Starting /dee2/code/volunteer_pipeline.sh SRR12701860 current disk space = 3057410895872 free memory = 1484774440 SRR12701860 SRAfilesize ed1fb8a21d1b0a3c3242dbba79592d9b SRR12701860.sra SRR12701860.sra file validated SRR12701860 is paired end SRR12701860 is conventional basespace SRR12701860 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2895 37.0 37.0 37.0 37.0 37.0 2 36.36925 37.0 37.0 37.0 37.0 37.0 3 36.307 37.0 37.0 37.0 37.0 37.0 4 36.298 37.0 37.0 37.0 37.0 37.0 5 36.5215 37.0 37.0 37.0 37.0 37.0 6 36.4275 37.0 37.0 37.0 37.0 37.0 7 36.54475 37.0 37.0 37.0 37.0 37.0 8 36.3 37.0 37.0 37.0 37.0 37.0 9 36.478 37.0 37.0 37.0 37.0 37.0 10-14 36.497400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4796 37.0 37.0 37.0 37.0 37.0 20-24 36.397999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3967 37.0 37.0 37.0 37.0 37.0 30-34 36.234500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2803 37.0 37.0 37.0 37.0 37.0 40-44 36.2252 37.0 37.0 37.0 37.0 37.0 45-49 36.2262 37.0 37.0 37.0 37.0 37.0 50-54 36.1802 37.0 37.0 37.0 37.0 37.0 55-59 36.175 37.0 37.0 37.0 37.0 37.0 60-64 36.14685 37.0 37.0 37.0 37.0 37.0 65-69 36.042500000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.969800000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.95720000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0175 37.0 37.0 37.0 37.0 37.0 85-89 35.9567 37.0 37.0 37.0 37.0 37.0 90-94 35.8718 37.0 37.0 37.0 37.0 37.0 95-99 35.9039 37.0 37.0 37.0 37.0 37.0 100-104 35.814761865466366 37.0 37.0 37.0 37.0 37.0 105-109 35.87404972320123 37.0 37.0 37.0 37.0 37.0 110-114 35.81065782816021 37.0 37.0 37.0 37.0 37.0 115-119 35.79546721382929 37.0 37.0 37.0 37.0 37.0 120-124 35.70768233002364 37.0 37.0 37.0 37.0 37.0 125-129 35.6555956651112 37.0 37.0 37.0 37.0 37.0 130-134 35.623849791614326 37.0 37.0 37.0 37.0 37.0 135-139 35.56638587148272 37.0 37.0 37.0 37.0 37.0 140-144 35.631001087247135 37.0 37.0 37.0 37.0 37.0 145-149 35.40045307191464 37.0 37.0 37.0 34.6 37.0 150 35.324132691820715 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 2.0 24 6.0 25 3.0 26 5.0 27 18.0 28 15.0 29 33.0 30 30.0 31 39.0 32 55.0 33 87.0 34 164.0 35 422.0 36 2926.0 37 189.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.175350701402806 20.34068136272545 17.73547094188377 36.74849699398798 2 22.528160200250312 29.43679599499374 33.516896120150186 14.518147684605756 3 19.900000000000002 34.75 25.0 20.349999999999998 4 21.4 38.15 20.65 19.8 5 22.775000000000002 37.025000000000006 22.875 17.325 6 16.25 37.974999999999994 24.55 21.224999999999998 7 15.778944736184048 16.104026006501627 43.11077769442361 25.006251562890725 8 19.825 20.974999999999998 28.249999999999996 30.95 9 20.525 22.525000000000002 29.375 27.575 10-14 20.755000000000003 29.505 26.655 23.085 15-19 21.065 28.299999999999997 28.12 22.515 20-24 21.27 29.099999999999998 26.919999999999998 22.71 25-29 21.709999999999997 29.345 27.395000000000003 21.55 30-34 20.95 29.275000000000002 27.865000000000002 21.91 35-39 21.215 28.93 27.534999999999997 22.32 40-44 21.9 28.84 27.060000000000002 22.2 45-49 21.165 28.51 28.325 22.0 50-54 21.365000000000002 28.38 27.950000000000003 22.305 55-59 21.535 28.110000000000003 27.52 22.835 60-64 21.52107605380269 28.48642432121606 27.42137106855343 22.571128556427823 65-69 21.834999999999997 28.645 26.979999999999997 22.54 70-74 21.27 29.110000000000003 27.605 22.015 75-79 21.915000000000003 27.71 27.79 22.585 80-84 22.189999999999998 