Starting /dee2/code/volunteer_pipeline.sh SRR12768911 current disk space = 3057257304064 free memory = 1158661492 SRR12768911 SRAfilesize 0c5d2941ff5946ebe44ce0b4aee2ed8d SRR12768911.sra SRR12768911.sra file validated SRR12768911 is single end SRR12768911 is conventional basespace SRR12768911 read1 length is 49-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12768911_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-141 %GC 41 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6995 37.0 37.0 37.0 37.0 37.0 2 36.564 37.0 37.0 37.0 37.0 37.0 3 36.6075 37.0 37.0 37.0 37.0 37.0 4 36.597 37.0 37.0 37.0 37.0 37.0 5 36.535 37.0 37.0 37.0 37.0 37.0 6 36.5045 37.0 37.0 37.0 37.0 37.0 7 36.57 37.0 37.0 37.0 37.0 37.0 8 36.6385 37.0 37.0 37.0 37.0 37.0 9 36.4895 37.0 37.0 37.0 37.0 37.0 10-14 36.542100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.460499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4265 37.0 37.0 37.0 37.0 37.0 25-29 36.4281 37.0 37.0 37.0 37.0 37.0 30-34 36.3669 37.0 37.0 37.0 37.0 37.0 35-39 36.305099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.30290000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.314800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.28032008002001 37.0 37.0 37.0 37.0 37.0 55-59 36.23130782695674 37.0 37.0 37.0 37.0 37.0 60-64 36.22830707676919 37.0 37.0 37.0 37.0 37.0 65-69 36.16589147286821 37.0 37.0 37.0 37.0 37.0 70-74 36.21010505252626 37.0 37.0 37.0 37.0 37.0 75-79 36.08265866733717 37.0 37.0 37.0 37.0 37.0 80-84 36.15834109696027 37.0 37.0 37.0 37.0 37.0 85-89 35.9686871850102 37.0 37.0 37.0 37.0 37.0 90-94 36.00471839717973 37.0 37.0 37.0 37.0 37.0 95-99 35.922773599196695 37.0 37.0 37.0 37.0 37.0 100-104 35.92645685843356 37.0 37.0 37.0 37.0 37.0 105-109 35.87186208379936 37.0 37.0 37.0 37.0 37.0 110-114 35.82143037156808 37.0 37.0 37.0 37.0 37.0 115-119 35.8811507878044 37.0 37.0 37.0 37.0 37.0 120-124 35.81406075233565 37.0 37.0 37.0 37.0 37.0 125-129 35.701578961348034 37.0 37.0 37.0 37.0 37.0 130-134 35.72323656556379 37.0 37.0 37.0 37.0 37.0 135-139 35.643474860357884 37.0 37.0 37.0 37.0 37.0 140-141 35.56068035566193 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 5.0 26 4.0 27 11.0 28 15.0 29 25.0 30 29.0 31 48.0 32 60.0 33 86.0 34 152.0 35 346.0 36 2895.0 37 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.375 23.05 10.4 19.175 2 17.474999999999998 23.775 39.425 19.325 3 14.424999999999999 32.324999999999996 29.849999999999998 23.400000000000002 4 18.95 36.7 24.65 19.7 5 16.975 38.925 25.3 18.8 6 15.1 36.575 26.700000000000003 21.625 7 13.0 24.75 42.0 20.25 8 16.650000000000002 23.775 29.175 30.4 9 15.75 25.75 30.65 27.85 10-14 18.8 31.509999999999998 26.935 22.755 15-19 17.580000000000002 32.019999999999996 28.83 21.57 20-24 18.365000000000002 31.705 27.705000000000002 22.225 25-29 17.885 32.745000000000005 27.685 21.685 30-34 18.105 32.045 27.66 22.189999999999998 35-39 17.865000000000002 32.15 27.639999999999997 22.345000000000002 40-44 18.105 32.045 28.025 21.825 45-49 18.04 32.635 27.3 22.025 50-54 18.369592398099524 32.40810202550637 27.646911727931982 21.575393848462117 55-59 18.444611152788198 31.862965741435357 27.461865466366593 22.230557639409852 60-64 18.039509877469367 31.957989497374346 27.136784196049014 22.865716429107277 65-69 18.294573643410853 31.577894473618407 27.38684671167792 22.740685171292824 70-74 18.194097048524263 32.416208104052025 27.063531765882942 22.32616308154077 75-79 18.547983588511958 31.702191534073854 27.27409186430501 22.475733013109174 80-84 18.623279098873592 31.198998748435546 27.659574468085108 22.518147684605758 85-89 18.658249411293152 31.369307079513003 27.55148053509695 22.4209629740969 90-94 18.48545636910732 31.61985957873621 26.885656970912734 23.009027081243733 95-99 18.667605917278856 31.2468551876824 26.813927744792192 23.271611150246553 100-104 18.544719555330975 