Starting /dee2/code/volunteer_pipeline.sh SRR12917502 current disk space = 3053022535680 free memory = 1475337108 SRR12917502 SRAfilesize 41d386c46877353bf5ac46b290e16cf8 SRR12917502.sra SRR12917502.sra file validated SRR12917502 is paired end SRR12917502 is conventional basespace SRR12917502 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.561 37.0 37.0 37.0 37.0 37.0 2 36.3675 37.0 37.0 37.0 37.0 37.0 3 36.555 37.0 37.0 37.0 37.0 37.0 4 36.564 37.0 37.0 37.0 37.0 37.0 5 36.627 37.0 37.0 37.0 37.0 37.0 6 36.5885 37.0 37.0 37.0 37.0 37.0 7 36.4975 37.0 37.0 37.0 37.0 37.0 8 36.584 37.0 37.0 37.0 37.0 37.0 9 36.608 37.0 37.0 37.0 37.0 37.0 10-14 36.6235 37.0 37.0 37.0 37.0 37.0 15-19 36.5915 37.0 37.0 37.0 37.0 37.0 20-24 36.581399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.555699999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.49 37.0 37.0 37.0 37.0 37.0 35-39 36.474000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4563 37.0 37.0 37.0 37.0 37.0 45-49 36.4446 37.0 37.0 37.0 37.0 37.0 50-54 36.424099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3668 37.0 37.0 37.0 37.0 37.0 60-64 36.359899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2836 37.0 37.0 37.0 37.0 37.0 70-74 36.3192 37.0 37.0 37.0 37.0 37.0 75-79 36.2614 37.0 37.0 37.0 37.0 37.0 80-84 36.3227 37.0 37.0 37.0 37.0 37.0 85-89 36.280699999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.257600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2109 37.0 37.0 37.0 37.0 37.0 100-104 36.138799999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1194 37.0 37.0 37.0 37.0 37.0 110-114 36.080799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0255 37.0 37.0 37.0 37.0 37.0 120-124 36.01 37.0 37.0 37.0 37.0 37.0 125-129 35.903200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8159 37.0 37.0 37.0 37.0 37.0 135-139 35.657799999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4874 37.0 37.0 37.0 37.0 37.0 145-149 35.307399999999994 37.0 37.0 37.0 34.6 37.0 150-151 35.0585 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 5.0 27 8.0 28 7.0 29 23.0 30 25.0 31 34.0 32 55.0 33 83.0 34 116.0 35 361.0 36 2979.0 37 301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.1 12.2 4.9750000000000005 37.724999999999994 2 17.95 11.25 40.2 30.599999999999998 3 17.4 15.425 29.75 37.425000000000004 4 22.2 23.025000000000002 25.3 29.475 5 23.724999999999998 31.225 24.675 20.375 6 18.625 33.225 25.324999999999996 22.825 7 15.275 25.15 43.3 16.275000000000002 8 16.3 25.1 33.225 25.374999999999996 9 16.775000000000002 24.05 36.475 22.7 10-14 19.400000000000002 29.995 27.83 22.775000000000002 15-19 20.165 27.46 28.76 23.615 20-24 20.285 28.345 27.62 23.75 25-29 20.215 28.244999999999997 27.625 23.915 30-34 19.645000000000003 28.655 27.41 24.29 35-39 19.85 28.705000000000002 27.634999999999998 23.810000000000002 40-44 20.74 28.79 27.400000000000002 23.07 45-49 20.080000000000002 28.705000000000002 27.325 23.89 50-54 20.26 28.335 28.005000000000003 23.400000000000002 55-59 20.405 28.775000000000002 27.025 23.794999999999998 60-64 20.474999999999998 28.355000000000004 27.935 23.235 65-69 20.765 28.470000000000002 27.250000000000004 23.515 70-74 20.200000000000003 28.549999999999997 27.42 23.830000000000002 75-79 19.950000000000003 28.244999999999997 