Starting /dee2/code/volunteer_pipeline.sh SRR12768910 current disk space = 3057068126208 free memory = 1224205064 SRR12768910 SRAfilesize 7991def1a52c8edccff24f19fc11f0de SRR12768910.sra SRR12768910.sra file validated SRR12768910 is single end SRR12768910 is conventional basespace SRR12768910 read1 length is 45-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12768910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7105 37.0 37.0 37.0 37.0 37.0 2 36.487 37.0 37.0 37.0 37.0 37.0 3 36.528 37.0 37.0 37.0 37.0 37.0 4 36.518 37.0 37.0 37.0 37.0 37.0 5 36.5755 37.0 37.0 37.0 37.0 37.0 6 36.3715 37.0 37.0 37.0 37.0 37.0 7 36.3735 37.0 37.0 37.0 37.0 37.0 8 36.4135 37.0 37.0 37.0 37.0 37.0 9 36.4945 37.0 37.0 37.0 37.0 37.0 10-14 36.4829 37.0 37.0 37.0 37.0 37.0 15-19 36.380100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.3617 37.0 37.0 37.0 37.0 37.0 25-29 36.333600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3919 37.0 37.0 37.0 37.0 37.0 35-39 36.342200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.32809999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.300255913978496 37.0 37.0 37.0 37.0 37.0 50-54 36.251612903225805 37.0 37.0 37.0 37.0 37.0 55-59 36.18436707726206 37.0 37.0 37.0 37.0 37.0 60-64 36.18232215932835 37.0 37.0 37.0 37.0 37.0 65-69 36.16763305712517 37.0 37.0 37.0 37.0 37.0 70-74 36.08704018160839 37.0 37.0 37.0 37.0 37.0 75-79 36.11393808138154 37.0 37.0 37.0 37.0 37.0 80-84 36.09953401653909 37.0 37.0 37.0 37.0 37.0 85-89 36.15604616156548 37.0 37.0 37.0 37.0 37.0 90-94 35.940291945271255 37.0 37.0 37.0 37.0 37.0 95-99 36.00827013647114 37.0 37.0 37.0 37.0 37.0 100-104 36.03166955974105 37.0 37.0 37.0 37.0 37.0 105-109 35.95092722413162 37.0 37.0 37.0 37.0 37.0 110-114 35.857424095406884 37.0 37.0 37.0 37.0 37.0 115-119 35.802750879957415 37.0 37.0 37.0 37.0 37.0 120-124 35.76228826955317 37.0 37.0 37.0 37.0 37.0 125-129 35.779105291121006 37.0 37.0 37.0 37.0 37.0 130-134 35.66748839208545 37.0 37.0 37.0 37.0 37.0 135-139 35.529097236883274 37.0 37.0 37.0 37.0 37.0 140-141 35.356471893491126 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 5.0 26 5.0 27 9.0 28 8.0 29 13.0 30 11.0 31 36.0 32 54.0 33 84.0 34 145.0 35 566.0 36 2751.0 37 312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.725 16.650000000000002 9.275 25.35 2 23.0 24.15 37.8 15.049999999999999 3 19.650000000000002 26.275 29.799999999999997 24.275 4 24.6 34.55 21.625 19.225 5 24.075 35.699999999999996 23.05 17.175 6 18.975 32.95 27.025 21.05 7 18.625 16.025 42.3 23.05 8 22.8 19.05 27.05 31.1 9 22.225 23.325000000000003 27.750000000000004 26.700000000000003 10-14 24.779999999999998 27.22 24.825 23.175 15-19 23.77 27.529999999999998 28.060000000000002 20.64 20-24 23.575 28.275 26.765 21.385 25-29 23.45 27.92 27.250000000000004 21.38 30-34 23.815 27.155 28.15 20.880000000000003 35-39 23.16 27.894999999999996 28.044999999999998 20.9 40-44 23.1 27.689999999999998 28.285 20.925 45-49 23.424684936987397 27.760552110422083 27.295459091818365 21.519303860772155 50-54 23.16079019754939 28.212053013253314 28.02200550137534 20.605151287821954 55-59 24.119647859143658 27.981192476990795 27.44597839135654 20.453181272509003 60-64 23.281296907835486 27.15901130791554 28.25477834484139 21.304913439407585 65-69 23.198558847077663 27.306845476381103 28.06244995996797 21.43214571657326 70-74 23.54472195805596 27.919315281045098 27.68406827168527 20.851894489213674 75-79 23.684078729904343 27.059648419892824 28.74743326488706 20.508839585315773 80-84 23.078080336994134 27.35068451933203 28.027681660899656 21.543553482774183 85-89 23.351731058705468 28.41445057701957 26.964375313597593 21.26944305067737 90-94 23.776504873882022 27.7962013867953 27.625364284996483 20.8019294543262 95-99 23.133125062984984 27.60253955457019 28.32812657462461 20.93620880782022 100-104 