Starting /dee2/code/volunteer_pipeline.sh SRR12917503 current disk space = 3052630802432 free memory = 1582203276 SRR12917503 SRAfilesize 60fb49e8003ff6db353601c712ec6d27 SRR12917503.sra SRR12917503.sra file validated SRR12917503 is paired end SRR12917503 is conventional basespace SRR12917503 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5885 37.0 37.0 37.0 37.0 37.0 2 36.5065 37.0 37.0 37.0 37.0 37.0 3 36.673 37.0 37.0 37.0 37.0 37.0 4 36.7 37.0 37.0 37.0 37.0 37.0 5 36.647 37.0 37.0 37.0 37.0 37.0 6 36.731 37.0 37.0 37.0 37.0 37.0 7 36.646 37.0 37.0 37.0 37.0 37.0 8 36.667 37.0 37.0 37.0 37.0 37.0 9 36.676 37.0 37.0 37.0 37.0 37.0 10-14 36.646499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.633799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.598400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.543899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5103 37.0 37.0 37.0 37.0 37.0 35-39 36.5053 37.0 37.0 37.0 37.0 37.0 40-44 36.52890000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4529 37.0 37.0 37.0 37.0 37.0 50-54 36.4629 37.0 37.0 37.0 37.0 37.0 55-59 36.4159 37.0 37.0 37.0 37.0 37.0 60-64 36.3784 37.0 37.0 37.0 37.0 37.0 65-69 36.306200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3919 37.0 37.0 37.0 37.0 37.0 75-79 36.315 37.0 37.0 37.0 37.0 37.0 80-84 36.3335 37.0 37.0 37.0 37.0 37.0 85-89 36.2967 37.0 37.0 37.0 37.0 37.0 90-94 36.3515 37.0 37.0 37.0 37.0 37.0 95-99 36.2478 37.0 37.0 37.0 37.0 37.0 100-104 36.17900000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1346 37.0 37.0 37.0 37.0 37.0 110-114 36.1844 37.0 37.0 37.0 37.0 37.0 115-119 36.1186 37.0 37.0 37.0 37.0 37.0 120-124 36.049400000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.9653 37.0 37.0 37.0 37.0 37.0 130-134 35.8909 37.0 37.0 37.0 37.0 37.0 135-139 35.7947 37.0 37.0 37.0 37.0 37.0 140-144 35.59349999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.4915 37.0 37.0 37.0 37.0 37.0 150-151 35.285 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 4.0 23 1.0 24 2.0 25 3.0 26 4.0 27 6.0 28 12.0 29 17.0 30 14.0 31 22.0 32 49.0 33 63.0 34 101.0 35 349.0 36 3003.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.725 12.425 7.000000000000001 39.85 2 20.175 12.125 37.15 30.55 3 18.275 15.225 26.200000000000003 40.300000000000004 4 20.849999999999998 22.35 25.174999999999997 31.624999999999996 5 25.624999999999996 28.375 24.349999999999998 21.65 6 20.325 32.525 22.7 24.45 7 15.475 28.000000000000004 40.425 16.1 8 16.650000000000002 26.5 33.7 23.150000000000002 9 18.65 23.9 34.675 22.775000000000002 10-14 19.45 30.43 26.91 23.21 15-19 19.939999999999998 28.544999999999998 27.845 23.669999999999998 20-24 20.435 27.83 27.815 23.919999999999998 25-29 19.86 28.544999999999998 27.16 24.435000000000002 30-34 19.52 28.82 27.665 23.995 35-39 20.465 28.305000000000003 27.67 23.56 40-44 19.73 28.050000000000004 27.915 24.305 45-49 19.895 28.115000000000002 28.035 23.955000000000002 50-54 20.630000000000003 28.315 27.42 23.635 55-59 20.115 28.994999999999997 27.41 23.48 60-64 20.195 27.965 27.584999999999997 24.255 65-69 20.54 27.900000000000002 27.96 23.599999999999998 70-74 20.5 27.77 27.88 23.849999999999998 75-79 20.085 27.925 27.79 24.2 80-84 19.99 28.389999999999997 27.55 24.07 85-89 20.43 27.975 27.505000000000003 24.09 90-94 20.53 27.935 27.439999999999998 24.095 95-99 21.02 28.025 27.215 23.74 100-104 20.865000000000002 28.52 27.450000000000003 23.165 105-109 21.3 27.785 26.900000000000002 24.015 110-114 21.305 27.905 27.405 23.385 115-119 21.38 28.74 26.605 23.275000000000002 120-124 21.095 28.1 26.650000000000002 24.154999999999998 125-129 21.525 27.88 26.605 23.990000000000002 130-134 21.5 28.52 25.71 24.27 135-139 21.375 27.87 26.33 24.425 140-144 21.955 27.589999999999996 26.57 23.885 145-149 21.95 27.07 26.44 24.54 150-151 22.7125 26.9625 25.974999999999998 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 0.5 24 1.0 25 5.5 26 7.0 27 5.0 28 11.0 29 16.5 30 14.0 31 18.5 32 27.5 33 37.5 34 46.5 35 66.5 36 88.0 37 98.0 38 121.0 39 136.0 40 177.5 41 229.5 42 231.5 43 225.0 44 240.5 45 255.5 46 264.0 47 265.0 48 254.0 49 228.0 50 190.5 51 151.0 52 121.0 53 111.0 54 93.0 55 68.5 56 49.0 57 36.5 58 26.0 59 19.0 60 15.0 61 10.5 62 9.5 63 5.0 64 2.0 65 5.0 66 5.5 67 3.