28.305000000000003 27.944999999999997 21.560000000000002 85-89 21.93 27.944999999999997 28.04 22.085 90-94 21.990000000000002 27.88 27.445000000000004 22.685 95-99 21.975 27.96 27.395000000000003 22.67 100-104 21.699339867973595 28.49569913982797 27.750550110022004 22.054410882176434 105-109 22.595817071950368 28.484939457620335 27.16401481036726 21.75522866006204 110-114 22.004608294930875 27.855139250651174 28.090563013424163 22.049689440993788 115-119 22.98389120289055 28.062427861695188 27.921914989712448 21.03176594570181 120-124 22.60332446140712 27.63521317732135 27.31381509566615 22.447647265605383 125-129 21.975978692396602 27.87074727373235 27.921001055329413 22.232272978541634 130-134 21.929250742213053 27.721028531172948 27.80153977758768 22.548180949026317 135-139 21.909659205484978 28.36761443839484 28.06009276063722 21.662633595482962 140-144 22.5962751728663 27.411295613990816 27.754504618179983 22.237924594962905 145-149 22.600243013365734 28.01235317942487 27.91616038882139 21.47124341838801 150 22.10686249683464 27.1714358065333 28.184350468473028 22.53735122815903 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 2.5 21 1.5 22 3.0 23 5.5 24 6.0 25 8.5 26 11.0 27 12.5 28 15.0 29 17.0 30 22.5 31 31.5 32 39.5 33 49.0 34 56.0 35 74.0 36 95.0 37 111.5 38 136.5 39 171.5 40 197.0 41 224.5 42 244.5 43 250.5 44 257.0 45 251.0 46 243.0 47 229.0 48 214.5 49 188.0 50 160.0 51 126.5 52 99.0 53 95.0 54 71.5 55 56.5 56 49.5 57 34.0 58 29.5 59 21.5 60 22.5 61 20.5 62 8.0 63 7.0 64 6.0 65 2.0 66 2.0 67 3.0 68 2.5 69 2.0 70 1.5 71 0.5 72 1.0 73 1.0 74 0.0 75 2.0 76 2.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 0.0 104-105 0.0 106-107 3.0 108-109 2.0 110-111 1.0 112-113 3.0 114-115 3.0 116-117 3.0 118-119 0.0 120-121 2.0 122-123 1.0 124-125 0.0 126-127 2.0 128-129 2.0 130-131 1.0 132-133 4.0 134-135 4.0 136-137 1.0 138-139 4.0 140-141 0.0 142-143 2.0 144-145 12.0 146-147 0.0 148-149 0.0 150-151 3949.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.8 #Duplication Level Percentage of deduplicated Percentage of total 1 85.17099056603774 72.225 2 12.264150943396226 20.8 3 2.063679245283019 5.25 4 0.4716981132075472 1.6 5 0.0294811320754717 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACCTGGAGTCAATGGCTGGAAGTAGGGAGGAGGATATTGGTAGTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCAC 10 0.007015441 143.7125 6 >>END_MODULE SRR12701860 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.341 37.0 37.0 37.0 37.0 37.0 2 36.17 37.0 37.0 37.0 37.0 37.0 3 36.1805 37.0 37.0 37.0 37.0 37.0 4 36.3055 37.0 37.0 37.0 37.0 37.0 5 36.2345 37.0 37.0 37.0 37.0 37.0 6 36.094 37.0 37.0 37.0 37.0 37.0 7 36.334 37.0 37.0 37.0 37.0 37.0 8 36.261 37.0 37.0 37.0 37.0 37.0 9 36.4645 37.0 37.0 37.0 37.0 37.0 10-14 36.2821 37.0 37.0 37.0 37.0 37.0 15-19 36.2709 37.0 37.0 37.0 37.0 37.0 20-24 36.2821 37.0 37.0 37.0 37.0 37.0 25-29 36.2214 37.0 37.0 37.0 37.0 37.0 30-34 36.1711 37.0 37.0 37.0 37.0 37.0 35-39 36.069 37.0 37.0 37.0 37.0 37.0 40-44 36.145 37.0 37.0 37.0 37.0 37.0 45-49 36.046299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0179 37.0 37.0 37.0 37.0 37.0 55-59 35.946600000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9582 37.0 37.0 37.0 37.0 37.0 65-69 35.876799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.91420000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.7851 37.0 37.0 37.0 37.0 37.0 80-84 35.6879 37.0 37.0 37.0 37.0 37.0 85-89 