27.905 23.9 80-84 20.275000000000002 28.01 28.075 23.64 85-89 20.435 28.025 27.900000000000002 23.64 90-94 21.295 27.915 27.115000000000002 23.674999999999997 95-99 20.794999999999998 27.950000000000003 27.72 23.535 100-104 20.880000000000003 28.585 27.029999999999998 23.505000000000003 105-109 20.465 28.235 27.355 23.945 110-114 20.655 28.470000000000002 27.32 23.555 115-119 21.33 28.835 26.729999999999997 23.105 120-124 21.485000000000003 28.29 26.93 23.294999999999998 125-129 21.085 28.000000000000004 27.455000000000002 23.46 130-134 21.295 29.054999999999996 26.419999999999998 23.23 135-139 21.36 28.53 26.105 24.005000000000003 140-144 21.73 28.03 26.490000000000002 23.75 145-149 21.775 28.235 26.405 23.585 150-151 21.3 28.287499999999998 27.0 23.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 2.0 19 2.0 20 1.5 21 1.5 22 0.5 23 3.0 24 4.0 25 2.0 26 2.5 27 7.0 28 11.0 29 12.5 30 15.0 31 22.0 32 36.5 33 48.0 34 65.5 35 77.0 36 80.0 37 105.0 38 116.0 39 133.0 40 171.0 41 197.5 42 222.5 43 247.5 44 269.5 45 269.0 46 255.5 47 263.5 48 241.0 49 203.5 50 201.0 51 167.5 52 119.5 53 100.5 54 81.0 55 58.0 56 45.5 57 40.0 58 26.5 59 19.0 60 17.0 61 10.5 62 7.5 63 4.5 64 3.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.25 #Duplication Level Percentage of deduplicated Percentage of total 1 91.31506849315069 83.325 2 7.917808219178083 14.45 3 0.6575342465753425 1.7999999999999998 4 0.08219178082191782 0.3 5 0.0273972602739726 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.7625000000000002 0.0 0.0 0.0 0.0 98-99 2.0250000000000004 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.7125000000000004 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.6125 0.0 0.0 0.0 0.0 108-109 4.0625 0.0 0.0 0.0 0.0 110-111 4.5125 0.0 0.0 0.0 0.0 112-113 5.137499999999999 0.0 0.0 0.0 0.0 114-115 5.4625 0.0 0.0 0.0 0.0 116-117 5.9125 0.0 0.0 0.0 0.0 118-119 6.387499999999999 0.0 0.0 0.0 0.0 120-121 7.125 0.0 0.0 0.0 0.0 122-123 7.6 0.0 0.0 0.0 0.0 124-125 8.375 0.0 0.0 0.0 0.0 126-127 9.100000000000001 0.0 0.0 0.0 0.0 128-129 9.7375 0.0 0.0 0.0 0.0 130-131 10.55 0.0 0.0 0.0 0.0 132-133 11.1125 0.0 0.0 0.0 0.0 134-135 11.5125 0.0 0.0 0.0 0.0 136-137 12.025 0.0 0.0 0.0 0.0 138-139 12.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTGG 10 0.006830828 145.0 5 >>END_MODULE SRR12917502 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917502_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32 37.0 37.0 37.0 37.0 37.0 2 36.2045 37.0 37.0 37.0 37.0 37.0 3 36.1755 37.0 37.0 37.0 37.0 37.0 4 36.309 37.0 37.0 37.0 37.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 36.29 37.0 37.0 37.0 37.0 37.0 7 36.289 37.0 37.0 37.0 37.0 37.0 8 36.3485 37.0 37.0 37.0 37.0 37.0 9 36.3415 37.0 37.0 37.0 37.0 37.0 10-14 36.3596 37.0 37.0 37.0 37.0 37.0 15-19 36.2883 37.0 37.0 37.0 37.0 37.0 20-24 36.2659 37.0 37.0 37.0 37.0 37.0 25-29 36.145700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1343 37.0 37.0 37.0 37.0 37.0 35-39 36.1101 37.0 37.0 37.0 37.0 37.0 40-44 36.088499999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.956 37.0 37.0 37.0 37.0 37.0 50-54 36.0344 37.0 37.0 37.0 37.0 37.0 55-59 35.9969 37.0 37.0 37.0 37.0 37.0 60-64 35.991099999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9423 37.0 37.0 37.0 37.0 37.0 70-74 35.9261 