Starting /dee2/code/volunteer_pipeline.sh SRR12917500 current disk space = 3052644675584 free memory = 1582187472 SRR12917500 SRAfilesize 91fde7b8fd820e45679ec5bd524a9be7 SRR12917500.sra SRR12917500.sra file validated SRR12917500 is paired end SRR12917500 is conventional basespace SRR12917500 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917500_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.649 37.0 37.0 37.0 37.0 37.0 2 36.449 37.0 37.0 37.0 37.0 37.0 3 36.6985 37.0 37.0 37.0 37.0 37.0 4 36.682 37.0 37.0 37.0 37.0 37.0 5 36.72 37.0 37.0 37.0 37.0 37.0 6 36.683 37.0 37.0 37.0 37.0 37.0 7 36.6355 37.0 37.0 37.0 37.0 37.0 8 36.6325 37.0 37.0 37.0 37.0 37.0 9 36.651 37.0 37.0 37.0 37.0 37.0 10-14 36.6656 37.0 37.0 37.0 37.0 37.0 15-19 36.6051 37.0 37.0 37.0 37.0 37.0 20-24 36.5884 37.0 37.0 37.0 37.0 37.0 25-29 36.565 37.0 37.0 37.0 37.0 37.0 30-34 36.5248 37.0 37.0 37.0 37.0 37.0 35-39 36.4626 37.0 37.0 37.0 37.0 37.0 40-44 36.4588 37.0 37.0 37.0 37.0 37.0 45-49 36.4381 37.0 37.0 37.0 37.0 37.0 50-54 36.3918 37.0 37.0 37.0 37.0 37.0 55-59 36.376400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.4003 37.0 37.0 37.0 37.0 37.0 65-69 36.285000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3069 37.0 37.0 37.0 37.0 37.0 75-79 36.331 37.0 37.0 37.0 37.0 37.0 80-84 36.3564 37.0 37.0 37.0 37.0 37.0 85-89 36.308299999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.278999999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2542 37.0 37.0 37.0 37.0 37.0 100-104 36.209599999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1598 37.0 37.0 37.0 37.0 37.0 110-114 36.146499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0969 37.0 37.0 37.0 37.0 37.0 120-124 36.1173 37.0 37.0 37.0 37.0 37.0 125-129 35.9844 37.0 37.0 37.0 37.0 37.0 130-134 35.9886 37.0 37.0 37.0 37.0 37.0 135-139 35.848 37.0 37.0 37.0 37.0 37.0 140-144 35.672399999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.632999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.49025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 0.0 22 4.0 23 2.0 24 1.0 25 3.0 26 7.0 27 3.0 28 7.0 29 14.0 30 24.0 31 28.0 32 42.0 33 42.0 34 128.0 35 321.0 36 3051.0 37 320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.525 12.55 5.8999999999999995 35.025 2 19.725 11.125 38.65 30.5 3 17.625 17.599999999999998 27.400000000000002 37.375 4 23.525 22.2 23.7 30.575000000000003 5 24.075 30.375000000000004 24.8 20.75 6 20.575 33.074999999999996 22.775000000000002 23.575 7 17.0 26.775 40.875 15.35 8 17.724999999999998 27.55 30.475 24.25 9 17.150000000000002 23.3 34.525 25.025 10-14 20.03 29.73 27.825 22.415 15-19 20.424999999999997 27.665 27.51 24.4 20-24 20.95 28.610000000000003 27.24 23.200000000000003 25-29 20.62 28.435 27.339999999999996 23.605 30-34 20.89 28.235 27.21 23.665 35-39 20.080000000000002 28.43 27.445000000000004 24.044999999999998 40-44 20.86 27.685 27.565 23.89 45-49 20.380000000000003 28.78 27.139999999999997 23.7 50-54 20.34 28.28 27.13 24.25 55-59 20.28 27.994999999999997 27.255000000000003 24.47 60-64 21.044999999999998 28.13 26.96 23.865 65-69 20.995 28.15 27.1 23.755000000000003 70-74 20.385 28.249999999999996 26.935 24.43 75-79 20.66 27.96 27.99 23.39 80-84 21.305 27.655 27.425 23.615 85-89 20.94 27.839999999999996 27.175 24.044999999999998 90-94 21.525 28.075 26.735 23.665 95-99 