23.57912849840579 27.703831165544816 27.982185333265853 20.734855002783544 105-109 23.161970754572785 27.263463596066646 28.068477097875377 21.5060885514852 110-114 23.932196403730227 27.456334690092227 27.868514606625794 20.742954299551755 115-119 24.121180464873333 27.594672238182294 27.66257508487856 20.621572212065814 120-124 23.360459550023936 27.578320302111592 28.636774639646827 20.424445508217648 125-129 23.632003488118595 27.637889688249402 28.095705253978636 20.634401569653367 130-134 23.845851797834744 28.45683513771246 27.598586413866606 20.09872665058619 135-139 24.6690942720074 27.1487197271834 27.622680769897695 20.55950523091151 140-141 23.041543026706233 28.531157270029674 27.7893175074184 20.637982195845698 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.5 28 4.0 29 5.5 30 12.0 31 18.0 32 25.0 33 30.0 34 36.0 35 48.0 36 64.0 37 81.5 38 113.5 39 161.5 40 193.0 41 198.0 42 220.5 43 246.0 44 270.5 45 297.0 46 294.0 47 290.5 48 274.0 49 230.5 50 183.5 51 151.5 52 142.0 53 110.5 54 68.5 55 60.5 56 51.5 57 32.0 58 18.5 59 14.5 60 12.5 61 9.0 62 8.0 63 7.5 64 5.0 65 4.5 66 4.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 1.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 1.0 70-71 0.0 72-73 1.0 74-75 1.0 76-77 1.0 78-79 2.0 80-81 3.0 82-83 1.0 84-85 1.0 86-87 0.0 88-89 3.0 90-91 2.0 92-93 3.0 94-95 8.0 96-97 2.0 98-99 8.0 100-101 7.0 102-103 9.0 104-105 11.0 106-107 15.0 108-109 19.0 110-111 17.0 112-113 18.0 114-115 20.0 116-117 25.0 118-119 33.0 120-121 23.0 122-123 37.0 124-125 34.0 126-127 46.0 128-129 33.0 130-131 51.0 132-133 40.0 134-135 32.0 136-137 53.0 138-139 57.0 140-141 3380.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 87.54641530991145 76.625 2 10.796915167095115 18.9 3 1.5138531848043417 3.975 4 0.14281633818908884 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCAC 10 0.009192968 131.2875 1 ACTTGGA 10 0.009192968 131.2875 8 ACTTGAT 10 0.009192968 131.2875 6 AGGGTGC 10 0.009192968 131.2875 6 CCTCACT 10 0.009192968 131.2875 2 CTTGATG 10 0.009192968 131.2875 7 TTTACTT 10 0.009192968 131.2875 5 TCCTTCA 15 0.0027672125 65.64375 28-29 CTCAGGA 15 0.0027672125 65.64375 82-83 TCTTGTT 20 0.0047857403 57.081524 128-129 >>END_MODULE Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra Rejected 2758378 READS because READLEN < 1 Read 2758378 spots for SRR12768910.sra Written 2758378 spots for SRR12768910.sra Rejected 2758364 READS because READLEN < 1 Read 2758364 spots for SRR12768910.sra Written 2758364 spots for SRR12768910.sra SRR ids: ['SRR12768910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lgt3qtq8 SRR12768910.sra spots: 55167294 blocks: [[1, 2758364], [2758365, 5516728], [5516729, 8275092], [8275093, 11033456], [11033457, 13791820], [13791821, 16550184], [16550185, 19308548], [19308549, 22066912], [22066913, 24825276], [24825277, 27583640], [27583641, 30342004], [30342005, 33100368], [33100369, 35858732], [35858733, 38617096], [38617097, 41375460], [41375461, 44133824], [44133825, 46892188], [46892189, 49650552], [49650553, 52408916], [52408917, 55167294]] SRR12768910 file size 8641849 SRR12768910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12768910 SRR12768910_2.fastq Input file: SRR12768910_2.fastq trimmed: SRR12768910-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:48:57 2025 >> started Mon Feb 10 21:49:21 2025 >> done (23.602s) 27583647 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 27583592 (100.00%) reads available; of these: 2 ( 0.00%) trimmed reads available after processing 27583590 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 14 0.00% 20 22 0.00% 21 29 0.00% 22 28 0.00% 23 32 0.00% 24 23 0.00% 25 61 0.00% 26 28 0.00% 27 25 0.00% 28 36 0.00% 29 35 0.00% 30 47 0.00% 31 34 0.00% 32 37 0.00% 33 50 0.00% 34 27 0.00% 35 35 0.00% 36 30 0.00% 37 40 0.00% 38 47 0.00% 