Starting /dee2/code/volunteer_pipeline.sh SRR12701861 current disk space = 3057444614144 free memory = 1467279196 SRR12701861 SRAfilesize 0bf1db4d862c5389ab0343026655fb82 SRR12701861.sra SRR12701861.sra file validated SRR12701861 is paired end SRR12701861 is conventional basespace SRR12701861 read1 length is 102-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 102-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42825 37.0 37.0 37.0 37.0 37.0 2 36.3665 37.0 37.0 37.0 37.0 37.0 3 36.5415 37.0 37.0 37.0 37.0 37.0 4 36.4125 37.0 37.0 37.0 37.0 37.0 5 36.463 37.0 37.0 37.0 37.0 37.0 6 36.488 37.0 37.0 37.0 37.0 37.0 7 36.371 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.557 37.0 37.0 37.0 37.0 37.0 10-14 36.474399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4285 37.0 37.0 37.0 37.0 37.0 20-24 36.4534 37.0 37.0 37.0 37.0 37.0 25-29 36.3853 37.0 37.0 37.0 37.0 37.0 30-34 36.368399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2726 37.0 37.0 37.0 37.0 37.0 40-44 36.267399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2453 37.0 37.0 37.0 37.0 37.0 50-54 36.2435 37.0 37.0 37.0 37.0 37.0 55-59 36.218500000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.1623 37.0 37.0 37.0 37.0 37.0 65-69 36.14829999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.1776 37.0 37.0 37.0 37.0 37.0 75-79 36.1451 37.0 37.0 37.0 37.0 37.0 80-84 36.0557 37.0 37.0 37.0 37.0 37.0 85-89 36.0658 37.0 37.0 37.0 37.0 37.0 90-94 36.0107 37.0 37.0 37.0 37.0 37.0 95-99 35.9984 37.0 37.0 37.0 37.0 37.0 100-104 35.972590045022514 37.0 37.0 37.0 37.0 37.0 105-109 35.90842919583385 37.0 37.0 37.0 37.0 37.0 110-114 35.87008097503966 37.0 37.0 37.0 37.0 37.0 115-119 35.846892272724205 37.0 37.0 37.0 37.0 37.0 120-124 35.8052190447846 37.0 37.0 37.0 37.0 37.0 125-129 35.862725494457614 37.0 37.0 37.0 37.0 37.0 130-134 35.77099158232157 37.0 37.0 37.0 37.0 37.0 135-139 35.60438665254094 37.0 37.0 37.0 37.0 37.0 140-144 35.58876258646476 37.0 37.0 37.0 37.0 37.0 145-149 35.643177664684444 37.0 37.0 37.0 37.0 37.0 150 35.59500764136526 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 5.0 26 9.0 27 8.0 28 26.0 29 31.0 30 30.0 31 52.0 32 62.0 33 74.0 34 126.0 35 338.0 36 2975.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.632158039509875 18.6046511627907 18.02950737684421 34.733683420855215 2 21.735867933966986 27.538769384692348 35.36768384192096 15.35767883941971 3 21.75 31.674999999999997 26.8 19.775000000000002 4 22.125 35.9 20.8 21.175 5 20.525 38.65 22.75 18.075 6 16.3 38.175 24.675 20.849999999999998 7 16.525000000000002 16.25 44.800000000000004 22.425 8 18.625 22.400000000000002 30.075000000000003 28.9 9 20.225 23.575 29.375 26.825 10-14 20.9 29.599999999999998 26.919999999999998 22.58 15-19 20.979999999999997 28.975 27.700000000000003 22.345000000000002 20-24 21.925 28.515 27.305 22.255 25-29 21.68 28.910000000000004 27.0 22.41 30-34 20.96 29.075 27.96 22.005 35-39 21.154999999999998 28.26 28.515 22.07 40-44 21.595 28.470000000000002 27.82 22.115000000000002 45-49 21.32 27.725 28.255000000000003 22.7 50-54 20.8 28.265 28.26 22.675 55-59 21.765 28.46 27.815 21.959999999999997 60-64 21.475 28.849999999999998 27.61 22.065 65-69 21.795 27.839999999999996 27.63 22.735 70-74 22.189999999999998 28.275 27.439999999999998 22.095000000000002 75-79 22.25 28.405 27.63 21.715 80-84 21.875 27.685 27.800000000000004 22.64 85-89 21.685 28.07 27.779999999999998 22.465 90-94 22.08 28.915000000000003 