Starting /dee2/code/volunteer_pipeline.sh SRR12917501 current disk space = 3052968939520 free memory = 1480486664 SRR12917501 SRAfilesize f8aca5120cb9f7c783b0465f767bccf9 SRR12917501.sra SRR12917501.sra file validated SRR12917501 is paired end SRR12917501 is conventional basespace SRR12917501 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.64825 37.0 37.0 37.0 37.0 37.0 2 36.457 37.0 37.0 37.0 37.0 37.0 3 36.619 37.0 37.0 37.0 37.0 37.0 4 36.6095 37.0 37.0 37.0 37.0 37.0 5 36.717 37.0 37.0 37.0 37.0 37.0 6 36.665 37.0 37.0 37.0 37.0 37.0 7 36.6155 37.0 37.0 37.0 37.0 37.0 8 36.6065 37.0 37.0 37.0 37.0 37.0 9 36.678 37.0 37.0 37.0 37.0 37.0 10-14 36.651 37.0 37.0 37.0 37.0 37.0 15-19 36.6129 37.0 37.0 37.0 37.0 37.0 20-24 36.571600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5613 37.0 37.0 37.0 37.0 37.0 30-34 36.511799999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.480399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4692 37.0 37.0 37.0 37.0 37.0 45-49 36.39359999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.444900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3652 37.0 37.0 37.0 37.0 37.0 60-64 36.3335 37.0 37.0 37.0 37.0 37.0 65-69 36.2874 37.0 37.0 37.0 37.0 37.0 70-74 36.28529999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2789 37.0 37.0 37.0 37.0 37.0 80-84 36.2772 37.0 37.0 37.0 37.0 37.0 85-89 36.308 37.0 37.0 37.0 37.0 37.0 90-94 36.230199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2007 37.0 37.0 37.0 37.0 37.0 100-104 36.179100000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1846 37.0 37.0 37.0 37.0 37.0 110-114 36.129599999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0803 37.0 37.0 37.0 37.0 37.0 120-124 36.069 37.0 37.0 37.0 37.0 37.0 125-129 35.9113 37.0 37.0 37.0 37.0 37.0 130-134 35.9111 37.0 37.0 37.0 37.0 37.0 135-139 35.8672 37.0 37.0 37.0 37.0 37.0 140-144 35.6777 37.0 37.0 37.0 37.0 37.0 145-149 35.5921 37.0 37.0 37.0 37.0 37.0 150-151 35.244749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 4.0 24 1.0 25 5.0 26 3.0 27 11.0 28 13.0 29 26.0 30 22.0 31 28.0 32 37.0 33 69.0 34 123.0 35 281.0 36 3019.0 37 355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.12934701025769 14.260695521641232 6.9051788841631225 39.70477858393796 2 19.775000000000002 13.3 38.15 28.775000000000002 3 17.349999999999998 15.9 28.425 38.324999999999996 4 22.225 21.675 23.7 32.4 5 23.05 30.675 24.25 22.025 6 22.35 32.625 23.225 21.8 7 15.325 29.025000000000002 39.35 16.3 8 16.6 27.725 33.35 22.325 9 16.525000000000002 24.45 35.449999999999996 23.575 10-14 19.139999999999997 30.865 27.515 22.48 15-19 19.255 29.03 27.750000000000004 23.965 20-24 19.509999999999998 29.580000000000002 26.99 23.919999999999998 25-29 19.564999999999998 28.860000000000003 27.750000000000004 23.825 30-34 19.93 29.244999999999997 27.005000000000003 23.82 35-39 20.275000000000002 29.060000000000002 27.034999999999997 23.630000000000003 40-44 20.165 29.665000000000003 26.245 23.925 45-49 20.255000000000003 29.375 27.12 23.25 50-54 20.09 28.854999999999997 26.640000000000004 24.415 55-59 20.565 28.660000000000004 27.08 23.695 60-64 20.06 29.360000000000003 26.345000000000002 24.235 65-69 20.335 28.715000000000003 26.834999999999997 24.115000000000002 70-74 20.095 28.9 26.605 24.4 75-79 20.7 28.505000000000003 26.674999999999997 24.12 80-84 20.349999999999998 29.104999999999997 26.97 23.575 85-89 20.244999999999997 28.08 27.82 23.855 