37.0 37.0 37.0 37.0 37.0 75-79 35.8726 37.0 37.0 37.0 37.0 37.0 80-84 35.8994 37.0 37.0 37.0 37.0 37.0 85-89 35.899800000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.9318 37.0 37.0 37.0 37.0 37.0 95-99 35.897400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.7769 37.0 37.0 37.0 37.0 37.0 105-109 35.7748 37.0 37.0 37.0 37.0 37.0 110-114 35.781499999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.604499999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.5448 37.0 37.0 37.0 37.0 37.0 125-129 35.4619 37.0 37.0 37.0 37.0 37.0 130-134 35.3918 37.0 37.0 37.0 37.0 37.0 135-139 35.346700000000006 37.0 37.0 37.0 34.6 37.0 140-144 35.084199999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.8209 37.0 37.0 37.0 25.0 37.0 150-151 34.386250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 2.0 16 1.0 17 1.0 18 4.0 19 2.0 20 3.0 21 0.0 22 1.0 23 5.0 24 9.0 25 4.0 26 6.0 27 12.0 28 19.0 29 14.0 30 31.0 31 42.0 32 52.0 33 117.0 34 231.0 35 567.0 36 2650.0 37 221.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2 26.75 8.55 24.5 2 26.3 24.975 34.325 14.399999999999999 3 20.075000000000003 27.375 34.675 17.875 4 23.925 32.275 24.25 19.55 5 25.275 38.3 19.975 16.45 6 20.325 39.65 20.9 19.125 7 20.3 22.650000000000002 39.1 17.95 8 18.65 25.275 32.0 24.075 9 21.125 23.0 30.8 25.074999999999996 10-14 22.595000000000002 29.685 26.85 20.87 15-19 22.875 28.09 28.144999999999996 20.89 20-24 22.314999999999998 28.185 27.944999999999997 21.555 25-29 22.46 28.475 28.13 20.935000000000002 30-34 22.58 28.439999999999998 27.505000000000003 21.475 35-39 22.56 27.779999999999998 28.315 21.345 40-44 22.225 28.68 27.925 21.17 45-49 22.305 27.92 28.42 21.355 50-54 22.865 27.73 28.050000000000004 21.355 55-59 23.169999999999998 28.194999999999997 27.224999999999998 21.41 60-64 22.95 27.794999999999998 27.83 21.425 65-69 22.715 27.79 27.935 21.560000000000002 70-74 23.555 27.485 27.450000000000003 21.51 75-79 23.195 28.42 27.52 20.865000000000002 80-84 23.005 28.435 26.66 21.9 85-89 23.01 27.72 27.555000000000003 21.715 90-94 23.544999999999998 27.82 27.595 21.04 95-99 23.294999999999998 28.470000000000002 27.11 21.125 100-104 24.07 28.03 26.955000000000002 20.945 105-109 24.349999999999998 28.110000000000003 26.729999999999997 20.810000000000002 110-114 23.945 28.42 27.48 20.155 115-119 24.55 28.060000000000002 26.46 20.93 120-124 24.560000000000002 28.994999999999997 26.174999999999997 20.27 125-129 25.174999999999997 28.26 26.345000000000002 20.22 130-134 25.759999999999998 28.065 26.605 19.57 135-139 25.755 28.225 26.705000000000002 19.314999999999998 140-144 26.82 27.47 26.009999999999998 19.7 145-149 27.605 27.575 25.509999999999998 19.31 150-151 27.0625 28.3375 25.587500000000002 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.0 23 1.0 24 2.0 25 6.0 26 9.0 27 9.5 28 8.0 29 8.0 30 15.5 31 27.5 32 39.0 33 47.0 34 63.0 35 71.5 36 77.0 37 99.5 38 133.0 39 158.5 40 176.5 41 218.0 42 249.5 43 264.5 44 267.0 45 265.5 46 258.0 47 250.0 48 234.5 49 206.5 50 163.0 51 121.5 52 105.5 53 95.0 54 80.0 55 58.0 56 50.0 57 41.0 58 28.5 59 24.0 60 21.0 61 11.0 62 5.0 63 3.5 64 1.5 65 1.0 66 2.0 67 3.5 68 3.