35.717200000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.64919999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.691199999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.49888914728682 37.0 37.0 37.0 34.6 37.0 105-109 35.57210437035577 37.0 37.0 37.0 37.0 37.0 110-114 35.63623061782361 37.0 37.0 37.0 37.0 37.0 115-119 35.41300322644103 37.0 37.0 37.0 37.0 37.0 120-124 35.24516550230601 37.0 37.0 37.0 29.8 37.0 125-129 35.392356553260676 37.0 37.0 37.0 32.2 37.0 130-134 35.36359669686037 37.0 37.0 37.0 32.2 37.0 135-139 35.279516875933844 37.0 37.0 37.0 32.2 37.0 140-144 35.33402624873363 37.0 37.0 37.0 29.8 37.0 145-149 35.21073215858106 37.0 37.0 37.0 27.4 37.0 150 35.267915928083056 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 1.0 24 5.0 25 6.0 26 5.0 27 13.0 28 19.0 29 29.0 30 31.0 31 41.0 32 75.0 33 129.0 34 225.0 35 765.0 36 2503.0 37 148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.674999999999997 19.6 16.900000000000002 36.825 2 22.6 28.799999999999997 35.0 13.600000000000001 3 20.724999999999998 33.0 25.624999999999996 20.65 4 21.725 37.574999999999996 20.674999999999997 20.025000000000002 5 21.224999999999998 37.7 22.400000000000002 18.675 6 17.2 38.725 23.925 20.150000000000002 7 15.8 16.675 43.525000000000006 24.0 8 19.425 21.025 29.349999999999998 30.2 9 19.975 23.825 30.0 26.200000000000003 10-14 21.065 29.015 27.305 22.615 15-19 20.61 28.560000000000002 28.549999999999997 22.28 20-24 21.335 29.125 27.224999999999998 22.314999999999998 25-29 21.245 29.425 27.250000000000004 22.08 30-34 21.21 29.185 27.76 21.845 35-39 21.285 28.035 28.09 22.59 40-44 21.41 29.054999999999996 27.650000000000002 21.884999999999998 45-49 22.015 28.26 27.900000000000002 21.825 50-54 21.48 27.93 28.205000000000002 22.384999999999998 55-59 21.41 28.305000000000003 27.925 22.36 60-64 21.52 28.565 28.34 21.575 65-69 21.61 28.694999999999997 27.82 21.875 70-74 22.125 28.410000000000004 27.084999999999997 22.38 75-79 21.875 27.834999999999997 28.34 21.95 80-84 22.055 27.77 27.339999999999996 22.835 85-89 21.98 28.415000000000003 27.605 22.0 90-94 21.58 28.48 27.529999999999998 22.41 95-99 21.83 28.810000000000002 27.24 22.12 100-104 21.714342868573716 28.180636127225444 27.99059811962393 22.114422884576914 105-109 21.850295206644653 28.294806364455116 27.644351045732012 22.210547383168215 110-114 22.20997796032859 28.295932678821877 27.579643358044482 21.91444600280505 115-119 22.361619912681284 27.9118783559994 27.997189742560348 21.72931198875897 120-124 22.357254055139858 28.28303118565761 27.01752623914026 22.34218852006227 125-129 22.31267902909694 28.418513493140356 27.649630634705264 21.61917684305744 130-134 21.400895687616366 28.495949277914757 27.897146882705176 22.206008151763697 135-139 22.48941318814277 27.979431336963096 27.69207501512402 21.839080459770116 140-144 21.945187503154497 28.546913642557914 27.48195629132388 22.02594256296371 145-149 22.721749696233292 27.931348724179827 27.283313082219525 22.063588497367356 150 22.71461129399848 28.08305900227906 26.918207141048367 22.284122562674096 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.5 24 5.5 25 7.5 26 6.5 27 11.0 28 20.5 29 21.0 30 20.5 31 34.5 32 51.5 33 55.5 34 64.0 35 85.5 36 94.0 37 113.0 38 135.5 39 178.0 40 224.5 41 219.5 42 224.0 43 236.5 44 249.5 45 275.0 46 268.0 47 223.5 48 195.5 49 179.5 50 152.5 51 126.5 52 98.0 53 78.5 54 64.5 55 53.0 56 43.0 57 35.5 58 27.5 59 18.5 60 16.5 61 12.5 62 10.5 63 11.0 64 6.5 65 3.0 66 5.5 67 5.0 68 3.0 69 2.5 70 2.0 71 2.5 72 1.5 73 1.5 74 1.0 75 1.0 76 1.0 77 0.0 78 3.0 79 3.