Starting /dee2/code/volunteer_pipeline.sh SRR12701863 current disk space = 3057471303680 free memory = 1155130048 SRR12701863 SRAfilesize 5209527c121cbc45fa13d7e837c0e01d SRR12701863.sra SRR12701863.sra file validated SRR12701863 is paired end SRR12701863 is conventional basespace SRR12701863 read1 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.25875 37.0 37.0 37.0 37.0 37.0 2 36.31775 37.0 37.0 37.0 37.0 37.0 3 36.3065 37.0 37.0 37.0 37.0 37.0 4 36.3105 37.0 37.0 37.0 37.0 37.0 5 36.3525 37.0 37.0 37.0 37.0 37.0 6 36.4235 37.0 37.0 37.0 37.0 37.0 7 36.44775 37.0 37.0 37.0 37.0 37.0 8 36.315 37.0 37.0 37.0 37.0 37.0 9 36.475 37.0 37.0 37.0 37.0 37.0 10-14 36.473400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3918 37.0 37.0 37.0 37.0 37.0 20-24 36.395500000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.29279999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.2653 37.0 37.0 37.0 37.0 37.0 35-39 36.2962 37.0 37.0 37.0 37.0 37.0 40-44 36.1514 37.0 37.0 37.0 37.0 37.0 45-49 36.1933 37.0 37.0 37.0 37.0 37.0 50-54 36.1677 37.0 37.0 37.0 37.0 37.0 55-59 36.1768 37.0 37.0 37.0 37.0 37.0 60-64 36.1566 37.0 37.0 37.0 37.0 37.0 65-69 36.051300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.962300000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.9936 37.0 37.0 37.0 37.0 37.0 80-84 36.04440000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9609 37.0 37.0 37.0 37.0 37.0 90-94 35.9437 37.0 37.0 37.0 37.0 37.0 95-99 35.879200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.84121182499898 37.0 37.0 37.0 37.0 37.0 105-109 35.92703575526137 37.0 37.0 37.0 37.0 37.0 110-114 35.791747374125976 37.0 37.0 37.0 37.0 37.0 115-119 35.77557287086646 37.0 37.0 37.0 37.0 37.0 120-124 35.68297551477964 37.0 37.0 37.0 37.0 37.0 125-129 35.62230894726067 37.0 37.0 37.0 37.0 37.0 130-134 35.603538639917716 37.0 37.0 37.0 37.0 37.0 135-139 35.51149044026965 37.0 37.0 37.0 37.0 37.0 140-144 35.63172791339951 37.0 37.0 37.0 37.0 37.0 145-149 35.37137603479289 37.0 37.0 37.0 34.6 37.0 150 35.28214285714286 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 2.0 24 0.0 25 4.0 26 13.0 27 9.0 28 27.0 29 32.0 30 37.0 31 53.0 32 58.0 33 101.0 34 160.0 35 401.0 36 2882.0 37 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.872026045579766 18.50738792887553 18.582519408965688 36.03806661657901 2 23.517638228671505 28.84663497623217 33.72529397047786 13.910432824618463 3 21.825 34.050000000000004 24.025 20.1 4 23.125 36.425000000000004 20.775 19.675 5 22.275 39.225 20.7 17.8 6 15.825 39.525 23.175 21.475 7 14.17854463615904 15.978994748687173 45.91147786946736 23.93098274568642 8 18.475 22.825 29.475 29.225 9 20.474999999999998 22.175 27.825 29.525000000000002 10-14 21.17 28.884999999999998 27.534999999999997 22.41 15-19 21.75 28.185 27.765 22.3 20-24 21.125 29.505 27.315 22.055 25-29 21.060000000000002 28.62 27.884999999999998 22.435 30-34 21.48 28.694999999999997 27.93 21.895 35-39 22.025 28.01 27.834999999999997 22.13 40-44 21.48 29.035 27.029999999999998 22.455 45-49 21.63 27.935 27.92 22.515 50-54 21.75 28.64 27.525 22.085 55-59 21.89 28.000000000000004 27.810000000000002 22.3 60-64 21.915000000000003 28.549999999999997 27.474999999999998 22.06 65-69 21.905 28.265 27.455000000000002 22.375 70-74 21.61 28.37 27.750000000000004 22.27 75-79 21.21 28.04 27.644999999999996 23.105 80-84 22.205 27.575 27.889999999999997 22.33 85-89 21.634999999999998 28.96 27.71 21.695 90-94 22.105 27.51 27.48 22.905 95-99 22.035 27.88 27.63 22.455 100-104 22.292323869610936 27.725201542236245 27.13935206048771 22.843122527665113 105-109 