Starting /dee2/code/volunteer_pipeline.sh SRR12917498 current disk space = 3052005109760 free memory = 1572203856 SRR12917498 SRAfilesize 499754dcad1256f001ca3b50cb2522cc SRR12917498.sra SRR12917498.sra file validated SRR12917498 is paired end SRR12917498 is conventional basespace SRR12917498 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917498_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.599 37.0 37.0 37.0 37.0 37.0 2 36.4785 37.0 37.0 37.0 37.0 37.0 3 36.564 37.0 37.0 37.0 37.0 37.0 4 36.703 37.0 37.0 37.0 37.0 37.0 5 36.661 37.0 37.0 37.0 37.0 37.0 6 36.6715 37.0 37.0 37.0 37.0 37.0 7 36.5565 37.0 37.0 37.0 37.0 37.0 8 36.549 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.6035 37.0 37.0 37.0 37.0 37.0 15-19 36.6175 37.0 37.0 37.0 37.0 37.0 20-24 36.584700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5465 37.0 37.0 37.0 37.0 37.0 30-34 36.514900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4399 37.0 37.0 37.0 37.0 37.0 40-44 36.4891 37.0 37.0 37.0 37.0 37.0 45-49 36.416999999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4443 37.0 37.0 37.0 37.0 37.0 55-59 36.37519999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3612 37.0 37.0 37.0 37.0 37.0 65-69 36.24679999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.299 37.0 37.0 37.0 37.0 37.0 75-79 36.3315 37.0 37.0 37.0 37.0 37.0 80-84 36.3428 37.0 37.0 37.0 37.0 37.0 85-89 36.27759999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2961 37.0 37.0 37.0 37.0 37.0 95-99 36.2028 37.0 37.0 37.0 37.0 37.0 100-104 36.1826 37.0 37.0 37.0 37.0 37.0 105-109 36.11039999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1366 37.0 37.0 37.0 37.0 37.0 115-119 36.07600000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0719 37.0 37.0 37.0 37.0 37.0 125-129 35.936099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9387 37.0 37.0 37.0 37.0 37.0 135-139 35.8329 37.0 37.0 37.0 37.0 37.0 140-144 35.661699999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.6072 37.0 37.0 37.0 37.0 37.0 150-151 35.43925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 0.0 22 3.0 23 1.0 24 1.0 25 1.0 26 4.0 27 9.0 28 8.0 29 14.0 30 17.0 31 23.0 32 42.0 33 76.0 34 137.0 35 306.0 36 3080.0 37 275.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.671335667833915 14.132066033016507 5.152576288144072 38.0440220110055 2 18.725 11.275 37.9 32.1 3 17.075000000000003 15.65 27.900000000000002 39.375 4 20.65 22.575 25.45 31.324999999999996 5 24.349999999999998 28.225 24.725 22.7 6 20.424999999999997 32.7 23.5 23.375 7 15.1 28.000000000000004 41.475 15.425 8 17.2 25.424999999999997 33.575 23.799999999999997 9 16.900000000000002 25.15 34.300000000000004 23.65 10-14 19.830000000000002 29.585 28.175 22.41 15-19 19.36 27.689999999999998 28.235 24.715 20-24 19.71 28.9 27.779999999999998 23.61 25-29 19.875 28.625 28.025 23.474999999999998 30-34 19.45 28.68 27.555000000000003 24.315 35-39 19.725 28.325 27.61 24.34 40-44 20.205000000000002 28.63 27.205000000000002 23.96 45-49 19.985 27.785 27.975 24.255 50-54 19.655 28.005000000000003 27.51 24.83 55-59 20.155 28.235 27.35 24.26 60-64 19.54 28.38 27.584999999999997 24.495 65-69 20.150000000000002 28.4 27.1 24.349999999999998 70-74 21.115000000000002 28.249999999999996 27.029999999999998 23.605 75-79 19.73 28.235 27.845 24.19 80-84 19.855 28.349999999999998 27.73 24.065 85-89 20.505000000000003 27.825 27.845 23.825 90-94 20.365 27.61 27.655 24.37 95-99 20.615 28.084999999999997 27.605 23.695 100-104 20.44 27.88 27.51 24.169999999999998 105-109 20.41 28.63 27.0 23.96 110-114 21.12 28.549999999999997 26.69 23.64 115-119 21.385 27.595 26.924999999999997 24.095 120-124 21.145 28.005000000000003 26.765 24.085 125-129 21.185000000000002 27.04 26.950000000000003 24.825 130-134 20.965 27.815 26.69 24.529999999999998 135-139 20.794999999999998 27.334999999999997 27.235 24.635 140-144 21.245 27.134999999999998 26.939999999999998 24.68 145-149 20.905 27.750000000000004 26.985 24.36 150-151 21.0625 27.5875 26.2625 25.