27.87 21.135 95-99 21.65 28.485 27.375 22.49 100-104 21.844368873774755 28.595719143828767 27.250450090018003 22.309461892378476 105-109 21.44286571943166 27.901741044626778 28.62717630578347 22.028216930158095 110-114 21.674926165089854 28.237473094058167 27.92711618361115 22.160484557240828 115-119 22.288552222333703 28.323467442560453 27.395404835958665 21.992575499147186 120-124 21.48602453247537 28.55921978684898 28.202292378845765 21.75246330182988 125-129 22.132178990285396 27.543162027482758 28.313283334172247 22.011375648059598 130-134 21.854671978215926 27.63854571126015 28.50083203065907 22.00595027986486 135-139 22.030815862591563 28.21419550391513 28.05253851982824 21.702450113665066 140-144 22.366756086450373 27.5649137014729 28.076124917750672 21.992205294326062 145-149 22.257292674235096 27.928524156187954 28.320521305299597 21.49366186427735 150 23.509933774834437 26.84666327050433 27.254202750891494 22.38920020376974 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 3.0 25 3.5 26 3.5 27 5.5 28 13.5 29 23.0 30 24.0 31 27.5 32 36.0 33 42.5 34 53.0 35 78.0 36 100.0 37 120.5 38 156.0 39 188.5 40 192.0 41 218.0 42 252.0 43 247.0 44 265.0 45 266.5 46 243.0 47 235.5 48 226.5 49 190.5 50 157.5 51 139.5 52 104.0 53 73.0 54 69.5 55 66.5 56 51.5 57 40.5 58 23.5 59 16.0 60 13.5 61 7.5 62 7.5 63 6.0 64 2.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 102 2.0 103 0.0 104 0.0 105 0.0 106 0.0 107 1.0 108 0.0 109 1.0 110 0.0 111 0.0 112 0.0 113 3.0 114 1.0 115 1.0 116 4.0 117 3.0 118 4.0 119 1.0 120 0.0 121 0.0 122 1.0 123 1.0 124 0.0 125 1.0 126 2.0 127 3.0 128 2.0 129 0.0 130 1.0 131 2.0 132 2.0 133 0.0 134 3.0 135 0.0 136 3.0 137 0.0 138 1.0 139 3.0 140 0.0 141 0.0 142 4.0 143 5.0 144 6.0 145 13.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3926.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.775 #Duplication Level Percentage of deduplicated Percentage of total 1 84.81273960483632 71.89999999999999 2 12.79858448835152 21.7 3 2.005308168681805 5.1 4 0.383367738130345 1.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATAAG 10 0.007066775 143.3625 9 >>END_MODULE SRR12701861 read2 length is 102-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 102-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2155 37.0 37.0 37.0 37.0 37.0 2 36.1165 37.0 37.0 37.0 37.0 37.0 3 36.3455 37.0 37.0 37.0 37.0 37.0 4 36.194 37.0 37.0 37.0 37.0 37.0 5 36.3715 37.0 37.0 37.0 37.0 37.0 6 36.33425 37.0 37.0 37.0 37.0 37.0 7 36.368 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.326 37.0 37.0 37.0 37.0 37.0 10-14 36.419599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.388600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.361000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.305499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2406 37.0 37.0 37.0 37.0 37.0 35-39 36.293 37.0 37.0 37.0 37.0 37.0 40-44 36.268299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.253099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2044 37.0 37.0 37.0 37.0 37.0 55-59 36.1741 37.0 37.0 37.0 37.0 37.0 60-64 36.108000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0822 37.0 37.0 37.0 37.0 37.0 70-74 36.1241 37.0 37.0 37.0 37.0 37.0 75-79 36.0173 37.0 37.0 37.0 37.0 37.0 80-84 35.9459 37.0 37.0 37.0 37.0 37.0 85-89 36.0683 37.0 37.0 37.0 37.0 37.0 90-94 35.8142 37.0 37.0 37.0 37.0 37.0 95-99 35.9088 37.0 37.0 37.0 37.0 37.0 100-104 35.932283691845925 