Starting /dee2/code/volunteer_pipeline.sh SRR12917499 current disk space = 3051667312640 free memory = 1414309204 SRR12917499 SRAfilesize 616e84f21c4280b16f80a0aeaaab29b6 SRR12917499.sra SRR12917499.sra file validated SRR12917499 is paired end SRR12917499 is conventional basespace SRR12917499 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.518 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.523 37.0 37.0 37.0 37.0 37.0 4 36.646 37.0 37.0 37.0 37.0 37.0 5 36.5675 37.0 37.0 37.0 37.0 37.0 6 36.633 37.0 37.0 37.0 37.0 37.0 7 36.5835 37.0 37.0 37.0 37.0 37.0 8 36.6435 37.0 37.0 37.0 37.0 37.0 9 36.6155 37.0 37.0 37.0 37.0 37.0 10-14 36.6412 37.0 37.0 37.0 37.0 37.0 15-19 36.6161 37.0 37.0 37.0 37.0 37.0 20-24 36.548199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4942 37.0 37.0 37.0 37.0 37.0 30-34 36.4864 37.0 37.0 37.0 37.0 37.0 35-39 36.4564 37.0 37.0 37.0 37.0 37.0 40-44 36.492200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.382400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.381099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3476 37.0 37.0 37.0 37.0 37.0 60-64 36.3072 37.0 37.0 37.0 37.0 37.0 65-69 36.2635 37.0 37.0 37.0 37.0 37.0 70-74 36.2564 37.0 37.0 37.0 37.0 37.0 75-79 36.3042 37.0 37.0 37.0 37.0 37.0 80-84 36.2558 37.0 37.0 37.0 37.0 37.0 85-89 36.2483 37.0 37.0 37.0 37.0 37.0 90-94 36.2176 37.0 37.0 37.0 37.0 37.0 95-99 36.1928 37.0 37.0 37.0 37.0 37.0 100-104 36.168099999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.0108 37.0 37.0 37.0 37.0 37.0 110-114 36.0217 37.0 37.0 37.0 37.0 37.0 115-119 35.9803 37.0 37.0 37.0 37.0 37.0 120-124 35.983599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8258 37.0 37.0 37.0 37.0 37.0 130-134 35.8562 37.0 37.0 37.0 37.0 37.0 135-139 35.746 37.0 37.0 37.0 37.0 37.0 140-144 35.5974 37.0 37.0 37.0 37.0 37.0 145-149 35.4929 37.0 37.0 37.0 37.0 37.0 150-151 35.37325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 4.0 23 0.0 24 2.0 25 3.0 26 0.0 27 5.0 28 13.0 29 13.0 30 28.0 31 27.0 32 45.0 33 71.0 34 139.0 35 362.0 36 3022.0 37 261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.19809904952476 13.056528264132067 5.2276138069034515 35.51775887943972 2 20.025000000000002 11.85 35.9 32.225 3 16.775000000000002 15.1 28.375 39.75 4 21.025 21.875 25.25 31.85 5 23.775 30.075000000000003 24.099999999999998 22.05 6 21.25 32.324999999999996 22.75 23.674999999999997 7 16.475 28.95 37.35 17.224999999999998 8 15.325 28.775000000000002 32.525 23.375 9 16.475 24.2 35.55 23.775 10-14 19.470000000000002 29.830000000000002 28.044999999999998 22.655 15-19 19.99 27.99 28.38 23.64 20-24 20.18 28.33 27.474999999999998 24.015 25-29 19.8 28.384999999999998 27.97 23.845 30-34 19.665 28.735 27.474999999999998 24.125 35-39 20.080000000000002 28.189999999999998 28.1 23.630000000000003 40-44 20.24 28.560000000000002 27.925 23.275000000000002 45-49 20.465 28.499999999999996 27.57 23.465 50-54 20.72 28.439999999999998 27.13 23.71 55-59 19.985 28.349999999999998 27.889999999999997 23.775 60-64 19.955000000000002 28.43 28.065 23.549999999999997 65-69 19.98 27.700000000000003 28.025 24.295 70-74 20.419999999999998 27.889999999999997 27.825 23.865 75-79 20.895 27.68 27.79 23.635 80-84 20.655 27.884999999999998 27.634999999999998 