Starting /dee2/code/volunteer_pipeline.sh SRR12701864 current disk space = 3057228566528 free memory = 1578836328 SRR12701864 SRAfilesize a83d69ed27454fe7e116baa0c3354dd3 SRR12701864.sra SRR12701864.sra file validated SRR12701864 is paired end SRR12701864 is conventional basespace SRR12701864 read1 length is 107-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 107-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.251 37.0 37.0 37.0 37.0 37.0 2 36.377 37.0 37.0 37.0 37.0 37.0 3 36.3595 37.0 37.0 37.0 37.0 37.0 4 36.268 37.0 37.0 37.0 37.0 37.0 5 36.39 37.0 37.0 37.0 37.0 37.0 6 36.452 37.0 37.0 37.0 37.0 37.0 7 36.447 37.0 37.0 37.0 37.0 37.0 8 36.429 37.0 37.0 37.0 37.0 37.0 9 36.4015 37.0 37.0 37.0 37.0 37.0 10-14 36.4412 37.0 37.0 37.0 37.0 37.0 15-19 36.4234 37.0 37.0 37.0 37.0 37.0 20-24 36.3636 37.0 37.0 37.0 37.0 37.0 25-29 36.336 37.0 37.0 37.0 37.0 37.0 30-34 36.28060000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.2714 37.0 37.0 37.0 37.0 37.0 40-44 36.1567 37.0 37.0 37.0 37.0 37.0 45-49 36.171400000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.12925 37.0 37.0 37.0 37.0 37.0 55-59 36.122049999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.08285 37.0 37.0 37.0 37.0 37.0 65-69 36.001400000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9385 37.0 37.0 37.0 37.0 37.0 75-79 35.9296 37.0 37.0 37.0 37.0 37.0 80-84 35.977199999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8927 37.0 37.0 37.0 37.0 37.0 90-94 35.8634 37.0 37.0 37.0 37.0 37.0 95-99 35.8202 37.0 37.0 37.0 37.0 37.0 100-104 35.7941 37.0 37.0 37.0 37.0 37.0 105-109 35.76922462667943 37.0 37.0 37.0 37.0 37.0 110-114 35.743971985993 37.0 37.0 37.0 37.0 37.0 115-119 35.68469458647262 37.0 37.0 37.0 37.0 37.0 120-124 35.64701231821536 37.0 37.0 37.0 37.0 37.0 125-129 35.58702581348737 37.0 37.0 37.0 37.0 37.0 130-134 35.53426301345345 37.0 37.0 37.0 37.0 37.0 135-139 35.53387226084393 37.0 37.0 37.0 37.0 37.0 140-144 35.59034064407461 37.0 37.0 37.0 37.0 37.0 145-149 35.386808433708 37.0 37.0 37.0 37.0 37.0 150 35.23898734177215 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 1.0 21 1.0 22 2.0 23 6.0 24 3.0 25 6.0 26 12.0 27 15.0 28 15.0 29 35.0 30 42.0 31 47.0 32 50.0 33 98.0 34 140.0 35 410.0 36 2962.0 37 152.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.41612418627942 19.228843264897346 17.95192789183776 35.40310465698548 2 22.12212212212212 28.178178178178175 35.810810810810814 13.88888888888889 3 20.325 32.9 26.575 20.200000000000003 4 20.724999999999998 39.025 21.224999999999998 19.025 5 21.15 37.775 22.400000000000002 18.675 6 16.1 37.675 24.525 21.7 7 16.08304152076038 16.58329164582291 43.67183591795898 23.66183091545773 8 19.875 22.625 29.575000000000003 27.925 9 21.0 21.8 29.45 27.750000000000004 10-14 20.815 29.01 27.41 22.765 15-19 21.65 28.375 27.939999999999998 22.035 20-24 20.990000000000002 29.020000000000003 27.750000000000004 22.24 25-29 21.02 30.115 27.21 21.654999999999998 30-34 20.89 28.994999999999997 27.91 22.205 35-39 21.785 28.34 27.465 22.41 40-44 21.305 28.83 28.044999999999998 21.82 45-49 21.33 28.384999999999998 28.255000000000003 22.03 50-54 21.796089804490222 27.626381319065953 28.261413070653536 22.31611580579029 55-59 22.01610080504025 28.361418070903543 28.0314015700785 21.5910795539777 60-64 21.68108405420271 28.036401820091005 27.896394819740987 22.3861193059653 