21.45148356054531 27.21030473135525 28.297914995990375 23.04029671210906 110-114 22.118567559434247 28.824355502056378 27.088975825057677 21.9681011134517 115-119 21.808964513376498 27.95763690207298 27.78697987250916 22.44641871204136 120-124 21.824579039959787 27.42397587333501 27.986931389796432 22.764513696908768 125-129 21.496550682310286 27.95206203736341 28.16858854927237 22.382798731053928 130-134 22.68873637464675 27.76039563988696 27.286031489705287 22.264836495761 135-139 21.63556364739797 28.609720325696657 27.71456025893896 22.040155767966418 140-144 22.058823529411764 28.133874239350913 27.925963488843813 21.88133874239351 145-149 22.251108732222054 27.618901972778716 28.13885915277565 21.991130142223582 150 21.887755102040813 27.806122448979593 27.117346938775512 23.18877551020408 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.0 18 1.5 19 2.0 20 1.5 21 0.5 22 1.5 23 3.5 24 4.5 25 6.5 26 8.0 27 10.5 28 13.0 29 19.0 30 26.0 31 35.0 32 42.0 33 58.0 34 71.0 35 74.5 36 87.0 37 104.0 38 136.0 39 157.5 40 166.5 41 199.5 42 217.5 43 238.0 44 273.0 45 290.5 46 271.0 47 238.5 48 219.5 49 176.5 50 152.5 51 136.5 52 109.5 53 88.0 54 76.0 55 75.0 56 50.0 57 25.5 58 23.0 59 17.5 60 14.5 61 12.0 62 11.0 63 10.0 64 7.5 65 6.5 66 3.5 67 3.5 68 6.0 69 5.0 70 3.0 71 2.5 72 0.5 73 0.0 74 0.0 75 1.0 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 8.0 102-103 1.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 2.0 112-113 0.0 114-115 3.0 116-117 0.0 118-119 2.0 120-121 2.0 122-123 5.0 124-125 3.0 126-127 1.0 128-129 4.0 130-131 4.0 132-133 4.0 134-135 3.0 136-137 2.0 138-139 8.0 140-141 0.0 142-143 7.0 144-145 19.0 146-147 0.0 148-149 0.0 150-151 3920.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.00294637595758 72.125 2 12.581025338833236 21.349999999999998 3 2.121390689451974 5.4 4 0.1767825574543312 0.6 5 0.0883912787271656 0.375 6 0.02946375957572186 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGAAACCGAAACTCTATTCTCTGATATTTACGATCCTGTCCTCTCCGAG 6 0.15 No Hit ATTTACTCCCTCCTCTGTTTCTTCAAAACCTCCCCAAAAGACCAGAACCA 5 0.125 No Hit CTTGACAGCCCTCGCGTTGTGCAGAGTCTTACTTTGCTCATGTGAAGACC 5 0.125 No Hit CTTCCATAATCAAATTGCACTGGTGGTGGAGACGTTGGGCATTTGTGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTAC 10 0.007101894 143.125 2 ACCATGT 10 0.007101894 143.125 7 GGATTAG 10 0.007101894 143.125 4 CGAGACC 10 0.007101894 143.125 2 TTTACCA 10 0.007101894 143.125 4 TACCATG 10 0.007101894 143.125 6 ATTTACC 10 0.007101894 143.125 3 >>END_MODULE SRR12701863 read2 length is 100-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.39 37.0 37.0 37.0 37.0 37.0 2 36.326 37.0 37.0 37.0 37.0 37.0 3 36.3265 37.0 37.0 37.0 37.0 37.0 4 36.318 37.0 37.0 37.0 37.0 37.0 5 36.337 37.0 37.0 37.0 37.0 37.0 6 36.2695 37.0 37.0 37.0 37.0 37.0 7 36.3395 37.0 37.0 37.0 37.0 37.0 8 36.31 37.0 37.0 37.0 37.0 37.0 9 36.3115 37.0 37.0 37.0 37.0 37.0 10-14 36.3174 37.0 37.0 37.0 37.0 37.0 15-19 36.3779 37.0 37.0 37.0 37.0 37.0 20-24 36.3694 37.0 37.0 37.0 37.0 37.0 25-29 36.2658 37.0 37.0 37.0 37.0 37.0 30-34 36.251400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.195 37.0 37.0 37.0 37.0 37.0 40-44 36.2244 37.0 37.0 37.0 37.0 37.0 45-49 36.1614 37.0 37.0 37.0 37.0 37.0 50-54 36.134299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0518 37.0 37.0 37.0 37.0 37.0 60-64 36.081599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.98740000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.96510000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8812 37.0 37.0 37.0 37.0 37.0 80-84 35.7667 37.0 37.0 37.0 37.0 37.0 85-89 