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 1.5 24 1.5 25 1.5 26 3.0 27 6.0 28 6.0 29 11.0 30 16.0 31 21.5 32 33.0 33 40.0 34 42.5 35 60.5 36 76.0 37 91.5 38 133.0 39 156.0 40 161.5 41 200.5 42 222.0 43 242.5 44 290.0 45 293.0 46 267.0 47 261.0 48 261.5 49 242.5 50 189.0 51 140.0 52 110.5 53 97.5 54 82.5 55 48.0 56 36.5 57 36.0 58 27.0 59 26.0 60 21.0 61 9.0 62 7.5 63 4.5 64 2.5 65 4.0 66 4.5 67 2.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.93419633225459 86.15 2 6.3646170442286945 11.799999999999999 3 0.593311758360302 1.6500000000000001 4 0.10787486515641855 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 90-91 1.2374999999999998 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.3375 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 3.0875 0.0 0.0 0.0 0.0 104-105 3.3625 0.0 0.0 0.0 0.0 106-107 3.6500000000000004 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.5375 0.0 0.0 0.0 0.0 112-113 4.9625 0.0 0.0 0.0 0.0 114-115 5.550000000000001 0.0 0.0 0.0 0.0 116-117 6.0625 0.0 0.0 0.0 0.0 118-119 6.65 0.0 0.0 0.0 0.0 120-121 7.225 0.0 0.0 0.0 0.0 122-123 7.8374999999999995 0.0 0.0 0.0 0.0 124-125 8.425 0.0 0.0 0.0 0.0 126-127 8.85 0.0 0.0 0.0 0.0 128-129 9.4375 0.0 0.0 0.0 0.0 130-131 10.1125 0.0 0.0 0.0 0.0 132-133 10.75 0.0 0.0 0.0 0.0 134-135 11.6125 0.0 0.0 0.0 0.0 136-137 12.175 0.0 0.0 0.0 0.0 138-139 12.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAGG 10 0.006830828 145.0 7 >>END_MODULE SRR12917498 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917498_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.409 37.0 37.0 37.0 37.0 37.0 2 36.3135 37.0 37.0 37.0 37.0 37.0 3 36.2525 37.0 37.0 37.0 37.0 37.0 4 36.366 37.0 37.0 37.0 37.0 37.0 5 36.453 37.0 37.0 37.0 37.0 37.0 6 36.3985 37.0 37.0 37.0 37.0 37.0 7 36.4325 37.0 37.0 37.0 37.0 37.0 8 36.4025 37.0 37.0 37.0 37.0 37.0 9 36.394 37.0 37.0 37.0 37.0 37.0 10-14 36.4329 37.0 37.0 37.0 37.0 37.0 15-19 36.4002 37.0 37.0 37.0 37.0 37.0 20-24 36.346900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.22359999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.2179 37.0 37.0 37.0 37.0 37.0 35-39 36.173199999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.1715 37.0 37.0 37.0 37.0 37.0 45-49 36.1143 37.0 37.0 37.0 37.0 37.0 50-54 36.0946 37.0 37.0 37.0 37.0 37.0 55-59 36.053 37.0 37.0 37.0 37.0 37.0 60-64 36.0936 37.0 37.0 37.0 37.0 37.0 65-69 35.951699999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.0052 37.0 37.0 37.0 37.0 37.0 75-79 35.950100000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.925700000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.9798 37.0 37.0 37.0 37.0 37.0 90-94 35.9262 37.0 37.0 37.0 37.0 37.0 95-99 35.903800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8725 37.0 37.0 37.0 37.0 37.0 105-109 35.8113 37.0 37.0 37.0 37.0 37.0 110-114 35.750600000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.701800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.6069 37.0 37.0 37.0 37.0 37.0 125-129 35.518600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.34779999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.28410000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.0912 37.0 37.0 37.0 29.8 37.0 145-149 34.834 37.0 37.0 37.0 27.4 37.0 150-151 34.309250000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 2.0 16 4.0 17 0.0 18 0.0 19 2.0 20 1.0 21 2.0 22 2.0 23 5.0 24 4.0 25 4.0 26 9.0 27 13.0 28 12.0 29 16.0 30 26.0 31 40.0 32 66.0 33 105.0 34 184.0 35 587.0 36 2691.