65-69 21.505 28.52 27.375 22.6 70-74 21.834999999999997 28.294999999999998 27.650000000000002 22.220000000000002 75-79 21.605 28.055000000000003 27.71 22.63 80-84 22.185 27.74 28.175 21.9 85-89 21.9 28.09 27.675 22.335 90-94 22.205 28.1 27.855 21.84 95-99 22.21 27.58 27.93 22.28 100-104 21.185000000000002 28.485 27.555000000000003 22.775000000000002 105-109 21.178176726508976 28.519277891683753 27.969195379306893 22.333350002500374 110-114 21.720860430215108 28.899449724862432 27.533766883441718 21.845922961480742 115-119 22.083249949969982 28.306984190514306 27.966780068040826 21.642985791474885 120-124 22.124824684431978 28.46623923061511 27.624724504107395 21.784211580845522 125-129 21.96137446701781 27.93077501881114 27.539503386004515 22.56834712816654 130-134 21.504998241824484 28.28653237554629 27.970060782639273 22.238408599989953 135-139 21.601086847136962 27.815235986716313 28.09197947066519 22.491697695481534 140-144 22.508314017938126 27.5773455608183 28.25758339211932 21.656757029124257 145-149 21.803369933714517 28.285179375600872 27.591964782674694 22.319485908009916 150 21.518987341772153 28.20253164556962 28.025316455696203 22.253164556962023 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 3.0 25 6.5 26 8.5 27 7.5 28 10.0 29 12.5 30 20.0 31 29.0 32 46.0 33 57.0 34 54.5 35 76.5 36 94.5 37 106.5 38 131.0 39 160.5 40 207.5 41 240.5 42 264.5 43 273.0 44 269.0 45 262.5 46 243.0 47 232.0 48 210.0 49 187.0 50 156.0 51 133.5 52 108.5 53 82.5 54 69.5 55 49.5 56 37.5 57 30.0 58 21.5 59 12.5 60 12.0 61 11.5 62 9.5 63 8.5 64 5.5 65 3.5 66 2.0 67 2.5 68 4.5 69 3.0 70 2.0 71 2.0 72 1.5 73 1.5 74 1.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 107 1.0 108 1.0 109 0.0 110 0.0 111 0.0 112 0.0 113 0.0 114 0.0 115 0.0 116 0.0 117 1.0 118 0.0 119 1.0 120 2.0 121 0.0 122 3.0 123 2.0 124 0.0 125 1.0 126 1.0 127 1.0 128 1.0 129 1.0 130 2.0 131 1.0 132 0.0 133 2.0 134 1.0 135 1.0 136 4.0 137 0.0 138 0.0 139 2.0 140 0.0 141 2.0 142 1.0 143 1.0 144 4.0 145 13.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3950.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.05461940732133 74.05000000000001 2 12.027890761185358 20.7 3 1.568855316676351 4.05 4 0.3486345148169669 1.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCAT 10 0.0070337174 143.5875 5 >>END_MODULE SRR12701864 read2 length is 107-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12701864_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 107-150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.203 37.0 37.0 37.0 37.0 37.0 2 36.055 37.0 37.0 37.0 37.0 37.0 3 36.149 37.0 37.0 37.0 37.0 37.0 4 36.141 37.0 37.0 37.0 37.0 37.0 5 36.1345 37.0 37.0 37.0 37.0 37.0 6 36.093 37.0 37.0 37.0 37.0 37.0 7 36.0635 37.0 37.0 37.0 37.0 37.0 8 36.1125 37.0 37.0 37.0 37.0 37.0 9 36.303 37.0 37.0 37.0 37.0 37.0 10-14 36.212 37.0 37.0 37.0 37.0 37.0 15-19 36.1765 37.0 37.0 37.0 37.0 37.0 20-24 36.1933 37.0 37.0 37.0 37.0 37.0 25-29 36.1094 37.0 37.0 37.0 37.0 37.0 30-34 36.0354 37.0 37.0 37.0 37.0 37.0 35-39 36.0558 37.0 37.0 37.0 37.0 37.0 40-44 36.015699999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.9154 37.0 37.0 37.0 37.0 37.0 50-54 35.9187 37.0 37.0 37.0 37.0 37.0 55-59 