90-94 20.07 28.315 27.089999999999996 24.525 95-99 20.77 27.950000000000003 27.35 23.93 100-104 20.5 28.24 27.04 24.22 105-109 20.474999999999998 28.065 27.115000000000002 24.345 110-114 20.77 28.4 26.590000000000003 24.240000000000002 115-119 21.64 28.425 26.540000000000003 23.395 120-124 21.2 27.694999999999997 26.905 24.2 125-129 21.36 28.1 26.685 23.855 130-134 22.05 27.345000000000002 26.565 24.04 135-139 21.61 27.860000000000003 26.455000000000002 24.075 140-144 21.695 27.334999999999997 26.400000000000002 24.57 145-149 21.69 27.35 26.279999999999998 24.68 150-151 20.974999999999998 27.450000000000003 26.487500000000004 25.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 2.0 22 3.0 23 2.5 24 3.0 25 9.5 26 8.5 27 9.0 28 16.0 29 18.0 30 18.5 31 25.0 32 42.5 33 50.5 34 61.5 35 94.5 36 117.0 37 118.0 38 135.0 39 159.5 40 171.0 41 176.5 42 187.0 43 203.5 44 228.0 45 240.0 46 237.5 47 222.5 48 198.5 49 199.0 50 192.0 51 172.5 52 142.5 53 107.0 54 83.0 55 74.5 56 66.5 57 48.0 58 32.0 59 27.0 60 22.5 61 16.5 62 14.5 63 7.5 64 3.5 65 7.0 66 6.0 67 1.5 68 2.0 69 1.5 70 2.0 71 2.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.9065705572498 81.975 2 7.762683670640421 14.000000000000002 3 0.99805932908234 2.7 4 0.249514832270585 0.8999999999999999 5 0.05544774050457444 0.25 6 0.0 0.0 7 0.02772387025228722 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCTTGGTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 11 (97% over 37bp) CGATGACATGTTCCCCTCCTGACATTTCTAGATCGTAAAAGAAACAGCAA 5 0.125 No Hit CACAAATCATACGCTTGCTTGCCTGTGAACTTGACCTCAATTGGGCTAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.225 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.9125 0.0 0.0 0.0 0.0 110-111 3.3875 0.0 0.0 0.0 0.0 112-113 3.775 0.0 0.0 0.0 0.0 114-115 4.1625 0.0 0.0 0.0 0.0 116-117 4.4625 0.0 0.0 0.0 0.0 118-119 4.800000000000001 0.0 0.0 0.0 0.0 120-121 5.2875 0.0 0.0 0.0 0.0 122-123 5.7125 0.0 0.0 0.0 0.0 124-125 6.1875 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.074999999999999 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.4125 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGAGA 10 0.006830828 145.0 1 ATCGGAA 50 0.0013298223 17.4 140-144 >>END_MODULE SRR12917501 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917501_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33125 37.0 37.0 37.0 37.0 37.0 2 36.136 37.0 37.0 37.0 37.0 37.0 3 36.2175 37.0 37.0 37.0 37.0 37.0 4 36.27 37.0 37.0 37.0 37.0 37.0 5 36.2875 37.0 37.0 37.0 37.0 37.0 6 36.2015 37.0 37.0 37.0 37.0 37.0 7 36.2655 37.0 37.0 37.0 37.0 37.0 8 36.355 37.0 37.0 37.0 37.0 37.0 9 36.3315 37.0 37.0 37.0 37.0 37.0 10-14 36.3281 37.0 37.0 37.0 37.0 37.0 15-19 36.333400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.2375 37.0 37.0 37.0 37.0 37.0 25-29 36.111999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.08559999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.0834 37.0 37.0 37.0 37.0 37.0 40-44 36.070899999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.9328 37.0 37.0 37.0 37.0 37.0 50-54 35.9466 37.0 37.0 37.0 37.0 37.0 55-59 35.9847 37.0 37.0 37.0 37.0 37.0 60-64 36.01290000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9297 37.0 37.0 37.0 37.0 37.0 70-74 35.8861 37.0 37.0 37.0 37.0 37.0 75-79 35.860800000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.892700000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.891 37.0 37.0 37.0 37.0 37.0 90-94 