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 28.15 9.725 23.325000000000003 2 28.275 25.15 31.0 15.575 3 19.425 28.050000000000004 34.449999999999996 18.075 4 23.65 32.25 25.35 18.75 5 26.75 35.225 21.5 16.525000000000002 6 19.7 40.025 21.675 18.6 7 21.675 24.15 36.199999999999996 17.974999999999998 8 20.325 24.65 30.625000000000004 24.4 9 22.85 24.45 30.55 22.15 10-14 23.835 29.555 26.045 20.565 15-19 23.544999999999998 28.425 27.24 20.79 20-24 23.425 28.694999999999997 27.055 20.825 25-29 24.21 28.134999999999998 26.915 20.74 30-34 22.84 28.749999999999996 27.47 20.94 35-39 23.885 28.285 27.145000000000003 20.685000000000002 40-44 23.605 28.720000000000002 27.02 20.655 45-49 24.01 28.165000000000003 27.12 20.705000000000002 50-54 23.79 28.765 26.44 21.005 55-59 23.54 28.515 27.42 20.525 60-64 24.05 27.71 27.38 20.86 65-69 23.885 27.700000000000003 27.800000000000004 20.615 70-74 23.66 28.57 27.66 20.11 75-79 24.23 27.529999999999998 27.165 21.075 80-84 23.57 27.415 27.93 21.085 85-89 23.715 28.15 27.6 20.535 90-94 24.865000000000002 27.43 27.689999999999998 20.015 95-99 24.115000000000002 28.050000000000004 27.224999999999998 20.61 100-104 24.03 28.18 27.334999999999997 20.455000000000002 105-109 25.264999999999997 28.025 26.69 20.02 110-114 24.779999999999998 27.97 26.590000000000003 20.66 115-119 25.580000000000002 28.22 26.685 19.515 120-124 26.229999999999997 27.82 26.41 19.54 125-129 26.085 28.62 25.885 19.41 130-134 26.355 27.85 26.615 19.18 135-139 26.695 26.88 27.075 19.35 140-144 26.950000000000003 27.54 26.229999999999997 19.28 145-149 27.200000000000003 27.48 26.075 19.245 150-151 27.762500000000003 26.700000000000003 25.974999999999998 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 1.5 23 0.5 24 0.0 25 1.0 26 2.0 27 3.5 28 3.0 29 4.5 30 11.0 31 18.5 32 21.5 33 26.0 34 44.0 35 56.5 36 73.5 37 108.0 38 144.0 39 169.5 40 203.0 41 241.5 42 255.5 43 255.0 44 279.5 45 303.0 46 273.0 47 244.5 48 231.5 49 205.5 50 175.5 51 138.0 52 107.0 53 90.0 54 72.5 55 52.5 56 35.5 57 27.5 58 24.0 59 21.5 60 19.5 61 12.0 62 5.5 63 4.5 64 3.5 65 2.0 66 1.5 67 1.5 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.35 #Duplication Level Percentage of deduplicated Percentage of total 1 92.82620465619924 85.725 2 6.334596643205198 11.700000000000001 3 0.7309149972929074 2.025 4 0.05414185165132648 0.2 5 0.0 0.0 6 0.02707092582566324 0.15 7 0.0 0.0 8 0.02707092582566324 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AAGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.5125000000000002 0.0 0.0 0.0 0.0 94-95 1.8250000000000002 0.0 0.0 0.0 0.0 96-97 2.0625 0.0 0.0 0.0 0.0 98-99 2.3625 0.0 0.0 0.0 0.0 100-101 2.7625 0.0 0.0 0.0 0.0 102-103 3.1125 0.0 0.0 0.0 0.0 104-105 3.4 0.0 0.0 0.0 0.0 106-107 3.7 0.0 0.0 0.0 0.0 108-109 4.0875 0.0 0.0 0.0 0.0 110-111 4.5875 0.0 0.0 0.0 0.0 112-113 5.0375 0.0 0.0 0.0 0.0 114-115 5.625 0.0 0.0 0.0 0.0 116-117 6.1375 0.0 0.0 0.0 0.0 118-119 6.675 0.0 0.0 0.0 0.0 120-121 7.2375 0.0 0.0 0.0 0.0 122-123 7.875 0.0 0.0 0.0 0.0 124-125 8.475 0.0 0.0 0.0 0.0 126-127 8.9 0.0 0.0 0.0 0.0 128-129 9.4875 0.0 0.0 0.0 0.0 130-131 10.1875 0.0 0.0 0.0 0.0 132-133 10.825 0.0 0.0 0.0 0.0 134-135 11.6875 0.0 0.0 0.0 0.0 136-137 12.3 0.0 0.0 0.0 0.0 138-139 12.