35.793099999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.80800000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.79279999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.77739999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.60549999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.5265 37.0 37.0 37.0 34.6 37.0 85-89 35.64319999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.5726 37.0 37.0 37.0 37.0 37.0 95-99 35.566 37.0 37.0 37.0 37.0 37.0 100-104 35.389700000000005 37.0 37.0 37.0 32.2 37.0 105-109 35.412756346014966 37.0 37.0 37.0 34.6 37.0 110-114 35.46893446723362 37.0 37.0 37.0 34.6 37.0 115-119 35.31188879403424 37.0 37.0 37.0 29.8 37.0 120-124 35.09331712408904 37.0 37.0 37.0 27.4 37.0 125-129 35.12557807858089 37.0 37.0 37.0 27.4 37.0 130-134 35.07877501350799 37.0 37.0 37.0 25.0 37.0 135-139 35.10278118930895 37.0 37.0 37.0 27.4 37.0 140-144 35.1855828719048 37.0 37.0 37.0 27.4 37.0 145-149 35.08689670592218 37.0 37.0 37.0 25.0 37.0 150 34.86886075949367 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 0.0 22 1.0 23 2.0 24 9.0 25 7.0 26 9.0 27 19.0 28 20.0 29 20.0 30 41.0 31 57.0 32 71.0 33 140.0 34 279.0 35 816.0 36 2387.0 37 116.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.35 19.75 19.0 35.9 2 21.075 29.075 36.4 13.450000000000001 3 20.375 33.525 25.924999999999997 20.175 4 21.45 36.675000000000004 20.674999999999997 21.2 5 20.974999999999998 36.95 24.2 17.875 6 16.975 37.25 24.45 21.325 7 15.725 16.85 44.1 23.325000000000003 8 19.725 20.225 29.975 30.075000000000003 9 21.4 22.1 28.625 27.875 10-14 20.535 28.665000000000003 27.79 23.01 15-19 20.855 28.205000000000002 28.355000000000004 22.585 20-24 20.965 29.07 27.705000000000002 22.259999999999998 25-29 21.39 28.999999999999996 27.49 22.12 30-34 21.8 29.354999999999997 27.165 21.68 35-39 20.895 29.57 27.49 22.045 40-44 21.654999999999998 28.720000000000002 27.725 21.9 45-49 21.815 28.910000000000004 27.634999999999998 21.64 50-54 21.39 28.96 27.98 21.67 55-59 21.82 28.395 27.93 21.855 60-64 21.705 27.98 28.16 22.155 65-69 21.51 28.865000000000002 28.000000000000004 21.625 70-74 21.275 28.22 28.15 22.355 75-79 21.790000000000003 28.17 27.800000000000004 22.24 80-84 21.63 28.810000000000002 27.33 22.23 85-89 22.49 28.185 28.199999999999996 21.125 90-94 21.81 28.139999999999997 27.860000000000003 22.189999999999998 95-99 22.09 27.939999999999998 28.395 21.575 100-104 21.98 28.57 27.474999999999998 21.975 105-109 20.988148222233335 28.5042756413462 27.85417812671901 22.653398009701455 110-114 21.690845422711355 28.07403701850926 27.57878939469735 22.65632816408204 115-119 21.788072843706225 28.817290374224534 27.71662997798679 21.67800680408245 120-124 22.415347625726305 28.496293327990387 27.75495892606692 21.33340012021639 125-129 21.62528216704289 28.49761725608227 27.399046902432904 22.478053674441938 130-134 21.70593258652735 28.618074044306024 27.83945345858241 21.836539910584214 135-139 22.41119050015095 28.247962161618194 27.473080406561333 21.867766931669518 140-144 22.100171319157514 28.398669757129902 27.26997883704525 22.231180086667337 145-149 21.767950209988363 28.533117441683952 27.536305216819308 22.162627131508376 150 22.987341772151897 27.417721518987342 27.569620253164555 22.025316455696203 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 3.0 21 2.5 22 2.0 23 3.0 24 2.5 25 5.0 26 7.0 27 11.0 28 15.5 29 21.5 30 27.5 31 32.0 32 45.5 33 57.0 34 63.5 35 73.5 36 101.0 37 126.5 38 155.5 39 182.0 40 198.0 41 235.0 42 253.5 43 271.5 44 271.5 45 247.0 46 236.5 47 214.0 48 197.0 49 190.0 50 156.5 51 119.5 52 98.5 53 75.0 54 55.5 55 39.5 56 29.0 57 31.5 58 35.0 59 24.5 60 14.5 61 14.5 62 13.5 63 8.0 64 3.5 65 5.0 66 5.5 67 2.0 68 1.5 69 3.0 70 4.5 71 2.