35.8728 37.0 37.0 37.0 37.0 37.0 95-99 35.81420000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.7791 37.0 37.0 37.0 37.0 37.0 105-109 35.7234 37.0 37.0 37.0 37.0 37.0 110-114 35.761700000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.718399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.5274 37.0 37.0 37.0 37.0 37.0 125-129 35.501400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.337599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3271 37.0 37.0 37.0 34.6 37.0 140-144 35.005700000000004 37.0 37.0 37.0 27.4 37.0 145-149 34.7846 37.0 37.0 37.0 25.0 37.0 150-151 34.36725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 3.0 16 3.0 17 3.0 18 0.0 19 4.0 20 4.0 21 3.0 22 7.0 23 2.0 24 7.0 25 4.0 26 10.0 27 9.0 28 9.0 29 16.0 30 23.0 31 31.0 32 55.0 33 126.0 34 212.0 35 651.0 36 2653.0 37 163.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.60965241310328 27.206801700425103 9.602400600150037 24.58114528632158 2 29.375 25.05 29.549999999999997 16.025 3 22.1 26.8 32.05 19.05 4 24.775 31.924999999999997 23.599999999999998 19.7 5 26.35 34.925 21.675 17.05 6 22.05 38.324999999999996 21.4 18.224999999999998 7 21.625 23.474999999999998 36.75 18.15 8 21.25 24.825 29.7 24.224999999999998 9 22.6 23.775 29.275000000000002 24.349999999999998 10-14 24.715 28.015 26.009999999999998 21.26 15-19 24.82 27.889999999999997 26.035000000000004 21.255 20-24 24.834999999999997 27.700000000000003 26.529999999999998 20.935000000000002 25-29 24.665 27.639999999999997 26.97 20.724999999999998 30-34 24.095 27.275 27.310000000000002 21.32 35-39 23.919999999999998 28.144999999999996 26.595000000000002 21.34 40-44 24.325 27.755000000000003 27.150000000000002 20.77 45-49 24.325 27.305 26.919999999999998 21.45 50-54 24.490000000000002 27.47 26.735 21.305 55-59 24.775 27.375 26.915 20.935000000000002 60-64 24.51 27.52 26.58 21.39 65-69 24.57 27.22 26.995 21.215 70-74 25.22 27.775 26.465 20.54 75-79 24.125 27.485 27.41 20.979999999999997 80-84 24.44 27.625 26.52 21.415 85-89 24.9 28.26 26.279999999999998 20.560000000000002 90-94 24.240000000000002 27.250000000000004 27.139999999999997 21.37 95-99 25.314999999999998 26.779999999999998 27.339999999999996 20.565 100-104 24.87 26.884999999999998 27.560000000000002 20.685000000000002 105-109 25.064999999999998 27.165 27.575 20.195 110-114 24.925 27.48 27.105 20.49 115-119 25.705 27.41 26.75 20.135 120-124 25.205 28.43 26.345000000000002 20.02 125-129 25.495 27.32 27.134999999999998 20.05 130-134 26.05 27.255000000000003 26.945000000000004 19.75 135-139 26.419999999999998 26.665 27.105 19.81 140-144 26.845000000000002 26.900000000000002 26.72 19.535 145-149 27.800000000000004 26.735 26.44 19.025 150-151 28.0875 26.8625 26.137500000000003 18.912499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 0.5 24 0.0 25 0.0 26 4.0 27 4.5 28 1.5 29 5.0 30 10.0 31 16.5 32 17.0 33 22.0 34 37.5 35 49.0 36 71.5 37 91.5 38 108.0 39 128.0 40 144.5 41 181.5 42 237.5 43 265.0 44 266.5 45 277.0 46 268.0 47 235.5 48 240.5 49 233.0 50 198.5 51 174.0 52 148.5 53 116.5 54 89.0 55 83.0 56 59.0 57 41.0 58 32.0 59 23.5 60 28.0 61 19.5 62 8.5 63 7.5 64 8.0 65 5.5 66 2.5 67 4.0 68 2.5 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 1.5 87 1.5 88 0.5 89 1.0 90 2.0 91 2.0 92 0.5 93 0.0 94 0.0 95 1.0 96 2.0 97 1.0 98 0.0 99 0.