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 1.0 102-103 0.0 104-105 0.0 106-107 3.0 108-109 2.0 110-111 1.0 112-113 3.0 114-115 3.0 116-117 3.0 118-119 0.0 120-121 2.0 122-123 1.0 124-125 0.0 126-127 2.0 128-129 2.0 130-131 1.0 132-133 4.0 134-135 4.0 136-137 1.0 138-139 4.0 140-141 0.0 142-143 2.0 144-145 12.0 146-147 0.0 148-149 0.0 150-151 3949.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.075 #Duplication Level Percentage of deduplicated Percentage of total 1 85.36585365853658 72.625 2 12.165736115192477 20.7 3 2.0570085218924477 5.25 4 0.38201586835145457 1.3 5 0.02938583602703497 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGTATCTGAACCCAGAAGGAGTAGATATGGTTTCTGGGGTTTATGGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0125 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGTGT 10 0.007015441 143.7125 8 >>END_MODULE Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072021 spots for SRR12701860.sra Written 1072021 spots for SRR12701860.sra Read 1072029 spots for SRR12701860.sra Written 1072029 spots for SRR12701860.sra SRR ids: ['SRR12701860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cyt861ho SRR12701860.sra spots: 21440428 blocks: [[1, 1072021], [1072022, 2144042], [2144043, 3216063], [3216064, 4288084], [4288085, 5360105], [5360106, 6432126], [6432127, 7504147], [7504148, 8576168], [8576169, 9648189], [9648190, 10720210], [10720211, 11792231], [11792232, 12864252], [12864253, 13936273], [13936274, 15008294], [15008295, 16080315], [16080316, 17152336], [17152337, 18224357], [18224358, 19296378], [19296379, 20368399], [20368400, 21440428]] SRR12701860 file size 7211270 SRR12701860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701860 SRR12701860_1.fastq SRR12701860_2.fastq Input file: SRR12701860_1.fastq Paired file: SRR12701860_2.fastq trimmed: SRR12701860-trimmed-pair1.fastq, SRR12701860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:12:02 2025 >> started Tue Feb 11 00:12:26 2025 >> done (23.455s) 21440428 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 17 ( 0.00%) empty read pairs filtered out after trimming by size control 21440411 (100.00%) read pairs available; of these: 59970 ( 0.28%) trimmed read pairs available after processing 21380441 (99.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 1 0.00% 27 3 0.00% 28 1 0.00% 29 0 0.00% 30 4 0.00% 31 3 0.00% 32 1 0.00% 33 3 0.00% 34 2 0.00% 35 3 0.00% 36 5 0.00% 37 1 0.00% 38 9 0.00% 39 4 0.00% 40 5 0.00% 41 4 0.00% 42 7 0.00% 43 4 0.00% 44 7 0.00% 45 3 0.00% 46 9 0.00% 47 7 0.00% 48 8 0.00% 49 11 0.00% 50 5 0.00% 51 13 0.00% 52 8 0.00% 53 9 0.00% 54 9 0.00% 55 8 0.00% 56 8 0.00% 57 8 0.00% 58 13 0.00% 59 8 0.00% 60 7 0.00% 61 12 0.00% 62 9 0.00% 63 12 0.00% 64 11 0.00% 65 5 0.00% 66 6 0.00% 67 7 0.00% 68 11 0.00% 69 3 0.00% 70 5 0.00% 71 13 0.00% 72 8 0.00% 73 9 0.00% 74 8 0.00% 75 11 0.00% 76 8 0.00% 77 9 0.00% 78 8 0.00% 79 9 0.00% 80 6 0.00% 81 12 0.00% 82 13 0.00% 83 17 0.00% 84 12 0.00% 85 7 0.00% 86 8 0.00% 87 11 0.00% 88 14 0.00% 89 14 0.00% 90 9 0.00% 91 10 0.00% 92 20 0.00% 93 7 0.00% 94 24 0.00% 95 12 0.00% 96 18 0.00% 97 24 0.00% 98 18 0.00% 99 1437 0.01% 100 1627 0.01% 101 1700 0.01% 102 1767 0.01% 103 1826 0.01% 104 2052 0.01% 105 2215 0.01% 106 2297 0.01% 107 2456 0.01% 108 2623 0.01% 109 2659 0.01% 110 2837 0.01% 111 2896 0.01% 112 3220 0.02% 113 3421 0.02% 114 3665 0.02% 