.154999999999998 28.13 28.225 22.49 60-64 21.315 27.915 28.345 22.425 65-69 21.68 28.065 28.08 22.175 70-74 21.765 28.115000000000002 28.065 22.055 75-79 21.715 27.744999999999997 27.485 23.055 80-84 21.695 28.410000000000004 27.595 22.3 85-89 22.32 28.18 27.21 22.29 90-94 22.005 27.834999999999997 27.900000000000002 22.259999999999998 95-99 21.37 28.185 27.825 22.62 100-104 22.170542635658915 28.382095523880967 27.46686671667917 21.980495123780948 105-109 21.8653057139998 28.89022315620935 27.394175923146204 21.850295206644653 110-114 21.966851935306195 27.840368534374843 28.19087677131841 22.00190275900055 115-119 22.328732747804267 27.9297365119197 28.165621079046428 21.575909661229613 120-124 21.953792064289303 27.815168257157207 28.05123053741838 22.179809141135106 125-129 21.92559074912016 27.611865258924084 27.82302664655606 22.6395173453997 130-134 22.402499244180188 27.673082737075482 27.909906278343243 22.014511740401087 135-139 22.31033437720982 27.820992019395895 27.59874734821699 22.269926255177293 140-144 21.89840113337381 27.792956891317548 28.035822707953855 22.272819267354787 145-149 22.544881249046433 27.62040380409907 27.808574479987797 22.026140466866703 150 22.290076335877863 26.79389312977099 29.541984732824428 21.374045801526716 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 2.5 24 3.0 25 3.5 26 6.0 27 11.5 28 16.0 29 17.5 30 24.0 31 33.0 32 42.5 33 52.0 34 59.0 35 68.0 36 85.5 37 118.5 38 139.5 39 165.0 40 201.0 41 222.5 42 242.0 43 247.0 44 257.0 45 263.5 46 247.0 47 232.0 48 219.5 49 191.5 50 160.0 51 134.5 52 115.0 53 95.5 54 73.5 55 56.0 56 40.0 57 40.5 58 39.0 59 23.5 60 12.5 61 9.5 62 7.5 63 4.0 64 2.0 65 0.5 66 1.5 67 3.0 68 1.5 69 1.0 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.025 9 0.025 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0050032521138740176 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 1.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 1.0 112-113 4.0 114-115 5.0 116-117 2.0 118-119 2.0 120-121 0.0 122-123 0.0 124-125 1.0 126-127 5.0 128-129 3.0 130-131 4.0 132-133 4.0 134-135 5.0 136-137 1.0 138-139 3.0 140-141 2.0 142-143 6.0 144-145 18.0 146-147 0.0 148-149 0.0 150-151 3930.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.208964084298 70.92500000000001 2 13.238349658652417 22.3 3 2.196497476996141 5.55 4 0.3265063817156426 1.0999999999999999 5 0.029682398337785694 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAACTT 10 0.007024571 143.65001 2 >>END_MODULE Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201608 spots for SRR12701858.sra Written 1201608 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra Read 1201592 spots for SRR12701858.sra Written 1201592 spots for SRR12701858.sra SRR ids: ['SRR12701858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ey5c68u5 SRR12701858.sra spots: 24031856 blocks: [[1, 1201592], [1201593, 2403184], [2403185, 3604776], [3604777, 4806368], [4806369, 6007960], [6007961, 7209552], [7209553, 8411144], [8411145, 9612736], [9612737, 10814328], [10814329, 12015920], [12015921, 13217512], [13217513, 14419104], [14419105, 15620696], [15620697, 16822288], [16822289, 18023880], [18023881, 19225472], [19225473, 20427064], [20427065, 21628656], [21628657, 22830248], [22830249, 24031856]] SRR12701858 file size 8086354 SRR12701858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701858 SRR12701858_1.fastq SRR12701858_2.fastq Input file: SRR12701858_1.fastq Paired file: SRR12701858_2.fastq trimmed: SRR12701858-trimmed-pair1.fastq, SRR12701858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:29:15 2025 >> started Mon Feb 10 23:29:45 2025 >> done (29.579s) 24031856 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 7 ( 0.00%) empty read pairs filtered out after trimming by size control 24031849 (100.00%) read pairs available; of these: 64691 ( 0.27%) trimmed read pairs available after processing 23967158 (99.