23.825 85-89 20.424999999999997 28.720000000000002 27.325 23.53 90-94 21.065 28.189999999999998 27.005000000000003 23.74 95-99 20.54 27.54 28.075 23.845 100-104 20.48 28.74 26.735 24.044999999999998 105-109 20.93 28.499999999999996 26.705000000000002 23.865 110-114 20.724999999999998 27.975 28.13 23.169999999999998 115-119 21.185000000000002 28.244999999999997 27.465 23.105 120-124 20.785 28.53 26.3 24.385 125-129 20.810000000000002 28.084999999999997 27.305 23.799999999999997 130-134 21.185000000000002 28.349999999999998 26.93 23.535 135-139 21.22 28.02 26.93 23.830000000000002 140-144 21.115000000000002 28.205000000000002 26.755000000000003 23.925 145-149 21.185000000000002 27.794999999999998 27.18 23.84 150-151 21.175 28.4 26.35 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.0 19 0.0 20 0.5 21 1.5 22 3.5 23 3.0 24 1.0 25 1.5 26 2.0 27 2.5 28 6.5 29 14.0 30 19.0 31 22.0 32 26.0 33 37.5 34 46.0 35 53.5 36 67.0 37 86.0 38 125.0 39 161.5 40 183.5 41 216.0 42 248.0 43 282.5 44 288.5 45 262.5 46 269.0 47 259.5 48 230.5 49 205.0 50 176.0 51 146.5 52 123.0 53 102.5 54 72.0 55 57.5 56 49.5 57 38.5 58 29.5 59 22.0 60 14.5 61 8.5 62 7.0 63 4.0 64 1.5 65 4.5 66 5.0 67 1.5 68 0.0 69 0.0 70 1.0 71 1.0 72 1.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.40816326530611 84.89999999999999 2 6.557823129251701 12.049999999999999 3 0.8979591836734694 2.475 4 0.0816326530612245 0.3 5 0.027210884353741496 0.125 6 0.027210884353741496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGTGACCATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 36bp) GTTGGCAAAAGAAAGAGGCTGCAGTGTAGCCTGCAATCCCAGCTGTCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.2125000000000004 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.237500000000001 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.175 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 6.8875 0.0 0.0 0.0 0.0 136-137 7.262499999999999 0.0 0.0 0.0 0.0 138-139 7.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917499 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917499_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20875 37.0 37.0 37.0 37.0 37.0 2 36.1885 37.0 37.0 37.0 37.0 37.0 3 36.264 37.0 37.0 37.0 37.0 37.0 4 36.2735 37.0 37.0 37.0 37.0 37.0 5 36.312 37.0 37.0 37.0 37.0 37.0 6 36.195 37.0 37.0 37.0 37.0 37.0 7 36.279 37.0 37.0 37.0 37.0 37.0 8 36.316 37.0 37.0 37.0 37.0 37.0 9 36.261 37.0 37.0 37.0 37.0 37.0 10-14 36.282 37.0 37.0 37.0 37.0 37.0 15-19 36.2368 37.0 37.0 37.0 37.0 37.0 20-24 36.2026 37.0 37.0 37.0 37.0 37.0 25-29 36.05550000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.9625 37.0 37.0 37.0 37.0 37.0 35-39 35.967000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.979699999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.87650000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.85189999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8889 37.0 37.0 37.0 37.0 37.0 60-64 35.8426 37.0 37.0 37.0 37.0 37.0 65-69 35.8602 37.0 37.0 37.0 37.0 37.0 70-74 35.8152 37.0 37.0 37.0 37.0 37.0 75-79 35.719 37.0 37.0 37.0 37.0 37.0 80-84 35.7303 37.0 37.0 37.0 37.0 37.0 85-89 35.8007 37.0 37.0 37.0 37.0 37.0 90-94 35.8158 37.0 37.0 37.0 37.0 37.0 95-99 35.7411 37.0 37.0 37.0 37.0 37.0 100-104 