21.2 28.16 27.495000000000005 23.145 100-104 20.849999999999998 28.29 26.795 24.065 105-109 21.39 27.779999999999998 27.015 23.815 110-114 21.7 28.015 26.52 23.765 115-119 22.040000000000003 28.044999999999998 26.5 23.415 120-124 20.79 27.88 26.740000000000002 24.59 125-129 21.88 27.48 26.384999999999998 24.255 130-134 21.36 27.810000000000002 26.46 24.37 135-139 21.685 27.425 26.400000000000002 24.490000000000002 140-144 21.86 27.57 26.185000000000002 24.385 145-149 21.4 27.939999999999998 26.21 24.45 150-151 22.3125 26.325 26.237500000000004 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 2.5 23 4.0 24 2.0 25 1.0 26 5.5 27 8.0 28 7.5 29 9.0 30 12.5 31 21.5 32 30.5 33 38.0 34 53.0 35 67.5 36 82.0 37 92.0 38 112.5 39 144.5 40 171.5 41 184.5 42 189.5 43 214.0 44 245.0 45 259.0 46 246.0 47 247.0 48 246.0 49 221.5 50 213.5 51 182.0 52 142.5 53 119.0 54 97.0 55 87.0 56 76.5 57 55.0 58 30.5 59 19.0 60 17.5 61 12.0 62 6.0 63 4.5 64 3.5 65 4.0 66 1.5 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.74329925393755 82.1 2 8.151423045040067 14.75 3 0.9671179883945842 2.625 4 0.11052777010223819 0.4 5 0.027631942525559547 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATGCAAAAATATAGATCAAAGCACATTCTGTAATCCCATGCCCTGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7875000000000001 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.325 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 2.9375 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.7625 0.0 0.0 0.0 0.0 108-109 4.175000000000001 0.0 0.0 0.0 0.0 110-111 4.6375 0.0 0.0 0.0 0.0 112-113 5.1625 0.0 0.0 0.0 0.0 114-115 5.637499999999999 0.0 0.0 0.0 0.0 116-117 6.2 0.0 0.0 0.0 0.0 118-119 7.012499999999999 0.0 0.0 0.0 0.0 120-121 7.7125 0.0 0.0 0.0 0.0 122-123 8.2625 0.0 0.0 0.0 0.0 124-125 9.024999999999999 0.0 0.0 0.0 0.0 126-127 9.575 0.0 0.0 0.0 0.0 128-129 10.125 0.0 0.0 0.0 0.0 130-131 10.675 0.0 0.0 0.0 0.0 132-133 11.2 0.0 0.0 0.0 0.0 134-135 11.7375 0.0 0.0 0.0 0.0 136-137 12.2625 0.0 0.0 0.0 0.0 138-139 12.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917500 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917500_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41125 37.0 37.0 37.0 37.0 37.0 2 36.3345 37.0 37.0 37.0 37.0 37.0 3 36.321 37.0 37.0 37.0 37.0 37.0 4 36.3835 37.0 37.0 37.0 37.0 37.0 5 36.424 37.0 37.0 37.0 37.0 37.0 6 36.338 37.0 37.0 37.0 37.0 37.0 7 36.454 37.0 37.0 37.0 37.0 37.0 8 36.384 37.0 37.0 37.0 37.0 37.0 9 36.4665 37.0 37.0 37.0 37.0 37.0 10-14 36.45 37.0 37.0 37.0 37.0 37.0 15-19 36.4568 37.0 37.0 37.0 37.0 37.0 20-24 36.41180000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.341899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2692 37.0 37.0 37.0 37.0 37.0 35-39 36.251400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1747 37.0 37.0 37.0 37.0 37.0 45-49 36.2193 37.0 37.0 37.0 37.0 37.0 50-54 36.125699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.161699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.191199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.17550000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.117599999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0582 37.0 37.0 37.0 37.0 37.0 80-84 36.063 37.0 37.0 37.0 37.0 37.0 85-89 