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.49110807113543 83.6 2 7.7701778385772915 14.2 3 0.6566347469220246 1.7999999999999998 4 0.05471956224350205 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027359781121751026 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 1.95 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 2.9749999999999996 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 4.0 0.0 0.0 0.0 0.0 110-111 4.475 0.0 0.0 0.0 0.0 112-113 5.112500000000001 0.0 0.0 0.0 0.0 114-115 5.4375 0.0 0.0 0.0 0.0 116-117 5.887499999999999 0.0 0.0 0.0 0.0 118-119 6.35 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.575 0.0 0.0 0.0 0.0 124-125 8.350000000000001 0.0 0.0 0.0 0.0 126-127 9.0875 0.0 0.0 0.0 0.0 128-129 9.7375 0.0 0.0 0.0 0.0 130-131 10.55 0.0 0.0 0.0 0.0 132-133 11.1125 0.0 0.0 0.0 0.0 134-135 11.525 0.0 0.0 0.0 0.0 136-137 12.0625 0.0 0.0 0.0 0.0 138-139 12.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATTA 10 0.006830828 145.0 9 GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609485 spots for SRR12917502.sra Written 609485 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra Read 609480 spots for SRR12917502.sra Written 609480 spots for SRR12917502.sra SRR ids: ['SRR12917502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dhzmhetv SRR12917502.sra spots: 12189605 blocks: [[1, 609480], [609481, 1218960], [1218961, 1828440], [1828441, 2437920], [2437921, 3047400], [3047401, 3656880], [3656881, 4266360], [4266361, 4875840], [4875841, 5485320], [5485321, 6094800], [6094801, 6704280], [6704281, 7313760], [7313761, 7923240], [7923241, 8532720], [8532721, 9142200], [9142201, 9751680], [9751681, 10361160], [10361161, 10970640], [10970641, 11580120], [11580121, 12189605]] SRR12917502 file size 4120860 SRR12917502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917502 SRR12917502_1.fastq SRR12917502_2.fastq Input file: SRR12917502_1.fastq Paired file: SRR12917502_2.fastq trimmed: SRR12917502-trimmed-pair1.fastq, SRR12917502-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:44:04 2025 >> started Thu Feb 13 06:44:18 2025 >> done (13.655s) 12189605 read pairs processed; of these: 209 ( 0.00%) short read pairs filtered out after trimming by size control 1438 ( 0.01%) empty read pairs filtered out after trimming by size control 12187958 (99.99%) read pairs available; of these: 2163869 (17.75%) trimmed read pairs available after processing 10024089 (82.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 15 0.00% 20 14 0.00% 21 16 0.00% 22 28 0.00% 23 17 0.00% 24 11 0.00% 25 23 0.00% 26 32 0.00% 27 20 0.00% 28 32 0.00% 29 30 0.00% 30 21 0.00% 31 48 0.00% 32 27 0.00% 33 40 0.00% 34 30 0.00% 35 30 0.00% 36 37 0.00% 37 29 0.00% 38 40 0.00% 39 34 0.00% 40 40 0.00% 41 53 0.00% 42 48 0.00% 43 55 0.00% 44 48 0.00% 45 54 0.00% 46 52 0.00% 47 59 0.00% 48 82 0.00% 49 100 0.00% 50 106 0.00% 51 132 0.00% 52 159 0.00% 53 166 0.00% 54 198 0.00% 55 186 0.00% 56 236 0.00% 57 256 0.00% 58 314 0.00% 59 388 0.00% 60 408 0.00% 61 477 0.00% 62 593 0.00% 63 701 0.01% 64 791 0.01% 65 834 0.01% 66 972 0.01% 67 1109 0.01% 68 1188 0.01% 69 1386 0.01% 70 1670 0.01% 71 1920 0.02% 72 2180 0.02% 73 2463 0.02% 74 2931 0.02% 75 3164 0.03% 76 3654 0.03% 77 3867 0.03% 78 4258 0.03% 79 4729 0.04% 80 5216 0.04% 81 5635 0.05% 82 6549 0.05% 83 7222 0.06% 84 8041 0.07% 85 8849 0.07% 86 9529 0.08% 87 9928 0.08% 88 10584 0.09% 89 11310 0.09% 90 11842 0.10% 