35.84590000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.809099999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.834799999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.63202649061783 37.0 37.0 37.0 37.0 37.0 105-109 35.7028854772863 37.0 37.0 37.0 37.0 37.0 110-114 35.72165182620784 37.0 37.0 37.0 37.0 37.0 115-119 35.601987407870766 37.0 37.0 37.0 37.0 37.0 120-124 35.40305889288096 37.0 37.0 37.0 34.6 37.0 125-129 35.49108280272305 37.0 37.0 37.0 34.6 37.0 130-134 35.389088824110885 37.0 37.0 37.0 37.0 37.0 135-139 35.37861749596853 37.0 37.0 37.0 34.6 37.0 140-144 35.488608486040945 37.0 37.0 37.0 37.0 37.0 145-149 35.32117980644125 37.0 37.0 37.0 29.8 37.0 150 35.2530612244898 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 7.0 25 8.0 26 9.0 27 13.0 28 8.0 29 19.0 30 30.0 31 53.0 32 59.0 33 101.0 34 216.0 35 657.0 36 2608.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.525 18.85 18.2 37.425000000000004 2 23.075000000000003 28.549999999999997 34.275 14.099999999999998 3 21.125 32.574999999999996 25.650000000000002 20.65 4 21.6 38.324999999999996 19.35 20.724999999999998 5 21.375 39.225 21.525 17.875 6 19.125 37.574999999999996 22.275 21.025 7 15.575 16.2 44.574999999999996 23.65 8 20.925 22.575 28.050000000000004 28.449999999999996 9 20.575 22.400000000000002 31.2 25.825 10-14 20.61 28.705000000000002 27.74 22.945 15-19 21.095 27.6 28.16 23.145 20-24 21.495 28.999999999999996 27.505000000000003 22.0 25-29 21.715 28.405 27.544999999999998 22.335 30-34 21.285 28.720000000000002 27.560000000000002 22.435 35-39 21.13 29.37 27.32 22.18 40-44 21.415 28.860000000000003 27.455000000000002 22.27 45-49 21.4 28.595 27.79 22.215 50-54 21.98 28.925 27.295 21.8 55-59 21.255 28.64 27.279999999999998 22.825 60-64 21.845 27.544999999999998 27.99 22.62 65-69 21.88 27.825 27.575 22.720000000000002 70-74 21.815 28.005000000000003 27.485 22.695 75-79 21.73 27.87 28.144999999999996 22.255 80-84 21.495 28.395 27.295 22.814999999999998 85-89 21.044999999999998 28.144999999999996 28.060000000000002 22.75 90-94 21.65 28.4 27.939999999999998 22.009999999999998 95-99 22.264999999999997 28.18 27.474999999999998 22.08 100-104 21.756546993140052 28.1057533423464 27.194431926293127 22.94326773822042 105-109 22.04791499599038 27.997193263833196 27.546110665597435 22.40878107457899 110-114 21.882836794061593 28.132209850536665 27.314675494031498 22.67027786137025 115-119 21.97962154294032 27.696632033328317 27.536013652562364 22.787732771169 120-124 21.85976375973863 28.414174415682332 27.795928625282734 21.930133199296307 125-129 21.89939070446649 28.148446548164557 27.579435016868924 22.372727730500024 130-134 22.476786435203874 27.906742026645137 27.765442067016554 21.851029471134435 135-139 21.392808375056894 27.997774743336873 28.382137257876906 22.22727962372933 140-144 22.2920892494929 28.240365111561864 27.408722109533468 22.058823529411764 145-149 22.480501605750113 28.18473772748127 27.384411479838917 21.950349186929703 150 22.091836734693878 27.98469387755102 27.857142857142858 22.066326530612244 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 0.5 20 0.5 21 1.5 22 2.5 23 3.5 24 6.0 25 7.0 26 8.0 27 11.0 28 12.0 29 17.5 30 30.0 31 37.0 32 43.5 33 52.5 34 62.0 35 83.5 36 93.0 37 102.5 38 127.0 39 154.0 40 178.5 41 194.0 42 230.5 43 264.5 44 266.0 45 256.5 46 250.5 47 254.0 48 221.5 49 193.5 50 175.5 51 129.0 52 95.0 53 84.0 54 70.5 55 51.5 56 42.0 57 30.5 58 25.5 59 25.5 60 21.0 61 12.0 62 8.5 63 8.0 64 6.5 65 6.5 66 5.5 67 5.0 68 6.0 69 5.0 70 4.5 71 3.5 72 1.5 73 1.5 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 8.0 102-103 1.0 104-105 0.0 106-107 1.0 108-109 1.0 110-111 2.0 112-113 0.0 114-115 3.0 116-117 0.0 118-119 2.0 120-121 2.0 122-123 5.0 124-125 3.0 126-127 1.0 128-129 4.0 130-131 4.0 132-133 4.0 134-135 3.0 136-137 2.0 138-139 8.0 140-141 0.0 142-143 7.0 144-145 19.0 146-147 0.0 148-149 0.0 150-151 3920.