36.090999999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.088699999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.023700000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.077799999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.89739999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.8702 37.0 37.0 37.0 37.0 37.0 115-119 35.831900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.682500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6101 37.0 37.0 37.0 37.0 37.0 130-134 35.4735 37.0 37.0 37.0 37.0 37.0 135-139 35.3652 37.0 37.0 37.0 37.0 37.0 140-144 34.9696 37.0 37.0 37.0 25.0 37.0 145-149 34.8223 37.0 37.0 37.0 25.0 37.0 150-151 34.441500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 0.0 16 3.0 17 2.0 18 3.0 19 1.0 20 2.0 21 1.0 22 5.0 23 3.0 24 6.0 25 4.0 26 5.0 27 8.0 28 12.0 29 13.0 30 26.0 31 34.0 32 53.0 33 100.0 34 177.0 35 471.0 36 2841.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.68542135533884 25.881470367591895 8.552138034508626 23.88097024256064 2 25.85 25.775 33.1 15.275 3 21.6 26.974999999999998 33.5 17.925 4 24.075 33.675 22.925 19.325 5 26.224999999999998 35.975 21.7 16.1 6 20.424999999999997 39.95 21.375 18.25 7 20.674999999999997 24.125 37.3 17.9 8 20.849999999999998 23.925 29.95 25.275 9 23.925 23.150000000000002 29.925 23.0 10-14 23.45 29.125 26.064999999999998 21.36 15-19 23.544999999999998 27.994999999999997 27.089999999999996 21.37 20-24 23.845 27.97 26.979999999999997 21.205 25-29 23.76 28.139999999999997 26.875 21.224999999999998 30-34 23.205000000000002 27.169999999999998 28.24 21.385 35-39 23.745 27.6 26.86 21.795 40-44 23.445 27.72 27.82 21.015 45-49 22.85 28.24 27.334999999999997 21.575 50-54 23.115 27.400000000000002 27.63 21.855 55-59 23.880000000000003 27.38 27.284999999999997 21.455 60-64 23.09 27.74 28.035 21.135 65-69 24.12 27.224999999999998 27.150000000000002 21.505 70-74 23.82 27.735 26.87 21.575 75-79 23.669999999999998 27.37 27.169999999999998 21.790000000000003 80-84 23.575 27.74 26.8 21.884999999999998 85-89 24.065 27.54 26.900000000000002 21.495 90-94 24.455 27.82 26.985 20.74 95-99 24.215 27.875 26.87 21.04 100-104 24.335 27.005000000000003 27.275 21.385 105-109 24.775 27.375 26.865 20.985 110-114 24.66 27.965 26.419999999999998 20.955 115-119 25.395 28.13 26.415 20.06 120-124 26.31 27.215 26.35 20.125 125-129 26.369999999999997 27.465 25.679999999999996 20.485 130-134 26.640000000000004 27.589999999999996 26.064999999999998 19.705000000000002 135-139 26.325 26.99 26.505000000000003 20.18 140-144 27.33 26.47 26.075 20.125 145-149 27.800000000000004 26.83 25.685000000000002 19.685 150-151 28.299999999999997 27.287499999999998 25.05 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 3.0 28 7.5 29 8.5 30 8.0 31 17.0 32 23.5 33 35.0 34 45.5 35 55.5 36 69.5 37 97.5 38 131.5 39 139.5 40 171.0 41 206.0 42 220.5 43 238.5 44 258.5 45 272.5 46 261.5 47 260.0 48 247.5 49 209.0 50 184.5 51 164.0 52 148.5 53 120.0 54 89.0 55 75.5 56 60.0 57 43.5 58 28.5 59 23.0 60 18.5 61 13.0 62 9.0 63 5.5 64 2.