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64829106945976 83.125 2 7.221609702315325 13.100000000000001 3 0.9095920617420067 2.475 4 0.05512679162072767 0.2 5 0.05512679162072767 0.25 6 0.027563395810363836 0.15 7 0.027563395810363836 0.17500000000000002 8 0.0 0.0 9 0.027563395810363836 0.22499999999999998 >10 0.027563395810363836 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit GGATGATCTTGCCTACGATGATGATGCCGGTGGCTGGTGATGAACGGTAA 5 0.125 No Hit AGGGTGTTCCCCAATGGAGAGGTGCAGTACTTGCATCCTAAGGATGGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.5125000000000002 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.3375000000000004 0.0 0.0 0.0 0.0 112-113 3.725 0.0 0.0 0.0 0.0 114-115 4.112500000000001 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.75 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.6875 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 7.050000000000001 0.0 0.0 0.0 0.0 130-131 7.775 0.0 0.0 0.0 0.0 132-133 8.625 0.0 0.0 0.0 0.0 134-135 9.3125 0.0 0.0 0.0 0.0 136-137 9.95 0.0 0.0 0.0 0.0 138-139 10.837499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATTC 10 0.006830828 145.0 9 ATCGGAA 50 0.0013298223 17.4 140-144 >>END_MODULE Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528702 spots for SRR12917501.sra Written 528702 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra Read 528701 spots for SRR12917501.sra Written 528701 spots for SRR12917501.sra SRR ids: ['SRR12917501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bwz2hewe SRR12917501.sra spots: 10574021 blocks: [[1, 528701], [528702, 1057402], [1057403, 1586103], [1586104, 2114804], [2114805, 2643505], [2643506, 3172206], [3172207, 3700907], [3700908, 4229608], [4229609, 4758309], [4758310, 5287010], [5287011, 5815711], [5815712, 6344412], [6344413, 6873113], [6873114, 7401814], [7401815, 7930515], [7930516, 8459216], [8459217, 8987917], [8987918, 9516618], [9516619, 10045319], [10045320, 10574021]] SRR12917501 file size 3571814 SRR12917501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917501 SRR12917501_1.fastq SRR12917501_2.fastq Input file: SRR12917501_1.fastq Paired file: SRR12917501_2.fastq trimmed: SRR12917501-trimmed-pair1.fastq, SRR12917501-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:46:26 2025 >> started Thu Feb 13 06:46:38 2025 >> done (12.148s) 10574021 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 17968 ( 0.17%) empty read pairs filtered out after trimming by size control 10555962 (99.83%) read pairs available; of these: 1749485 (16.57%) trimmed read pairs available after processing 8806477 (83.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 5 0.00% 21 5 0.00% 22 6 0.00% 23 11 0.00% 24 14 0.00% 25 17 0.00% 26 19 0.00% 27 11 0.00% 28 23 0.00% 29 19 0.00% 30 16 0.00% 31 24 0.00% 32 25 0.00% 33 25 0.00% 34 20 0.00% 35 29 0.00% 36 30 0.00% 37 24 0.00% 38 28 0.00% 39 26 0.00% 40 32 0.00% 41 32 0.00% 42 33 0.00% 43 37 0.00% 44 37 0.00% 45 31 0.00% 46 33 0.00% 47 60 0.00% 48 72 0.00% 49 81 0.00% 50 80 0.00% 51 98 0.00% 52 76 0.00% 53 90 0.00% 54 131 0.00% 55 157 0.00% 56 153 0.00% 57 166 0.00% 58 186 0.00% 59 242 0.00% 60 295 0.00% 61 331 0.00% 62 382 0.00% 63 474 0.00% 64 508 0.00% 65 602 0.01% 66 633 0.01% 67 645 0.01% 68 816 0.01% 69 941 0.01% 70 1047 0.01% 71 1181 0.01% 72 1527 0.01% 73 1600 0.02% 74 1804 0.02% 75 2133 0.02% 76 2167 0.02% 77 2495 0.02% 78 2726 0.03% 79 2869 0.03% 80 3217 0.03% 81 3648 0.03% 82 4218 0.04% 83 4617 0.04% 84 5234 0.05% 85 5749 0.05% 86 6154 0.06% 87 6656 0.06% 88 6923 0.07% 89 7152 0.07% 90 7599 0.07% 91 8251 0.08% 92 