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.725 #Duplication Level Percentage of deduplicated Percentage of total 1 84.86279138388906 71.89999999999999 2 12.747123045146061 21.6 3 2.035998819710829 5.175 4 0.23605783416937148 0.8 5 0.08852168781351431 0.375 6 0.029507229271171435 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGGTTGCTGAATCGTCCTTGGACTCAGCTTCACATTCACAATCTTCGG 6 0.15 No Hit GTGGCTATTCTAGTTCTACCACTGGTGCTGCCACCATTACCACCGCCACC 5 0.125 No Hit TCTGGCTCTTATCTTCCCCACCTAAACCAGCAGATTCAACACCTGAAAGC 5 0.125 No Hit AAAACATGAATGATCTCTTTTCCGGCTCCTTCTCTCGCTTCCACAGTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAG 10 0.007101894 143.125 3 TCTGTCG 10 0.007101894 143.125 7 CCACAGT 10 0.007101894 143.125 4 CTGTCGG 10 0.007101894 143.125 8 CTGCAGC 10 0.007101894 143.125 6 ATCTGTC 15 1.2018699E-4 143.125 6 CTATTAT 10 0.007101894 143.125 1 >>END_MODULE Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067838 spots for SRR12701863.sra Written 1067838 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra Read 1067835 spots for SRR12701863.sra Written 1067835 spots for SRR12701863.sra SRR ids: ['SRR12701863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5kd7qzbf SRR12701863.sra spots: 21356703 blocks: [[1, 1067835], [1067836, 2135670], [2135671, 3203505], [3203506, 4271340], [4271341, 5339175], [5339176, 6407010], [6407011, 7474845], [7474846, 8542680], [8542681, 9610515], [9610516, 10678350], [10678351, 11746185], [11746186, 12814020], [12814021, 13881855], [13881856, 14949690], [14949691, 16017525], [16017526, 17085360], [17085361, 18153195], [18153196, 19221030], [19221031, 20288865], [20288866, 21356703]] SRR12701863 file size 7184274 SRR12701863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701863 SRR12701863_1.fastq SRR12701863_2.fastq Input file: SRR12701863_1.fastq Paired file: SRR12701863_2.fastq trimmed: SRR12701863-trimmed-pair1.fastq, SRR12701863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:09:40 2025 >> started Tue Feb 11 00:10:13 2025 >> done (32.895s) 21356703 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 24 ( 0.00%) empty read pairs filtered out after trimming by size control 21356679 (100.00%) read pairs available; of these: 53465 ( 0.25%) trimmed read pairs available after processing 21303214 (99.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 4 0.00% 31 6 0.00% 32 3 0.00% 33 7 0.00% 34 2 0.00% 35 5 0.00% 36 5 0.00% 37 4 0.00% 38 2 0.00% 39 8 0.00% 40 7 0.00% 41 4 0.00% 42 6 0.00% 43 5 0.00% 44 3 0.00% 45 9 0.00% 46 6 0.00% 47 8 0.00% 48 6 0.00% 49 9 0.00% 50 8 0.00% 51 5 0.00% 52 6 0.00% 53 6 0.00% 54 7 0.00% 55 7 0.00% 56 7 0.00% 57 7 0.00% 58 5 0.00% 59 4 0.00% 60 8 0.00% 61 11 0.00% 62 9 0.00% 63 7 0.00% 64 7 0.00% 65 7 0.00% 66 8 0.00% 67 8 0.00% 68 14 0.00% 69 9 0.00% 70 8 0.00% 71 14 0.00% 72 11 0.00% 73 8 0.00% 74 6 0.00% 75 10 0.00% 76 11 0.00% 77 7 0.00% 78 7 0.00% 79 12 0.00% 80 5 0.00% 81 10 0.00% 82 12 0.00% 83 6 0.00% 84 6 0.00% 85 6 0.00% 86 8 0.00% 87 10 0.00% 88 7 0.00% 89 15 0.00% 90 8 0.00% 91 14 0.00% 92 15 0.00% 93 12 0.00% 94 10 0.00% 95 9 0.00% 96 10 0.00% 97 10 0.00% 98 15 0.00% 99 1324 0.01% 100 1336 0.01% 101 1444 0.01% 102 1596 0.01% 103 1771 0.01% 104 1766 0.01% 105 1814 0.01% 106 2025 0.01% 107 2139 0.01% 108 2227 0.01% 109 2399 