35.688599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.615500000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6408 37.0 37.0 37.0 37.0 37.0 115-119 35.589600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.50509999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.4847 37.0 37.0 37.0 37.0 37.0 130-134 35.35719999999999 37.0 37.0 37.0 34.6 37.0 135-139 35.3055 37.0 37.0 37.0 34.6 37.0 140-144 35.142100000000006 37.0 37.0 37.0 27.4 37.0 145-149 34.927 37.0 37.0 37.0 25.0 37.0 150-151 34.379 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 4.0 16 2.0 17 4.0 18 3.0 19 2.0 20 2.0 21 0.0 22 7.0 23 9.0 24 3.0 25 9.0 26 8.0 27 8.0 28 12.0 29 23.0 30 30.0 31 39.0 32 67.0 33 110.0 34 220.0 35 684.0 36 2566.0 37 183.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.585396349087276 25.03125781445361 10.102525631407852 23.280820205051263 2 28.025 26.125 30.4 15.45 3 20.424999999999997 28.65 32.85 18.075 4 23.25 33.175 25.45 18.125 5 25.55 35.15 22.725 16.575 6 21.075 38.625 22.45 17.849999999999998 7 22.225 22.400000000000002 37.6 17.775 8 19.775000000000002 24.9 29.975 25.35 9 22.5 24.425 30.475 22.6 10-14 23.03 29.065 27.505000000000003 20.4 15-19 23.59 27.365000000000002 28.155 20.89 20-24 23.189999999999998 28.299999999999997 27.900000000000002 20.61 25-29 23.119999999999997 28.435 27.450000000000003 20.995 30-34 23.225 28.525 27.474999999999998 20.775 35-39 23.22 27.965 28.055000000000003 20.76 40-44 23.810000000000002 28.189999999999998 27.37 20.630000000000003 45-49 23.815 28.16 27.229999999999997 20.794999999999998 50-54 23.65 27.655 28.355000000000004 20.34 55-59 23.505000000000003 27.96 28.194999999999997 20.34 60-64 23.755000000000003 27.875 27.589999999999996 20.78 65-69 23.455000000000002 28.060000000000002 27.775 20.71 70-74 24.104999999999997 27.694999999999997 27.61 20.59 75-79 23.925 27.689999999999998 27.834999999999997 20.549999999999997 80-84 23.794999999999998 28.165000000000003 26.939999999999998 21.099999999999998 85-89 23.66 27.865000000000002 27.950000000000003 20.525 90-94 23.735 28.18 27.605 20.48 95-99 23.830000000000002 28.38 27.215 20.575 100-104 24.11 27.875 27.465 20.549999999999997 105-109 23.78 27.779999999999998 27.715 20.724999999999998 110-114 23.985 28.99 26.905 20.119999999999997 115-119 24.125 28.575 27.185 20.115 120-124 24.815 29.275000000000002 26.540000000000003 19.37 125-129 24.905 27.825 27.025 20.244999999999997 130-134 25.45 28.634999999999998 26.39 19.525000000000002 135-139 25.650000000000002 27.85 26.945000000000004 19.555 140-144 25.41 28.01 27.089999999999996 19.49 145-149 26.055 28.04 26.26 19.645000000000003 150-151 26.05 28.6875 25.7625 19.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.0 26 3.0 27 2.0 28 7.5 29 13.0 30 14.5 31 16.0 32 23.0 33 39.0 34 54.5 35 62.5 36 72.5 37 108.0 38 137.0 39 153.5 40 190.0 41 231.0 42 267.0 43 282.5 44 276.5 45 283.0 46 288.5 47 261.5 48 222.5 49 205.0 50 170.0 51 131.5 52 108.5 53 83.5 54 63.5 55 47.0 56 34.5 57 30.5 58 29.5 59 16.0 60 11.0 61 10.5 62 4.5 63 3.5 64 4.0 65 2.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 1.0 79 1.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 2.