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85619285120532 81.975 2 7.924632862288723 14.299999999999999 3 0.997506234413965 2.7 4 0.0831255195344971 0.3 5 0.0831255195344971 0.375 6 0.02770850651149903 0.15 7 0.0 0.0 8 0.02770850651149903 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATAT 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GGTCCTCTTCTTCTCCAAACGAGTACCATGACTGCAGAGAATTGTAAGAA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7875000000000001 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.3125 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.9625 0.0 0.0 0.0 0.0 104-105 3.425 0.0 0.0 0.0 0.0 106-107 3.8125 0.0 0.0 0.0 0.0 108-109 4.225 0.0 0.0 0.0 0.0 110-111 4.7125 0.0 0.0 0.0 0.0 112-113 5.2625 0.0 0.0 0.0 0.0 114-115 5.737500000000001 0.0 0.0 0.0 0.0 116-117 6.3 0.0 0.0 0.0 0.0 118-119 7.125 0.0 0.0 0.0 0.0 120-121 7.8375 0.0 0.0 0.0 0.0 122-123 8.3875 0.0 0.0 0.0 0.0 124-125 9.1875 0.0 0.0 0.0 0.0 126-127 9.75 0.0 0.0 0.0 0.0 128-129 10.3 0.0 0.0 0.0 0.0 130-131 10.85 0.0 0.0 0.0 0.0 132-133 11.4125 0.0 0.0 0.0 0.0 134-135 11.962499999999999 0.0 0.0 0.0 0.0 136-137 12.4625 0.0 0.0 0.0 0.0 138-139 13.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGGGA 10 0.006830828 145.0 7 >>END_MODULE Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588510 spots for SRR12917500.sra Written 588510 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra Read 588499 spots for SRR12917500.sra Written 588499 spots for SRR12917500.sra SRR ids: ['SRR12917500.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xngicevx SRR12917500.sra spots: 11769991 blocks: [[1, 588499], [588500, 1176998], [1176999, 1765497], [1765498, 2353996], [2353997, 2942495], [2942496, 3530994], [3530995, 4119493], [4119494, 4707992], [4707993, 5296491], [5296492, 5884990], [5884991, 6473489], [6473490, 7061988], [7061989, 7650487], [7650488, 8238986], [8238987, 8827485], [8827486, 9415984], [9415985, 10004483], [10004484, 10592982], [10592983, 11181481], [11181482, 11769991]] SRR12917500 file size 3978257 SRR12917500 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917500 SRR12917500_1.fastq SRR12917500_2.fastq Input file: SRR12917500_1.fastq Paired file: SRR12917500_2.fastq trimmed: SRR12917500-trimmed-pair1.fastq, SRR12917500-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:34:36 2025 >> started Thu Feb 13 08:43:44 2025 >> done (548.085s) 11769991 read pairs processed; of these: 133 ( 0.00%) short read pairs filtered out after trimming by size control 5313 ( 0.05%) empty read pairs filtered out after trimming by size control 11764545 (99.95%) read pairs available; of these: 2128912 (18.10%) trimmed read pairs available after processing 9635633 (81.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 7 0.00% 21 12 0.00% 22 10 0.00% 23 14 0.00% 24 15 0.00% 25 11 0.00% 26 11 0.00% 27 20 0.00% 28 20 0.00% 29 14 0.00% 30 17 0.00% 31 26 0.00% 32 20 0.00% 33 16 0.00% 34 22 0.00% 35 30 0.00% 36 24 0.00% 37 35 0.00% 38 23 0.00% 39 22 0.00% 40 31 0.00% 41 38 0.00% 42 46 0.00% 43 36 0.00% 44 43 0.00% 45 36 0.00% 46 51 0.00% 47 60 0.00% 48 86 0.00% 49 92 0.00% 50 139 0.00% 51 141 0.00% 52 146 0.00% 53 187 0.00% 54 196 0.00% 55 222 0.00% 56 257 0.00% 57 289 0.00% 58 351 0.00% 59 376 0.00% 60 494 0.00% 61 571 0.00% 62 737 0.01% 63 808 0.01% 64 863 0.01% 65 1059 0.01% 66 1081 0.01% 67 1293 0.01% 68 1426 0.01% 69 1647 0.01% 70 1833 0.02% 71 2196 0.02% 72 2535 0.02% 73 2862 0.02% 74 3339 0.03% 75 3638 0.03% 76 4021 0.03% 77 4358 0.04% 78 4554 0.04% 79 5101 0.04% 80 5399 0.05% 81 6133 0.05% 82 6907 0.06% 83 7604 0.06% 84 8054 0.07% 85 9049 0.08% 86 9573 0.08% 87 9942 0.08% 88 10609 0.09% 89 11065 0.09% 90 11694 0.10% 91 12266 0.10% 92 