91 12911 0.11% 92 13640 0.11% 93 14979 0.12% 94 16070 0.13% 95 17346 0.14% 96 17947 0.15% 97 18837 0.15% 98 19192 0.16% 99 20100 0.16% 100 20728 0.17% 101 21196 0.17% 102 22116 0.18% 103 23056 0.19% 104 24171 0.20% 105 25136 0.21% 106 26229 0.22% 107 27222 0.22% 108 27317 0.22% 109 28116 0.23% 110 28192 0.23% 111 28816 0.24% 112 30144 0.25% 113 30221 0.25% 114 31326 0.26% 115 31961 0.26% 116 33390 0.27% 117 33992 0.28% 118 34993 0.29% 119 35100 0.29% 120 36010 0.30% 121 36168 0.30% 122 36727 0.30% 123 37254 0.31% 124 37522 0.31% 125 38307 0.31% 126 40252 0.33% 127 39997 0.33% 128 40465 0.33% 129 40920 0.34% 130 41506 0.34% 131 41195 0.34% 132 41432 0.34% 133 41951 0.34% 134 41636 0.34% 135 42384 0.35% 136 43247 0.35% 137 43382 0.36% 138 43643 0.36% 139 45028 0.37% 140 44010 0.36% 141 44889 0.37% 142 45263 0.37% 143 45076 0.37% 144 45538 0.37% 145 45480 0.37% 146 45287 0.37% 147 46007 0.38% 148 46646 0.38% 149 46899 0.38% 150 47987 0.39% 151 10024089 82.25% 12187958 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=336.64 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=1.15 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=55.17 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATC SRR12917502 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:44:57 Started mapping on | Feb 13 06:44:57 Finished on | Feb 13 06:46:14 Mapping speed, Million of reads per hour | 569.83 Number of input reads | 12187958 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11332059 Uniquely mapped reads % | 92.98% Average mapped length | 290.19 Number of splices: Total | 11037616 Number of splices: Annotated (sjdb) | 10800095 Number of splices: GT/AG | 10805378 Number of splices: GC/AG | 186617 Number of splices: AT/AC | 6715 Number of splices: Non-canonical | 38906 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273733 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 19977 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 582166 582166 582166 N_multimapping 273733 273733 273733 N_noFeature 413054 11185953 465706 N_ambiguous 172462 542 78687 UnstrandedReadsAssigned:10746543 PositiveStrandReadsAssigned:145564 NegativeStrandReadsAssigned:10787666 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917502 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917502-trimmed-pair1.fastq SRR12917502-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,187,958 reads, 10,813,973 reads pseudoaligned [quant] estimated average fragment length: 241.517 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR12917502.ke.tsv 34699 SRR12917502.se.tsv 87100 total ==> SRR12917502.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.48 276 14.4817 Potri.005G024800.1.v4.1 1035 794.483 120 14.0868 Potri.004G059700.1.v4.1 961 720.749 31 4.01138 Potri.007G009000.2.v4.1 1416 1175.48 0 0 Potri.003G141000.2.v4.1 2943 2702.48 503.428 17.3736 Potri.016G087400.1.v4.1 270 99.129 545.464 513.194 Potri.015G069301.1.v4.1 564 339.958 0 0 Potri.010G195200.1.v4.1 1773 1532.48 8 0.486867 Potri.012G127500.1.v4.1 977 736.636 115 14.56 ==> SRR12917502.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 173 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 116 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12917502 completed mapping pipeline successfully