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 1 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 0 0.00% 32 4 0.00% 33 6 0.00% 34 4 0.00% 35 6 0.00% 36 10 0.00% 37 0 0.00% 38 9 0.00% 39 11 0.00% 40 10 0.00% 41 7 0.00% 42 11 0.00% 43 6 0.00% 44 6 0.00% 45 9 0.00% 46 7 0.00% 47 9 0.00% 48 8 0.00% 49 8 0.00% 50 6 0.00% 51 8 0.00% 52 12 0.00% 53 12 0.00% 54 12 0.00% 55 15 0.00% 56 10 0.00% 57 9 0.00% 58 12 0.00% 59 8 0.00% 60 9 0.00% 61 14 0.00% 62 8 0.00% 63 9 0.00% 64 9 0.00% 65 17 0.00% 66 8 0.00% 67 10 0.00% 68 6 0.00% 69 11 0.00% 70 12 0.00% 71 9 0.00% 72 15 0.00% 73 6 0.00% 74 10 0.00% 75 15 0.00% 76 14 0.00% 77 7 0.00% 78 7 0.00% 79 7 0.00% 80 9 0.00% 81 13 0.00% 82 7 0.00% 83 13 0.00% 84 8 0.00% 85 13 0.00% 86 8 0.00% 87 7 0.00% 88 10 0.00% 89 11 0.00% 90 6 0.00% 91 14 0.00% 92 14 0.00% 93 11 0.00% 94 22 0.00% 95 17 0.00% 96 17 0.00% 97 16 0.00% 98 24 0.00% 99 1397 0.01% 100 1565 0.01% 101 1677 0.01% 102 1964 0.01% 103 1995 0.01% 104 2136 0.01% 105 2340 0.01% 106 2367 0.01% 107 2552 0.01% 108 2769 0.01% 109 2866 0.01% 110 2908 0.01% 111 3141 0.01% 112 3402 0.01% 113 3628 0.02% 114 3778 0.02% 115 3939 0.02% 116 4097 0.02% 117 4427 0.02% 118 4570 0.02% 119 4601 0.02% 120 5039 0.02% 121 5344 0.02% 122 5421 0.02% 123 5789 0.02% 124 6175 0.03% 125 6570 0.03% 126 6546 0.03% 127 7208 0.03% 128 7171 0.03% 129 7547 0.03% 130 7956 0.03% 131 8107 0.03% 132 8679 0.04% 133 9131 0.04% 134 9374 0.04% 135 9767 0.04% 136 10325 0.04% 137 94 0.00% 138 10641 0.04% 139 11031 0.05% 140 11518 0.05% 141 12327 0.05% 142 12913 0.05% 143 14246 0.06% 144 20369 0.08% 145 69304 0.29% 146 14808 0.06% 147 15319 0.06% 148 16292 0.07% 149 16264 0.07% 150 23617746 98.28% 24031849 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=1.9 sequence=AGCGGATCGCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=26.49 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.9 sequence=CAAACAACAACTTCGTATCCCAAGTCTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=2.1 sequence=GGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCACTCTCGGCTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=87.09 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.4 sequence=AGCAAACAACAACTTCGTATCCCAAGTCTTT SRR12701858 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:30:59 Started mapping on | Feb 10 23:30:59 Finished on | Feb 10 23:35:44 Mapping speed, Million of reads per hour | 303.56 Number of input reads | 24031849 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22003553 Uniquely mapped reads % | 91.56% Average mapped length | 295.55 Number of splices: Total | 22060892 Number of splices: Annotated (sjdb) | 21404677 Number of splices: GT/AG | 21551273 Number of splices: GC/AG | 354417 Number of splices: AT/AC | 17197 Number of splices: Non-canonical | 138005 Mismatch rate per base, % | 1.23% Deletion rate per base | 0.10% Deletion average length | 3.43 Insertion rate per base | 0.08% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1099781 % of reads mapped to multiple loci | 4.58% Number of reads mapped to too many loci | 102021 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 928515 928515 928515 N_multimapping 1099781 1099781 1099781 N_noFeature 754623 11172623 11332695 N_ambiguous 429641 89324 88387 UnstrandedReadsAssigned:20819289 PositiveStrandReadsAssigned:10741606 NegativeStrandReadsAssigned:10582471 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12701858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701858-trimmed-pair1.fastq SRR12701858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,031,849 reads, 20,342,020 reads pseudoaligned [quant] estimated average fragment length: 252.747 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR12701858.ke.tsv 34699 SRR12701858.se.tsv 87100 total ==> SRR12701858.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.25 1180.36 23.7921 Potri.005G024800.1.v4.1 1035 783.253 508 23.0905 Potri.004G059700.1.v4.1 961 709.261 21 1.05411 Potri.007G009000.2.v4.1 1416 1164.25 0 0 Potri.003G141000.2.v4.1 2943 2691.25 777.353 10.2834 Potri.016G087400.1.v4.1 270 50.2072 1361 965.08 Potri.015G069301.1.v4.1 564 312.529 0 0 Potri.010G195200.1.v4.1 1773 1521.25 110.965 2.59691 Potri.012G127500.1.v4.1 977 725.261 42 2.0617 ==> SRR12701858.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 52 SRR12701858 completed mapping pipeline successfully