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 41.428574 145 >>END_MODULE Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767970 spots for SRR12917498.sra Written 767970 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra Read 767962 spots for SRR12917498.sra Written 767962 spots for SRR12917498.sra SRR ids: ['SRR12917498.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f5jtschb SRR12917498.sra spots: 15359248 blocks: [[1, 767962], [767963, 1535924], [1535925, 2303886], [2303887, 3071848], [3071849, 3839810], [3839811, 4607772], [4607773, 5375734], [5375735, 6143696], [6143697, 6911658], [6911659, 7679620], [7679621, 8447582], [8447583, 9215544], [9215545, 9983506], [9983507, 10751468], [10751469, 11519430], [11519431, 12287392], [12287393, 13055354], [13055355, 13823316], [13823317, 14591278], [14591279, 15359248]] SRR12917498 file size 5198044 SRR12917498 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917498 SRR12917498_1.fastq SRR12917498_2.fastq Input file: SRR12917498_1.fastq Paired file: SRR12917498_2.fastq trimmed: SRR12917498-trimmed-pair1.fastq, SRR12917498-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:17:40 2025 >> started Thu Feb 13 04:21:32 2025 >> done (232.544s) 15359248 read pairs processed; of these: 140 ( 0.00%) short read pairs filtered out after trimming by size control 12261 ( 0.08%) empty read pairs filtered out after trimming by size control 15346847 (99.92%) read pairs available; of these: 2863602 (18.66%) trimmed read pairs available after processing 12483245 (81.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 8 0.00% 20 10 0.00% 21 13 0.00% 22 12 0.00% 23 17 0.00% 24 14 0.00% 25 19 0.00% 26 17 0.00% 27 19 0.00% 28 17 0.00% 29 23 0.00% 30 25 0.00% 31 29 0.00% 32 22 0.00% 33 31 0.00% 34 28 0.00% 35 37 0.00% 36 37 0.00% 37 39 0.00% 38 61 0.00% 39 53 0.00% 40 53 0.00% 41 60 0.00% 42 65 0.00% 43 62 0.00% 44 88 0.00% 45 72 0.00% 46 92 0.00% 47 139 0.00% 48 150 0.00% 49 173 0.00% 50 239 0.00% 51 275 0.00% 52 297 0.00% 53 363 0.00% 54 370 0.00% 55 394 0.00% 56 510 0.00% 57 542 0.00% 58 650 0.00% 59 764 0.00% 60 973 0.01% 61 1129 0.01% 62 1264 0.01% 63 1523 0.01% 64 1766 0.01% 65 1986 0.01% 66 2145 0.01% 67 2323 0.02% 68 2572 0.02% 69 2952 0.02% 70 3444 0.02% 71 3918 0.03% 72 4579 0.03% 73 5226 0.03% 74 5769 0.04% 75 6418 0.04% 76 7172 0.05% 77 7518 0.05% 78 8012 0.05% 79 8687 0.06% 80 9290 0.06% 81 10320 0.07% 82 11145 0.07% 83 12285 0.08% 84 13552 0.09% 85 14616 0.10% 86 15133 0.10% 87 15985 0.10% 88 16822 0.11% 89 17173 0.11% 90 17802 0.12% 91 18779 0.12% 92 19549 0.13% 93 21167 0.14% 94 22916 0.15% 95 23549 0.15% 96 24968 0.16% 97 26259 0.17% 98 26118 0.17% 99 26851 0.17% 100 27365 0.18% 101 28139 0.18% 102 29303 0.19% 103 29944 0.20% 104 31454 0.20% 105 33046 0.22% 106 35014 0.23% 107 35654 0.23% 108 36143 0.24% 109 36339 0.24% 110 36336 0.24% 111 37212 0.24% 112 37720 0.25% 113 38315 0.25% 114 40026 0.26% 115 41821 0.27% 116 42416 0.28% 117 44003 0.29% 118 44859 0.29% 119 45424 0.30% 120 46065 0.30% 121 45577 0.30% 122 45555 0.30% 123 46630 0.30% 124 47511 0.31% 125 48389 0.32% 126 49806 0.32% 127 50633 0.33% 128 51458 0.34% 129 52006 0.34% 130 52859 0.34% 131 52877 0.34% 132 53032 0.35% 133 53986 0.35% 134 53990 0.35% 135 54946 0.36% 136 55223 0.36% 137 56239 0.37% 138 57044 