0.01% 110 2486 0.01% 111 2730 0.01% 112 2949 0.01% 113 2988 0.01% 114 3177 0.01% 115 3377 0.02% 116 3372 0.02% 117 3711 0.02% 118 3716 0.02% 119 3935 0.02% 120 4250 0.02% 121 4438 0.02% 122 4847 0.02% 123 5007 0.02% 124 5109 0.02% 125 5584 0.03% 126 5504 0.03% 127 5900 0.03% 128 6026 0.03% 129 6488 0.03% 130 6622 0.03% 131 6963 0.03% 132 7206 0.03% 133 7499 0.04% 134 7843 0.04% 135 8455 0.04% 136 8875 0.04% 137 73 0.00% 138 8889 0.04% 139 9480 0.04% 140 9607 0.04% 141 10251 0.05% 142 10856 0.05% 143 12386 0.06% 144 18095 0.08% 145 63716 0.30% 146 12197 0.06% 147 12712 0.06% 148 13240 0.06% 149 13583 0.06% 150 21002144 98.34% 21356679 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=2.1 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=247.37 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.0 sequence=GAAAGAAAGATAGTCTTTGGGTCCTTCAACTGCTGCAGAAAGTTTCTCGAAGAAGAAACAAACAAGTTTCTACGGCAGTTGAAATATATAAAAGATCCATCATCTCTTGTTTTCATAACTTCTTTCACAAAGTTTGAATCAAATCACACACTGTATTTGTAGAATGGCTCGTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=40 prefix-density=0.28 prefix-fanout=2.1 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=348.11 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.6 sequence=GAAAGAAAGATAGTCTTTGGGTCCTTCAACTGCTGCAGAAAGTTTCTCGAAGAAGAAACAAACAAGTTTCTACGGCAGTTGAAATATATAAAAGATCCATCATCTCTTGTTTTCATAACTTCTTTCACAAAGTTTGAATCAAATCACACACTGTATTTGTAGAATGGCTCGTT SRR12701863 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:11:05 Started mapping on | Feb 11 00:11:05 Finished on | Feb 11 00:15:46 Mapping speed, Million of reads per hour | 273.61 Number of input reads | 21356679 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18875061 Uniquely mapped reads % | 88.38% Average mapped length | 295.10 Number of splices: Total | 16858040 Number of splices: Annotated (sjdb) | 16296898 Number of splices: GT/AG | 16498626 Number of splices: GC/AG | 203377 Number of splices: AT/AC | 25006 Number of splices: Non-canonical | 131031 Mismatch rate per base, % | 1.26% Deletion rate per base | 0.11% Deletion average length | 3.36 Insertion rate per base | 0.09% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1079168 % of reads mapped to multiple loci | 5.05% Number of reads mapped to too many loci | 113468 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.75% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1402450 1402450 1402450 N_multimapping 1079168 1079168 1079168 N_noFeature 771164 9696092 9843219 N_ambiguous 273007 84859 82379 UnstrandedReadsAssigned:17830890 PositiveStrandReadsAssigned:9094110 NegativeStrandReadsAssigned:8949463 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12701863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701863-trimmed-pair1.fastq SRR12701863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,356,679 reads, 17,661,698 reads pseudoaligned [quant] estimated average fragment length: 260.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR12701863.ke.tsv 34699 SRR12701863.se.tsv 87100 total ==> SRR12701863.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.68 1702 36.9122 Potri.005G024800.1.v4.1 1035 775.682 12826 630.675 Potri.004G059700.1.v4.1 961 701.687 36 1.95685 Potri.007G009000.2.v4.1 1416 1156.68 0 0 Potri.003G141000.2.v4.1 2943 2683.68 770.327 10.9482 Potri.016G087400.1.v4.1 270 49.781 1152.18 882.785 Potri.015G069301.1.v4.1 564 304.986 0 0 Potri.010G195200.1.v4.1 1773 1513.68 44 1.10871 Potri.012G127500.1.v4.1 977 717.682 6082 323.231 ==> SRR12701863.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 879 SRR12701863 completed mapping pipeline successfully