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.59761388286334 85.375 2 6.480477223427332 11.95 3 0.8405639913232104 2.325 4 0.05422993492407809 0.2 5 0.0 0.0 6 0.027114967462039046 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.5999999999999996 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.675000000000001 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.512499999999999 0.0 0.0 0.0 0.0 134-135 6.8375 0.0 0.0 0.0 0.0 136-137 7.237500000000001 0.0 0.0 0.0 0.0 138-139 7.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAGA 40 0.005621335 54.375 6 >>END_MODULE Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra Read 695246 spots for SRR12917499.sra Written 695246 spots for SRR12917499.sra Read 695228 spots for SRR12917499.sra Written 695228 spots for SRR12917499.sra SRR ids: ['SRR12917499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s4a0s3uc SRR12917499.sra spots: 13904578 blocks: [[1, 695228], [695229, 1390456], [1390457, 2085684], [2085685, 2780912], [2780913, 3476140], [3476141, 4171368], [4171369, 4866596], [4866597, 5561824], [5561825, 6257052], [6257053, 6952280], [6952281, 7647508], [7647509, 8342736], [8342737, 9037964], [9037965, 9733192], [9733193, 10428420], [10428421, 11123648], [11123649, 11818876], [11818877, 12514104], [12514105, 13209332], [13209333, 13904578]] SRR12917499 file size 4703683 SRR12917499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917499 SRR12917499_1.fastq SRR12917499_2.fastq Input file: SRR12917499_1.fastq Paired file: SRR12917499_2.fastq trimmed: SRR12917499-trimmed-pair1.fastq, SRR12917499-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:05:45 2025 >> started Thu Feb 13 06:08:46 2025 >> done (180.705s) 13904578 read pairs processed; of these: 129 ( 0.00%) short read pairs filtered out after trimming by size control 38997 ( 0.28%) empty read pairs filtered out after trimming by size control 13865452 (99.72%) read pairs available; of these: 1656140 (11.94%) trimmed read pairs available after processing 12209312 (88.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 8 0.00% 20 12 0.00% 21 11 0.00% 22 21 0.00% 23 16 0.00% 24 12 0.00% 25 23 0.00% 26 20 0.00% 27 28 0.00% 28 23 0.00% 29 23 0.00% 30 20 0.00% 31 24 0.00% 32 25 0.00% 33 27 0.00% 34 26 0.00% 35 29 0.00% 36 32 0.00% 37 22 0.00% 38 20 0.00% 39 36 0.00% 40 25 0.00% 41 30 0.00% 42 32 0.00% 43 45 0.00% 44 39 0.00% 45 34 0.00% 46 45 0.00% 47 58 0.00% 48 60 0.00% 49 52 0.00% 50 87 0.00% 51 94 0.00% 52 79 0.00% 53 101 0.00% 54 114 0.00% 55 113 0.00% 56 154 0.00% 57 156 0.00% 58 178 0.00% 59 220 0.00% 60 243 0.00% 61 290 0.00% 62 311 0.00% 63 398 0.00% 64 436 0.00% 65 509 0.00% 66 561 0.00% 67 561 0.00% 68 717 0.01% 69 858 0.01% 70 967 0.01% 71 1106 0.01% 72 1296 0.01% 73 1466 0.01% 74 1719 0.01% 75 1939 0.01% 76 2064 0.01% 77 2155 0.02% 78 2437 0.02% 79 2662 0.02% 80 2931 0.02% 81 3345 0.02% 82 3810 0.03% 83 4276 0.03% 84 4496 0.03% 85 5284 0.04% 86 5485 0.04% 87 5636 0.04% 88 6049 0.04% 89 6389 0.05% 90 6738 0.05% 91 7432 0.05% 92 7675 0.06% 93 8341 0.06% 94 9086 0.07% 95 9827 0.07% 96 10543 0.08% 97 10836 0.08% 98 11320 0.08% 99 11717 0.08% 100 12244 0.09% 101 12417 0.09% 102 13267 0.10% 103 14076 0.10% 104 14671 0.11% 105 15843 0.11% 106 16650 0.12% 107 16894 0.12% 108 17871 0.13% 109 18423 0.13% 110 18408 0.13% 111 18915 0.14% 112 19597 0.14% 113 20294 0.15% 