0.37% 139 57072 0.37% 140 58130 0.38% 141 58879 0.38% 142 58982 0.38% 143 57844 0.38% 144 59279 0.39% 145 58960 0.38% 146 59313 0.39% 147 59966 0.39% 148 59813 0.39% 149 60352 0.39% 150 61099 0.40% 151 12483245 81.34% 15346847 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=33 prefix-density=0.45 prefix-fanout=2.0 sequence=GTAAAAACAAGCCCTAAGCGAAGGTGTGCGATTTTGCAGTTGCTTCTCTCGATTTCAGCAATGGGGTCTATCAAACTCGCTTGCATGGACTGCTGTGGCATAACCAGCAGCAGCCCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=31 fanout-score=49.28 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.5 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=35 prefix-density=0.93 prefix-fanout=2.0 sequence=TTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTACCTCTGATGTCAACGAAAGGGCTCTGCAAGACTCTGGACTCTATAGCCCTGACAGTGAAGACTCTTCTGTTGACATTGCGGGCAGAAGGTTCCATAGCGGGACACTAAACGGTTCTTCTATTGTATATGTCAAGACAGGGAGTCATTCAGTAAATATGGCAACAACTTTGCAAATCCTTCTAGTTAGATTCAGCATTCACGGAGTCATCTATTTTGGGAATGCTGGAAGCTTGGATAAGAAAACAATGGTTCCAGGTGATGTTTCTGTGCCGCAGGCTGTTGCCTTCACAGGAGTTTGGAACTGGAAGAAATTCGGATCGGAGAAAGGTAAACTGGTATTTGGAGATTTCAATTATCCAGAGAATGGAGAGAACTTGTTGGGGACTGTAGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=469.04 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=17.2 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAACACTGACGCTATTTCTGCTGTTTGTCAAGATGGGGTTCTGACTGTTACTGTTGAGAAATTACCACCTCCTGAGCCTAAGAAGCCTAAGACTAT SRR12917498 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 04:55:59 Started mapping on | Feb 13 04:56:07 Finished on | Feb 13 05:55:12 Mapping speed, Million of reads per hour | 15.58 Number of input reads | 15346847 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14333008 Uniquely mapped reads % | 93.39% Average mapped length | 289.87 Number of splices: Total | 13120507 Number of splices: Annotated (sjdb) | 12858854 Number of splices: GT/AG | 12876266 Number of splices: GC/AG | 189999 Number of splices: AT/AC | 14250 Number of splices: Non-canonical | 39992 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.11 Insertion rate per base | 0.03% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414649 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 80360 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599190 599190 599190 N_multimapping 414649 414649 414649 N_noFeature 370614 14138415 458287 N_ambiguous 197771 827 90377 UnstrandedReadsAssigned:13764623 PositiveStrandReadsAssigned:193766 NegativeStrandReadsAssigned:13784344 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917498 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917498-trimmed-pair1.fastq SRR12917498-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,346,847 reads, 13,857,575 reads pseudoaligned [quant] estimated average fragment length: 235.022 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR12917498.ke.tsv 34699 SRR12917498.se.tsv 87100 total ==> SRR12917498.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.98 593 22.8692 Potri.005G024800.1.v4.1 1035 800.978 175 15.0315 Potri.004G059700.1.v4.1 961 727.06 75 7.09702 Potri.007G009000.2.v4.1 1416 1181.98 0 0 Potri.003G141000.2.v4.1 2943 2708.98 820.367 20.8347 Potri.016G087400.1.v4.1 270 99.2231 1202 833.444 Potri.015G069301.1.v4.1 564 343.354 0 0 Potri.010G195200.1.v4.1 1773 1538.98 20 0.894093 Potri.012G127500.1.v4.1 977 743.008 5979 553.631 ==> SRR12917498.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 115 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR12917498 completed mapping pipeline successfully