37.0 37.0 37.0 37.0 37.0 105-109 35.86831083793085 37.0 37.0 37.0 37.0 37.0 110-114 35.759743815942166 37.0 37.0 37.0 37.0 37.0 115-119 35.73081017960128 37.0 37.0 37.0 37.0 37.0 120-124 35.81269626381221 37.0 37.0 37.0 37.0 37.0 125-129 35.64065054859723 37.0 37.0 37.0 37.0 37.0 130-134 35.63716712051503 37.0 37.0 37.0 37.0 37.0 135-139 35.64611537928698 37.0 37.0 37.0 37.0 37.0 140-144 35.42125391767077 37.0 37.0 37.0 32.2 37.0 145-149 35.61232100795408 37.0 37.0 37.0 37.0 37.0 150 35.522669383596536 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 3.0 25 6.0 26 10.0 27 11.0 28 6.0 29 11.0 30 29.0 31 42.0 32 59.0 33 100.0 34 184.0 35 553.0 36 2731.0 37 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 18.5 18.275 35.099999999999994 2 21.96098049024512 29.389694847423716 34.79239619809905 13.856928464232116 3 21.875 32.725 24.725 20.674999999999997 4 22.55 36.525 20.05 20.875 5 20.95 38.7 22.975 17.375 6 17.35433858464616 39.0847711927982 23.53088272068017 20.030007501875467 7 16.375 17.325 43.25 23.05 8 18.684342171085543 22.98649324662331 30.21510755377689 28.114057028514257 9 20.710355177588795 23.23661830915458 28.789394697348676 27.263631815907953 10-14 21.04710471047105 29.672967296729674 26.717671767176714 22.562256225622562 15-19 21.925 28.125 28.199999999999996 21.75 20-24 21.584999999999997 28.555000000000003 27.685 22.175 25-29 21.44 29.020000000000003 27.46 22.08 30-34 21.11 28.23 27.894999999999996 22.765 35-39 21.649329865973193 28.075615123024605 27.840568113622727 22.434486897379475 40-44 21.584999999999997 29.01 27.73 21.675 45-49 21.325 28.67 27.555000000000003 22.45 50-54 21.285 29.080000000000002 27.665 21.97 55-59 21.555 28.560000000000002 27.639999999999997 22.245 60-64 21.48 29.360000000000003 27.145000000000003 22.015 65-69 21.63 28.92 27.04 22.41 70-74 21.085 27.655 28.785 22.475 75-79 21.92 28.075 27.715 22.29 80-84 21.695 29.110000000000003 26.97 22.225 85-89 21.59 28.535 27.805000000000003 22.07 90-94 22.285 27.839999999999996 27.685 22.189999999999998 95-99 21.560000000000002 28.705000000000002 27.275 22.46 100-104 22.274454890978195 28.325665133026607 28.185637127425483 21.214242848569715 105-109 21.605123586510558 27.284098869208446 29.15040528369859 21.96037226058241 110-114 21.94023126595585 28.482755168443713 27.97216799319217 21.60484557240827 115-119 22.012641717668306 27.74656366007826 28.21310324069429 22.027691381559144 120-124 21.807761914337423 28.353106776593606 27.971043635632416 21.868087673436555 125-129 22.34861831177329 28.283082498615798 27.79986912971259 21.568430059898326 130-134 21.82441631788614 27.966315364832838 28.32938328879028 21.879885028490747 135-139 21.995453397322557 28.178833038646122 27.673654963374588 22.152058600656733 140-144 21.668269474110442 28.253277319431085 28.157108872804574 21.921344333653895 145-149 22.562744998218196 28.488520083490304 27.735071017665327 21.21366390062618 150 21.115639327559858 29.77585328578706 26.897605705552724 22.210901681100356 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 2.0 23 2.5 24 3.0 25 6.0 26 7.5 27 5.0 28 11.5 29 14.5 30 16.5 31 25.0 32 35.0 33 53.5 34 60.5 35 84.0 36 107.5 37 109.5 38 132.5 39 155.0 40 186.5 41 231.0 42 246.5 43 261.0 44 287.0 45 287.0 46 263.0 47 237.0 48 212.0 49 176.5 50 160.5 51 143.5 52 102.5 53 77.0 54 67.5 55 59.5 56 42.5 57 35.0 58 28.5 59 19.5 60 15.0 61 8.5 62 7.5 63 4.5 64 1.