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 107 1.0 108 1.0 109 0.0 110 0.0 111 0.0 112 0.0 113 0.0 114 0.0 115 0.0 116 0.0 117 1.0 118 0.0 119 1.0 120 2.0 121 0.0 122 3.0 123 2.0 124 0.0 125 1.0 126 1.0 127 1.0 128 1.0 129 1.0 130 2.0 131 1.0 132 0.0 133 2.0 134 1.0 135 1.0 136 4.0 137 0.0 138 0.0 139 2.0 140 0.0 141 2.0 142 1.0 143 1.0 144 4.0 145 13.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3950.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.47007805724198 74.775 2 11.795316565481354 20.4 3 1.4165943914426133 3.675 4 0.26019080659150046 0.8999999999999999 5 0.057820179242555655 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGACGCTGGCATACTCCTACCATTATCAAGAACAGATCGGATCTCCTCC 5 0.125 No Hit CTTTCCTTGGCTTCTCTTGCCACTCCTCCCAGCTTCTCATCCTCGTATGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra Read 1042493 spots for SRR12701864.sra Written 1042493 spots for SRR12701864.sra Read 1042492 spots for SRR12701864.sra Written 1042492 spots for SRR12701864.sra SRR ids: ['SRR12701864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p3tijj_c SRR12701864.sra spots: 20849841 blocks: [[1, 1042492], [1042493, 2084984], [2084985, 3127476], [3127477, 4169968], [4169969, 5212460], [5212461, 6254952], [6254953, 7297444], [7297445, 8339936], [8339937, 9382428], [9382429, 10424920], [10424921, 11467412], [11467413, 12509904], [12509905, 13552396], [13552397, 14594888], [14594889, 15637380], [15637381, 16679872], [16679873, 17722364], [17722365, 18764856], [18764857, 19807348], [19807349, 20849841]] SRR12701864 file size 7015232 SRR12701864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12701864 SRR12701864_1.fastq SRR12701864_2.fastq Input file: SRR12701864_1.fastq Paired file: SRR12701864_2.fastq trimmed: SRR12701864-trimmed-pair1.fastq, SRR12701864-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:06:38 2025 >> started Tue Feb 11 01:07:03 2025 >> done (24.723s) 20849841 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 12 ( 0.00%) empty read pairs filtered out after trimming by size control 20849826 (100.00%) read pairs available; of these: 41597 ( 0.20%) trimmed read pairs available after processing 20808229 (99.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 6 0.00% 27 5 0.00% 28 5 0.00% 29 2 0.00% 30 1 0.00% 31 1 0.00% 32 5 0.00% 33 2 0.00% 34 8 0.00% 35 5 0.00% 36 4 0.00% 37 6 0.00% 38 7 0.00% 39 8 0.00% 40 3 0.00% 41 5 0.00% 42 10 0.00% 43 8 0.00% 44 9 0.00% 45 6 0.00% 46 10 0.00% 47 13 0.00% 48 7 0.00% 49 10 0.00% 50 11 0.00% 51 11 0.00% 52 9 0.00% 53 7 0.00% 54 7 0.00% 55 5 0.00% 56 7 0.00% 57 7 0.00% 58 5 0.00% 59 6 0.00% 60 6 0.00% 61 10 0.00% 62 7 0.00% 63 8 0.00% 64 8 0.00% 65 11 0.00% 66 8 0.00% 67 6 0.00% 68 5 0.00% 69 8 0.00% 70 11 0.00% 71 10 0.00% 72 12 0.00% 73 7 0.00% 74 8 0.00% 75 10 0.00% 76 4 0.00% 77 6 0.00% 78 11 0.00% 79 18 0.00% 80 3 0.00% 81 8 0.00% 82 7 0.00% 83 12 0.00% 84 9 0.00% 85 12 0.00% 86 12 0.00% 87 9 0.00% 88 13 0.00% 89 9 0.00% 90 17 0.00% 91 8 0.00% 92 15 0.00% 93 8 0.00% 94 12 0.00% 95 21 0.00% 96 15 0.00% 97 14 0.00% 98 8 0.00% 99 986 0.00% 100 1170 0.01% 101 1142 0.01% 102 1267 0.01% 103 1415 0.01% 104 1371 0.01% 105 1511 