13305 0.11% 93 13859 0.12% 94 15009 0.13% 95 16143 0.14% 96 16702 0.14% 97 17646 0.15% 98 17866 0.15% 99 18805 0.16% 100 18928 0.16% 101 19602 0.17% 102 20242 0.17% 103 21136 0.18% 104 22094 0.19% 105 23455 0.20% 106 23972 0.20% 107 24845 0.21% 108 25602 0.22% 109 26094 0.22% 110 26556 0.23% 111 26758 0.23% 112 27702 0.24% 113 27642 0.23% 114 28851 0.25% 115 30002 0.26% 116 31401 0.27% 117 32681 0.28% 118 32971 0.28% 119 34303 0.29% 120 34521 0.29% 121 34485 0.29% 122 34527 0.29% 123 35784 0.30% 124 36566 0.31% 125 37036 0.31% 126 38423 0.33% 127 38689 0.33% 128 40040 0.34% 129 41110 0.35% 130 41269 0.35% 131 40342 0.34% 132 41548 0.35% 133 41831 0.36% 134 41721 0.35% 135 42308 0.36% 136 43178 0.37% 137 43226 0.37% 138 45015 0.38% 139 45789 0.39% 140 46167 0.39% 141 46353 0.39% 142 46790 0.40% 143 46229 0.39% 144 46581 0.40% 145 47154 0.40% 146 47277 0.40% 147 47392 0.40% 148 48535 0.41% 149 48675 0.41% 150 50258 0.43% 151 9635633 81.90% 11764545 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=15 prefix-density=0.81 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=11.35 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.5 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=1.12 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=59.45 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12917500 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:28:59 Started mapping on | Feb 13 09:29:02 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 7.30 Number of input reads | 11764545 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11110057 Uniquely mapped reads % | 94.44% Average mapped length | 290.71 Number of splices: Total | 10675213 Number of splices: Annotated (sjdb) | 10486436 Number of splices: GT/AG | 10429517 Number of splices: GC/AG | 202899 Number of splices: AT/AC | 6503 Number of splices: Non-canonical | 36294 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324138 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 29821 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 330350 330350 330350 N_multimapping 324138 324138 324138 N_noFeature 265470 10940207 325209 N_ambiguous 183776 771 73154 UnstrandedReadsAssigned:10660811 PositiveStrandReadsAssigned:169079 NegativeStrandReadsAssigned:10711694 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917500 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917500-trimmed-pair1.fastq SRR12917500-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,764,545 reads, 10,828,444 reads pseudoaligned [quant] estimated average fragment length: 231.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 977 rounds 52401 SRR12917500.ke.tsv 34699 SRR12917500.se.tsv 87100 total ==> SRR12917500.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.86 226 10.4217 Potri.005G024800.1.v4.1 1035 804.861 204 20.8966 Potri.004G059700.1.v4.1 961 730.967 49 5.52668 Potri.007G009000.2.v4.1 1416 1185.86 0 0 Potri.003G141000.2.v4.1 2943 2712.86 395.418 12.0169 Potri.016G087400.1.v4.1 270 97.2346 622 527.394 Potri.015G069301.1.v4.1 564 344.322 0 0 Potri.010G195200.1.v4.1 1773 1542.86 21 1.12217 Potri.012G127500.1.v4.1 977 746.905 326 35.9847 ==> SRR12917500.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 173 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917500 completed mapping pipeline successfully