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.05 9 0.05 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.010006003602161296 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 102 2.0 103 0.0 104 0.0 105 0.0 106 0.0 107 1.0 108 0.0 109 1.0 110 0.0 111 0.0 112 0.0 113 3.0 114 1.0 115 1.0 116 4.0 117 3.0 118 4.0 119 1.0 120 0.0 121 0.0 122 1.0 123 1.0 124 0.0 125 1.0 126 2.0 127 3.0 128 2.0 129 0.0 130 1.0 131 2.0 132 2.0 133 0.0 134 3.0 135 0.0 136 3.0 137 0.0 138 1.0 139 3.0 140 0.0 141 0.0 142 4.0 143 5.0 144 6.0 145 13.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3926.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.875 #Duplication Level Percentage of deduplicated Percentage of total 1 84.88954344624447 72.05 2 12.724594992636229 21.6 3 2.0618556701030926 5.25 4 0.3240058910162003 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTA 10 0.007066775 143.3625 4 GAACAAG 10 0.007066775 143.3625 4 AGAAGAA 40 0.005879785 53.760937 7 >>END_MODULE Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140024 spots for SRR12701861.sra Written 1140024 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra Read 1140010 spots for SRR12701861.sra Written 1140010 spots for SRR12701861.sra SRR ids: ['SRR12701861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9wolnwr1 SRR12701861.sra spots: 22800214 blocks: [[1, 1140010], [1140011, 2280020], [2280021, 3420030], [3420031, 4560040], [4560041, 5700050], [5700051, 6840060], [6840061, 7980070], [7980071, 9120080], [9120081, 10260090], [10260091, 11400100], [11400101, 12540110], [12540111, 13680120], [13680121, 14820130], [14820131, 15960140], [15960141, 17100150], [17100151, 18240160], [18240161, 19380170], [19380171, 20520180], [20520181, 21660190], [21660191, 22800214]] SRR12701861 file size 7665086 SRR12701861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701861 SRR12701861_1.fastq SRR12701861_2.fastq Input file: SRR12701861_1.fastq Paired file: SRR12701861_2.fastq trimmed: SRR12701861-trimmed-pair1.fastq, SRR12701861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:03:47 2025 >> started Tue Feb 11 00:04:17 2025 >> done (29.369s) 22800214 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 16 ( 0.00%) empty read pairs filtered out after trimming by size control 22800197 (100.00%) read pairs available; of these: 93565 ( 0.41%) trimmed read pairs available after processing 22706632 (99.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 3 0.00% 28 6 0.00% 29 5 0.00% 30 2 0.00% 31 5 0.00% 32 0 0.00% 33 4 0.00% 34 5 0.00% 35 2 0.00% 36 5 0.00% 37 3 0.00% 38 2 0.00% 39 7 0.00% 40 9 0.00% 41 8 0.00% 42 6 0.00% 43 9 0.00% 44 8 0.00% 45 3 0.00% 46 9 0.00% 47 12 0.00% 48 7 0.00% 49 8 0.00% 50 7 0.00% 51 5 0.00% 52 4 0.00% 53 1 0.00% 54 8 0.00% 55 13 0.00% 56 7 0.00% 57 7 0.00% 58 12 0.00% 59 6 0.00% 60 5 0.00% 61 5 0.00% 62 8 0.00% 63 10 0.00% 64 6 0.00% 65 7 0.00% 66 8 0.00% 67 6 0.00% 68 6 0.00% 69 11 0.00% 70 15 0.00% 71 7 0.00% 72 10 0.00% 73 8 0.00% 74 7 0.00% 75 4 0.00% 76 6 0.00% 77 7 0.00% 78 9 0.00% 79 7 0.00% 80 3 0.00% 81 7 0.00% 82 9 0.00% 83 6 0.00% 84 14 0.00% 85 11 0.00% 86 10 0.00% 87 7 0.00% 88 6 0.00% 89 10 0.00% 90 13 0.00% 91 10 0.00% 92 7 0.00% 93 7 0.00% 94 11 0.00% 95 5 0.00% 96 12 0.00% 97 10 0.00% 98 19 0.00% 99 2049 0.01% 100 2310 0.01% 101 2481 0.01% 102 2563 0.01% 103 2942 0.01% 104 2959 0.01% 105 3191 0.01% 106 3275 0.01% 107 3452 0.02% 108 3854 0.02% 109 3897 0.02% 110 4330 0.02% 111 4424 0.02% 112 4664 0.02% 113 4995 0.02% 114 5438 0.02% 