39 54 0.00% 40 120 0.00% 41 173 0.00% 42 210 0.00% 43 183 0.00% 44 252 0.00% 45 225 0.00% 46 261 0.00% 47 287 0.00% 48 444 0.00% 49 367 0.00% 50 451 0.00% 51 437 0.00% 52 502 0.00% 53 535 0.00% 54 626 0.00% 55 657 0.00% 56 649 0.00% 57 710 0.00% 58 760 0.00% 59 855 0.00% 60 863 0.00% 61 1016 0.00% 62 1041 0.00% 63 1209 0.00% 64 1242 0.00% 65 1295 0.00% 66 1458 0.01% 67 1540 0.01% 68 1670 0.01% 69 1888 0.01% 70 2220 0.01% 71 2357 0.01% 72 2504 0.01% 73 2823 0.01% 74 3131 0.01% 75 3357 0.01% 76 3723 0.01% 77 3996 0.01% 78 4310 0.02% 79 4801 0.02% 80 5265 0.02% 81 5854 0.02% 82 6339 0.02% 83 7350 0.03% 84 8098 0.03% 85 8629 0.03% 86 9617 0.03% 87 10483 0.04% 88 11436 0.04% 89 12301 0.04% 90 13544 0.05% 91 15133 0.05% 92 16654 0.06% 93 18110 0.07% 94 19729 0.07% 95 21595 0.08% 96 23601 0.09% 97 25334 0.09% 98 27758 0.10% 99 30062 0.11% 100 32408 0.12% 101 34057 0.12% 102 38293 0.14% 103 40342 0.15% 104 43759 0.16% 105 47205 0.17% 106 49993 0.18% 107 53762 0.19% 108 56759 0.21% 109 60478 0.22% 110 63896 0.23% 111 68297 0.25% 112 72569 0.26% 113 76289 0.28% 114 81106 0.29% 115 84988 0.31% 116 88730 0.32% 117 93802 0.34% 118 96885 0.35% 119 100894 0.37% 120 107210 0.39% 121 112552 0.41% 122 115713 0.42% 123 121776 0.44% 124 124805 0.45% 125 128186 0.46% 126 134192 0.49% 127 139765 0.51% 128 140595 0.51% 129 145589 0.53% 130 147688 0.54% 131 151752 0.55% 132 156696 0.57% 133 166650 0.60% 134 161038 0.58% 135 167896 0.61% 136 193763 0.70% 137 166691 0.60% 138 170961 0.62% 139 172945 0.63% 140 173901 0.63% 141 22845919 82.82% 27583592 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=3.2 sequence=GATGCTGACAAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=68.57 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.2 sequence=GCTGCTGCTGCTTTGAAGGGTTC Started job on | Feb 10 21:49:49 Started mapping on | Feb 10 21:49:50 Finished on | Feb 10 21:50:28 Mapping speed, Million of reads per hour | 2613.18 Number of input reads | 27583592 Average input read length | 137 UNIQUE READS: Uniquely mapped reads number | 26620589 Uniquely mapped reads % | 96.51% Average mapped length | 137.47 Number of splices: Total | 10913126 Number of splices: Annotated (sjdb) | 10702328 Number of splices: GT/AG | 10756345 Number of splices: GC/AG | 124098 Number of splices: AT/AC | 12491 Number of splices: Non-canonical | 20192 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 499734 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 69869 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.41% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463269 463269 463269 N_multimapping 499734 499734 499734 N_noFeature 990942 1085390 26325064 N_ambiguous 291898 90354 865 UnstrandedReadsAssigned:25337749 PositiveStrandReadsAssigned:25444845 NegativeStrandReadsAssigned:294660 Dataset is classified positive stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR12768910 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12768910-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,583,592 reads, 25,680,519 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR12768910.ke.tsv 34699 SRR12768910.se.tsv 87100 total ==> SRR12768910.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1008 29.3874 Potri.005G024800.1.v4.1 1035 936 132 7.88993 Potri.004G059700.1.v4.1 961 862 21 1.36297 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 315.735 6.2111 Potri.016G087400.1.v4.1 270 171 1218 398.498 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 55 1.83816 Potri.012G127500.1.v4.1 977 878 3079 196.196 ==> SRR12768910.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3327 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 659 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 62 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12768910 completed mapping pipeline successfully