30.818595250126325 27.796867104598284 22.839818089944416 105-109 18.488590740458402 30.76688519591401 27.37714082431265 23.367383239314936 110-114 18.908941755537327 29.568293683347008 28.358285479901557 23.16447908121411 115-119 19.181718806933528 30.138982874394877 26.948102649523708 23.731195669147883 120-124 18.916906053835515 29.146717735929357 28.396637940206404 23.539738270028725 125-129 19.338699151620624 29.21470524254949 28.290189253861215 23.156406351968677 130-134 19.98544884710096 29.264607118871726 27.3393776583837 23.41056637564361 135-139 18.94645441389291 29.111432706222867 27.68162083936324 24.260492040520983 140-141 19.59479443951494 28.674948240165634 26.88553682342502 24.84472049689441 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 2.0 24 3.5 25 5.0 26 10.5 27 18.5 28 28.0 29 44.5 30 64.5 31 89.5 32 122.5 33 151.5 34 176.5 35 191.0 36 204.5 37 236.5 38 224.0 39 219.0 40 239.5 41 225.5 42 206.5 43 203.0 44 192.5 45 157.5 46 136.5 47 130.0 48 117.0 49 95.0 50 88.0 51 73.0 52 51.5 53 49.5 54 42.5 55 35.0 56 23.5 57 17.0 58 17.0 59 15.0 60 17.0 61 12.0 62 10.0 63 11.0 64 7.5 65 4.5 66 6.0 67 6.5 68 5.0 69 4.5 70 2.5 71 1.5 72 1.0 73 0.0 74 1.5 75 1.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 48-49 1.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 1.0 70-71 0.0 72-73 0.0 74-75 1.0 76-77 0.0 78-79 0.0 80-81 3.0 82-83 1.0 84-85 1.0 86-87 1.0 88-89 0.0 90-91 3.0 92-93 3.0 94-95 7.0 96-97 6.0 98-99 5.0 100-101 9.0 102-103 8.0 104-105 11.0 106-107 6.0 108-109 17.0 110-111 11.0 112-113 22.0 114-115 30.0 116-117 20.0 118-119 38.0 120-121 41.0 122-123 30.0 124-125 29.0 126-127 38.0 128-129 36.0 130-131 47.0 132-133 45.0 134-135 44.0 136-137 54.0 138-139 41.0 140-141 3390.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.81857451403887 85.95 2 6.506479481641468 12.049999999999999 3 0.5669546436285098 1.575 4 0.08099352051835854 0.3 5 0.02699784017278618 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACAGTTCGTGTCAAAATTGGAACGAAGTTTTTAGCATTAAAATCATCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTA 10 0.00899189 132.2625 2 >>END_MODULE Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232728 READS because READLEN < 1 Read 2232728 spots for SRR12768911.sra Written 2232728 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra Rejected 2232714 READS because READLEN < 1 Read 2232714 spots for SRR12768911.sra Written 2232714 spots for SRR12768911.sra SRR ids: ['SRR12768911.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_n992ma SRR12768911.sra spots: 44654294 blocks: [[1, 2232714], [2232715, 4465428], [4465429, 6698142], [6698143, 8930856], [8930857, 11163570], [11163571, 13396284], [13396285, 15628998], [15628999, 17861712], [17861713, 20094426], [20094427, 22327140], [22327141, 24559854], [24559855, 26792568], [26792569, 29025282], [29025283, 31257996], [31257997, 33490710], [33490711, 35723424], [35723425, 37956138], [37956139, 40188852], [40188853, 42421566], [42421567, 44654294]] SRR12768911 file size 7010313 SRR12768911 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12768911 SRR12768911_1.fastq Input file: SRR12768911_1.fastq trimmed: SRR12768911-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:17:12 2025 >> started Mon Feb 10 22:17:26 2025 >> done (13.600s) 22327147 reads processed; of these: 49 ( 0.00%) short reads filtered out after trimming by size control 149 ( 0.00%) empty reads filtered out after trimming by size control 22326949 (100.00%) reads available; of these: 85 ( 0.00%) trimmed reads available after processing 22326864 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 5 0.00% 21 7 0.00% 22 8 0.00% 23 7 0.00% 24 17 0.00% 25 40 0.00% 26 17 0.00% 27 27 0.00% 28 14 0.00% 29 20 0.00% 30 25 0.00% 31 22 0.00% 32 22 0.00% 33 25 0.00% 34 24 0.00% 35 49 0.00% 36 22 0.00% 37 26 0.00% 38 31 0.00% 39 34 0.00% 40 58 0.00% 41 56 0.00% 42 77 0.00% 