8612 0.08% 93 9690 0.09% 94 10209 0.10% 95 10944 0.10% 96 11749 0.11% 97 12411 0.12% 98 12559 0.12% 99 13083 0.12% 100 13584 0.13% 101 14184 0.13% 102 14560 0.14% 103 15275 0.14% 104 16245 0.15% 105 17162 0.16% 106 18009 0.17% 107 18905 0.18% 108 19486 0.18% 109 19477 0.18% 110 20278 0.19% 111 20351 0.19% 112 21340 0.20% 113 21459 0.20% 114 22516 0.21% 115 23881 0.23% 116 24851 0.24% 117 26333 0.25% 118 26551 0.25% 119 27340 0.26% 120 27905 0.26% 121 27925 0.26% 122 28607 0.27% 123 28890 0.27% 124 30063 0.28% 125 30116 0.29% 126 31637 0.30% 127 32365 0.31% 128 33549 0.32% 129 35057 0.33% 130 34649 0.33% 131 34705 0.33% 132 35942 0.34% 133 36334 0.34% 134 36719 0.35% 135 37781 0.36% 136 38098 0.36% 137 38585 0.37% 138 40134 0.38% 139 41241 0.39% 140 41331 0.39% 141 41982 0.40% 142 42335 0.40% 143 42030 0.40% 144 42889 0.41% 145 43556 0.41% 146 43584 0.41% 147 44035 0.42% 148 46349 0.44% 149 45707 0.43% 150 47530 0.45% 151 8806477 83.43% 10555962 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=30.72 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.1 sequence=TGATCTTCAAAAACCCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGAAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=32 prefix-density=0.54 prefix-fanout=2.0 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=39.67 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.7 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12917501 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:47:17 Started mapping on | Feb 13 06:47:17 Finished on | Feb 13 06:48:24 Mapping speed, Million of reads per hour | 567.19 Number of input reads | 10555962 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 9904775 Uniquely mapped reads % | 93.83% Average mapped length | 292.15 Number of splices: Total | 8663134 Number of splices: Annotated (sjdb) | 8499281 Number of splices: GT/AG | 8475799 Number of splices: GC/AG | 143356 Number of splices: AT/AC | 7682 Number of splices: Non-canonical | 36297 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 3.26 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262579 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 136024 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388608 388608 388608 N_multimapping 262579 262579 262579 N_noFeature 275217 9669781 337893 N_ambiguous 256835 519 84305 UnstrandedReadsAssigned:9372723 PositiveStrandReadsAssigned:234475 NegativeStrandReadsAssigned:9482577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917501 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917501-trimmed-pair1.fastq SRR12917501-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,555,962 reads, 9,581,954 reads pseudoaligned [quant] estimated average fragment length: 227.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,307 rounds 52401 SRR12917501.ke.tsv 34699 SRR12917501.se.tsv 87100 total ==> SRR12917501.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.6 202 7.44267 Potri.005G024800.1.v4.1 1035 808.596 430 35.1038 Potri.004G059700.1.v4.1 961 734.629 49 4.40297 Potri.007G009000.2.v4.1 1416 1189.6 0 0 Potri.003G141000.2.v4.1 2943 2716.6 348 8.45613 Potri.016G087400.1.v4.1 270 92.5291 685 488.686 Potri.015G069301.1.v4.1 564 344.145 0 0 Potri.010G195200.1.v4.1 1773 1546.6 7 0.298771 Potri.012G127500.1.v4.1 977 750.616 1256 110.456 ==> SRR12917501.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12917501 completed mapping pipeline successfully