115 5651 0.02% 116 5892 0.03% 117 6426 0.03% 118 6780 0.03% 119 7019 0.03% 120 7306 0.03% 121 7780 0.03% 122 8062 0.04% 123 8419 0.04% 124 8811 0.04% 125 9151 0.04% 126 9657 0.04% 127 10267 0.05% 128 10606 0.05% 129 11172 0.05% 130 11700 0.05% 131 12183 0.05% 132 12684 0.06% 133 13343 0.06% 134 13677 0.06% 135 14465 0.06% 136 15231 0.07% 137 136 0.00% 138 15653 0.07% 139 16623 0.07% 140 17306 0.08% 141 17731 0.08% 142 19062 0.08% 143 20590 0.09% 144 26466 0.12% 145 72906 0.32% 146 21511 0.09% 147 22511 0.10% 148 23313 0.10% 149 24232 0.11% 150 22228518 97.49% 22800197 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.1 sequence=CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCTGCAGATGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAGTAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=64.31 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.8 sequence=TCATCACCAGTCCTTGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTATCCGGTGCCGCTCCACCGCCCCTTCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.1 sequence=CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCTGCAGATGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAGTAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=18.03 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=3.2 sequence=TGCAAGTGCAGTTAGCGCCGCACTTGCA SRR12701861 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:05:12 Started mapping on | Feb 11 00:05:12 Finished on | Feb 11 00:09:51 Mapping speed, Million of reads per hour | 294.20 Number of input reads | 22800197 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20963348 Uniquely mapped reads % | 91.94% Average mapped length | 295.30 Number of splices: Total | 21187758 Number of splices: Annotated (sjdb) | 20566197 Number of splices: GT/AG | 20702642 Number of splices: GC/AG | 343127 Number of splices: AT/AC | 15817 Number of splices: Non-canonical | 126172 Mismatch rate per base, % | 1.21% Deletion rate per base | 0.10% Deletion average length | 3.50 Insertion rate per base | 0.07% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1006278 % of reads mapped to multiple loci | 4.41% Number of reads mapped to too many loci | 62176 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 830571 830571 830571 N_multimapping 1006278 1006278 1006278 N_noFeature 717257 10665338 10830541 N_ambiguous 338645 77607 77135 UnstrandedReadsAssigned:19907446 PositiveStrandReadsAssigned:10220403 NegativeStrandReadsAssigned:10055672 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12701861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701861-trimmed-pair1.fastq SRR12701861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,800,197 reads, 19,387,301 reads pseudoaligned [quant] estimated average fragment length: 242.1 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR12701861.ke.tsv 34699 SRR12701861.se.tsv 87100 total ==> SRR12701861.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.9 1348 30.7876 Potri.005G024800.1.v4.1 1035 793.9 495 25.3039 Potri.004G059700.1.v4.1 961 719.91 2 0.112746 Potri.007G009000.2.v4.1 1416 1174.9 0 0 Potri.003G141000.2.v4.1 2943 2701.9 774 11.6257 Potri.016G087400.1.v4.1 270 55.0327 1297.65 956.944 Potri.015G069301.1.v4.1 564 323.057 0 0 Potri.010G195200.1.v4.1 1773 1531.9 84 2.22534 Potri.012G127500.1.v4.1 977 735.91 17 0.937503 ==> SRR12701861.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 59 SRR12701861 completed mapping pipeline successfully