0.01% 106 1595 0.01% 107 1666 0.01% 108 1838 0.01% 109 1899 0.01% 110 1932 0.01% 111 2042 0.01% 112 2214 0.01% 113 2337 0.01% 114 2381 0.01% 115 2584 0.01% 116 2735 0.01% 117 2924 0.01% 118 2954 0.01% 119 3034 0.01% 120 3257 0.02% 121 3410 0.02% 122 3721 0.02% 123 3636 0.02% 124 4016 0.02% 125 4001 0.02% 126 4412 0.02% 127 4490 0.02% 128 4624 0.02% 129 4911 0.02% 130 5021 0.02% 131 5236 0.03% 132 5499 0.03% 133 5802 0.03% 134 6246 0.03% 135 6276 0.03% 136 6711 0.03% 137 79 0.00% 138 6977 0.03% 139 7292 0.03% 140 7557 0.04% 141 7987 0.04% 142 8277 0.04% 143 9652 0.05% 144 15212 0.07% 145 59650 0.29% 146 9191 0.04% 147 9946 0.05% 148 10130 0.05% 149 10431 0.05% 150 20564563 98.63% 20849826 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.1 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=7 fanout-score=157.03 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=20.7 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.1 sequence=CCGGGAGGTGGCTTCTTTCCGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=189.13 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=23.1 sequence=GCTGCTGCTGCT SRR12701864 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:07:53 Started mapping on | Feb 11 01:07:53 Finished on | Feb 11 01:11:42 Mapping speed, Million of reads per hour | 327.77 Number of input reads | 20849826 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18769899 Uniquely mapped reads % | 90.02% Average mapped length | 295.28 Number of splices: Total | 16851396 Number of splices: Annotated (sjdb) | 16304425 Number of splices: GT/AG | 16478146 Number of splices: GC/AG | 225000 Number of splices: AT/AC | 23917 Number of splices: Non-canonical | 124333 Mismatch rate per base, % | 1.25% Deletion rate per base | 0.11% Deletion average length | 3.33 Insertion rate per base | 0.08% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 967256 % of reads mapped to multiple loci | 4.64% Number of reads mapped to too many loci | 98789 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.57% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1112671 1112671 1112671 N_multimapping 967256 967256 967256 N_noFeature 877663 9702675 9851215 N_ambiguous 250345 79663 78153 UnstrandedReadsAssigned:17641891 PositiveStrandReadsAssigned:8987561 NegativeStrandReadsAssigned:8840531 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12701864 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12701864-trimmed-pair1.fastq SRR12701864-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,849,826 reads, 17,417,134 reads pseudoaligned [quant] estimated average fragment length: 267.703 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR12701864.ke.tsv 34699 SRR12701864.se.tsv 87100 total ==> SRR12701864.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.3 1681 47.5672 Potri.005G024800.1.v4.1 1035 768.297 5215 336.376 Potri.004G059700.1.v4.1 961 694.297 26 1.85579 Potri.007G009000.2.v4.1 1416 1149.3 0 0 Potri.003G141000.2.v4.1 2943 2676.3 903.859 16.7366 Potri.016G087400.1.v4.1 270 49.1789 861.199 867.81 Potri.015G069301.1.v4.1 564 297.613 0 0 Potri.010G195200.1.v4.1 1773 1506.3 68 2.23717 Potri.012G127500.1.v4.1 977 710.297 5864 409.123 ==> SRR12701864.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 110 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1055 SRR12701864 completed mapping pipeline successfully