115 3653 0.02% 116 3799 0.02% 117 4240 0.02% 118 4347 0.02% 119 4688 0.02% 120 4750 0.02% 121 4996 0.02% 122 5239 0.02% 123 5514 0.03% 124 5810 0.03% 125 6171 0.03% 126 6469 0.03% 127 6812 0.03% 128 6883 0.03% 129 7287 0.03% 130 7445 0.03% 131 7947 0.04% 132 8368 0.04% 133 8673 0.04% 134 9036 0.04% 135 9609 0.04% 136 9931 0.05% 137 99 0.00% 138 10114 0.05% 139 10694 0.05% 140 11046 0.05% 141 11676 0.05% 142 12312 0.06% 143 13792 0.06% 144 19579 0.09% 145 65004 0.30% 146 13937 0.07% 147 14003 0.07% 148 14831 0.07% 149 15282 0.07% 150 21047049 98.17% 21440411 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.2 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=183.33 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=20.2 sequence=AGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCATGGTAGAACCGTAGAACCATAACAACAAGAGACATATTGCAGATAAGAACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGTTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.1 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=249.00 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.1 sequence=AAGAAAGATAGTCTTTGGGTCCTTCAACTGCTGCAGAAAGTTTCTCGAAGAAGAAACAAACAAGTTTCTACGGCAGTTGAAATATATAAAAGATCCATCATCTCTTGTTTTCATAACTTCTTTCACAAAGTTTGAATCAAATCACACACTGTATTTGTA SRR12701860 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:13:37 Started mapping on | Feb 11 00:13:37 Finished on | Feb 11 00:16:55 Mapping speed, Million of reads per hour | 389.83 Number of input reads | 21440411 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19132878 Uniquely mapped reads % | 89.24% Average mapped length | 287.36 Number of splices: Total | 16829465 Number of splices: Annotated (sjdb) | 16274493 Number of splices: GT/AG | 16467664 Number of splices: GC/AG | 212868 Number of splices: AT/AC | 24880 Number of splices: Non-canonical | 124053 Mismatch rate per base, % | 1.26% Deletion rate per base | 0.11% Deletion average length | 3.32 Insertion rate per base | 0.08% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 988506 % of reads mapped to multiple loci | 4.61% Number of reads mapped to too many loci | 99190 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.45% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1319027 1319027 1319027 N_multimapping 988506 988506 988506 N_noFeature 855025 9876724 10012633 N_ambiguous 267967 85883 84697 UnstrandedReadsAssigned:18009886 PositiveStrandReadsAssigned:9170271 NegativeStrandReadsAssigned:9035548 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR12701860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701860-trimmed-pair1.fastq SRR12701860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,440,411 reads, 17,979,281 reads pseudoaligned [quant] estimated average fragment length: 247.555 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52401 SRR12701860.ke.tsv 34699 SRR12701860.se.tsv 87100 total ==> SRR12701860.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.44 1804 43.2244 Potri.005G024800.1.v4.1 1035 788.445 10320 555.557 Potri.004G059700.1.v4.1 961 714.45 42 2.49516 Potri.007G009000.2.v4.1 1416 1169.44 0 0 Potri.003G141000.2.v4.1 2943 2696.44 892.321 14.0459 Potri.016G087400.1.v4.1 270 54.0127 1006.18 790.676 Potri.015G069301.1.v4.1 564 317.67 0 0 Potri.010G195200.1.v4.1 1773 1526.44 72.8431 2.02548 Potri.012G127500.1.v4.1 977 730.45 6179 359.044 ==> SRR12701860.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1185 SRR12701860 completed mapping pipeline successfully