43 80 0.00% 44 89 0.00% 45 89 0.00% 46 123 0.00% 47 108 0.00% 48 246 0.00% 49 260 0.00% 50 286 0.00% 51 300 0.00% 52 306 0.00% 53 287 0.00% 54 379 0.00% 55 312 0.00% 56 388 0.00% 57 394 0.00% 58 419 0.00% 59 504 0.00% 60 516 0.00% 61 609 0.00% 62 737 0.00% 63 667 0.00% 64 681 0.00% 65 775 0.00% 66 769 0.00% 67 784 0.00% 68 882 0.00% 69 1006 0.00% 70 1085 0.00% 71 1238 0.01% 72 1404 0.01% 73 1538 0.01% 74 1694 0.01% 75 1780 0.01% 76 1970 0.01% 77 2152 0.01% 78 2445 0.01% 79 2721 0.01% 80 2939 0.01% 81 3401 0.02% 82 3902 0.02% 83 4176 0.02% 84 4803 0.02% 85 5164 0.02% 86 5738 0.03% 87 6164 0.03% 88 6748 0.03% 89 7456 0.03% 90 8035 0.04% 91 9339 0.04% 92 10503 0.05% 93 11257 0.05% 94 12778 0.06% 95 13748 0.06% 96 14719 0.07% 97 16160 0.07% 98 17270 0.08% 99 19103 0.09% 100 20656 0.09% 101 22959 0.10% 102 25434 0.11% 103 27252 0.12% 104 30085 0.13% 105 31739 0.14% 106 34406 0.15% 107 36997 0.17% 108 38835 0.17% 109 40960 0.18% 110 44590 0.20% 111 47892 0.21% 112 50452 0.23% 113 54555 0.24% 114 58309 0.26% 115 62245 0.28% 116 64661 0.29% 117 67056 0.30% 118 70703 0.32% 119 73290 0.33% 120 77356 0.35% 121 80969 0.36% 122 85566 0.38% 123 89511 0.40% 124 93667 0.42% 125 97548 0.44% 126 100664 0.45% 127 104294 0.47% 128 104777 0.47% 129 107882 0.48% 130 111212 0.50% 131 114624 0.51% 132 119035 0.53% 133 125720 0.56% 134 125446 0.56% 135 130036 0.58% 136 154371 0.69% 137 130203 0.58% 138 132565 0.59% 139 133149 0.60% 140 134724 0.60% 141 18856484 84.46% 22326949 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=43 prefix-density=0.12 prefix-fanout=2.2 sequence=GCTATAGCATCATATTCAATTTTTTGGGCCAATGTCCTTAAGGGCACAGATCTGCTCCTCTCCCATGGCAGACATGACAGACACCACAAGGTCCTTCCCTTCGCCAAATCCATCTTTAATCTGAGTAAGTAGACTGTCATCAGTGGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=420.40 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=30.8 sequence=AAAAGAAAAGAAA Started job on | Feb 10 22:17:52 Started mapping on | Feb 10 22:17:56 Finished on | Feb 10 22:18:24 Mapping speed, Million of reads per hour | 2870.61 Number of input reads | 22326949 Average input read length | 138 UNIQUE READS: Uniquely mapped reads number | 21754152 Uniquely mapped reads % | 97.43% Average mapped length | 137.87 Number of splices: Total | 3963896 Number of splices: Annotated (sjdb) | 3845369 Number of splices: GT/AG | 3892312 Number of splices: GC/AG | 48586 Number of splices: AT/AC | 4167 Number of splices: Non-canonical | 18831 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.04% Deletion average length | 2.62 Insertion rate per base | 0.03% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355921 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 10352 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 216876 216876 216876 N_multimapping 355921 355921 355921 N_noFeature 755349 21380886 818749 N_ambiguous 387493 1199 77687 UnstrandedReadsAssigned:20611310 PositiveStrandReadsAssigned:372067 NegativeStrandReadsAssigned:20857716 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR12768911 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR12768911-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,326,949 reads, 21,090,196 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR12768911.ke.tsv 34699 SRR12768911.se.tsv 87100 total ==> SRR12768911.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1037 32.8348 Potri.005G024800.1.v4.1 1035 936 197 12.7886 Potri.004G059700.1.v4.1 961 862 1 0.0704894 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 350.069 7.47919 Potri.016G087400.1.v4.1 270 171 604 214.621 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22 0.798543 Potri.012G127500.1.v4.1 977 878 537 37.163 ==> SRR12768911.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 510 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1924 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12768911 completed mapping pipeline successfully