114 21097 0.15% 115 22183 0.16% 116 23142 0.17% 117 24246 0.17% 118 24746 0.18% 119 25428 0.18% 120 26050 0.19% 121 26316 0.19% 122 26852 0.19% 123 27138 0.20% 124 28096 0.20% 125 29251 0.21% 126 30254 0.22% 127 31288 0.23% 128 31712 0.23% 129 32628 0.24% 130 33291 0.24% 131 33642 0.24% 132 34230 0.25% 133 34969 0.25% 134 34966 0.25% 135 36486 0.26% 136 36541 0.26% 137 37873 0.27% 138 39064 0.28% 139 39616 0.29% 140 40273 0.29% 141 40809 0.29% 142 40790 0.29% 143 41280 0.30% 144 42262 0.30% 145 42490 0.31% 146 43045 0.31% 147 43766 0.32% 148 44511 0.32% 149 44475 0.32% 150 45665 0.33% 151 12209312 88.06% 13865452 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.03 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=3.2 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=30.52 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.9 sequence=CATCCTTCACAA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=37 prefix-density=0.20 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=361.01 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=34.5 sequence=AAGAAGAAGAAA SRR12917499 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:10:24 Started mapping on | Feb 13 06:10:24 Finished on | Feb 13 06:12:44 Mapping speed, Million of reads per hour | 356.54 Number of input reads | 13865452 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12959795 Uniquely mapped reads % | 93.47% Average mapped length | 294.63 Number of splices: Total | 12263425 Number of splices: Annotated (sjdb) | 12042777 Number of splices: GT/AG | 12038125 Number of splices: GC/AG | 179121 Number of splices: AT/AC | 12681 Number of splices: Non-canonical | 33498 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.24 Insertion rate per base | 0.03% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326088 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 51200 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579569 579569 579569 N_multimapping 326088 326088 326088 N_noFeature 338693 12809572 403093 N_ambiguous 158525 664 72639 UnstrandedReadsAssigned:12462577 PositiveStrandReadsAssigned:149559 NegativeStrandReadsAssigned:12484063 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917499 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917499-trimmed-pair1.fastq SRR12917499-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,865,452 reads, 12,514,371 reads pseudoaligned [quant] estimated average fragment length: 255.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR12917499.ke.tsv 34699 SRR12917499.se.tsv 87100 total ==> SRR12917499.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.37 388 18.3965 Potri.005G024800.1.v4.1 1035 780.371 164 17.5708 Potri.004G059700.1.v4.1 961 706.483 32 3.78701 Potri.007G009000.2.v4.1 1416 1161.37 0 0 Potri.003G141000.2.v4.1 2943 2688.37 698.221 21.7146 Potri.016G087400.1.v4.1 270 88.1137 961.199 912.048 Potri.015G069301.1.v4.1 564 324.946 0 0 Potri.010G195200.1.v4.1 1773 1518.37 85 4.68046 Potri.012G127500.1.v4.1 977 722.437 11195 1295.6 ==> SRR12917499.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 113 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 146 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12917499 completed mapping pipeline successfully