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.50124619219054 81.69999999999999 2 8.418720576017725 15.2 3 0.9415674328440876 2.55 4 0.11077263915812793 0.4 5 0.0 0.0 6 0.027693159789531983 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTCGACATAAGATCATCTCTCTGCATTTCAAGCTCCTTTTCTTTGTTC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 90-91 1.4125 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.8875000000000002 0.0 0.0 0.0 0.0 96-97 2.3375000000000004 0.0 0.0 0.0 0.0 98-99 2.75 0.0 0.0 0.0 0.0 100-101 3.1375 0.0 0.0 0.0 0.0 102-103 3.5125 0.0 0.0 0.0 0.0 104-105 3.9375 0.0 0.0 0.0 0.0 106-107 4.5125 0.0 0.0 0.0 0.0 108-109 5.3 0.0 0.0 0.0 0.0 110-111 5.8125 0.0 0.0 0.0 0.0 112-113 6.375 0.0 0.0 0.0 0.0 114-115 6.9 0.0 0.0 0.0 0.0 116-117 7.55 0.0 0.0 0.0 0.0 118-119 8.0875 0.0 0.0 0.0 0.0 120-121 8.825 0.0 0.0 0.0 0.0 122-123 9.8125 0.0 0.0 0.0 0.0 124-125 10.625 0.0 0.0 0.0 0.0 126-127 11.475000000000001 0.0 0.0 0.0 0.0 128-129 12.2125 0.0 0.0 0.0 0.0 130-131 13.1125 0.0 0.0 0.0 0.0 132-133 13.8875 0.0 0.0 0.0 0.0 134-135 14.7625 0.0 0.0 0.0 0.0 136-137 15.7125 0.0 0.0 0.0 0.0 138-139 16.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917503 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917503_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5175 37.0 37.0 37.0 37.0 37.0 2 36.2855 37.0 37.0 37.0 37.0 37.0 3 36.34 37.0 37.0 37.0 37.0 37.0 4 36.388 37.0 37.0 37.0 37.0 37.0 5 36.424 37.0 37.0 37.0 37.0 37.0 6 36.325 37.0 37.0 37.0 37.0 37.0 7 36.3675 37.0 37.0 37.0 37.0 37.0 8 36.506 37.0 37.0 37.0 37.0 37.0 9 36.504 37.0 37.0 37.0 37.0 37.0 10-14 36.418 37.0 37.0 37.0 37.0 37.0 15-19 36.370999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3427 37.0 37.0 37.0 37.0 37.0 25-29 36.2564 37.0 37.0 37.0 37.0 37.0 30-34 36.20739999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.1706 37.0 37.0 37.0 37.0 37.0 40-44 36.200199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1065 37.0 37.0 37.0 37.0 37.0 50-54 36.1042 37.0 37.0 37.0 37.0 37.0 55-59 36.0694 37.0 37.0 37.0 37.0 37.0 60-64 36.0516 37.0 37.0 37.0 37.0 37.0 65-69 36.0442 37.0 37.0 37.0 37.0 37.0 70-74 36.031099999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.010999999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.98879999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9679 37.0 37.0 37.0 37.0 37.0 90-94 35.977999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.9161 37.0 37.0 37.0 37.0 37.0 100-104 35.876 37.0 37.0 37.0 37.0 37.0 105-109 35.783699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7889 37.0 37.0 37.0 37.0 37.0 115-119 35.7004 37.0 37.0 37.0 37.0 37.0 120-124 35.5404 37.0 37.0 37.0 37.0 37.0 125-129 35.4462 37.0 37.0 37.0 37.0 37.0 130-134 35.3048 37.0 37.0 37.0 34.6 37.0 135-139 35.1514 37.0 37.0 37.0 27.4 37.0 140-144 34.860699999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.4577 37.0 37.0 37.0 25.0 37.0 150-151 34.046 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 3.0 16 1.0 17 2.0 18 1.0 19 3.0 20 2.0 21 3.0 22 3.0 23 5.0 24 2.0 25 5.0 26 2.0 27 9.0 28 17.0 29 16.0 30 28.0 31 40.0 32 60.0 33 115.0 34 216.0 35 591.0 36 2681.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.375 26.0 10.725 26.900000000000002 2 27.275 27.450000000000003 29.725 15.55 3 21.4 27.675 32.25 18.675 4 24.15 34.575 23.599999999999998 17.675 5 25.974999999999998 36.95 20.775 16.3 6 20.95 40.550000000000004 21.4 17.1 7 22.7 22.650000000000002 35.949999999999996 18.7 8 20.825 27.3 27.175 24.7 9 21.325 25.75 29.525000000000002 23.400000000000002 10-14 22.86 29.145 26.700000000000003 21.295 15-19 23.275000000000002 28.12 28.08 20.525 20-24 23.625 28.27 27.105 21.0 25-29 23.13 28.735 27.515 20.62 30-34 23.44 27.255000000000003 27.950000000000003 21.355 35-39 23.13 28.225 27.42 21.224999999999998 40-44 23.755000000000003 28.7 27.169999999999998 20.375 45-49 23.169999999999998 27.96 28.055000000000003 20.815 50-54 23.905 27.51 27.834999999999997 20.75 55-59 23.549999999999997 27.655 27.58 21.215 60-64 23.615 27.474999999999998 27.985 20.925 65-69 23.535 27.115000000000002 27.925 21.425 70-74 24.3 27.51 27.355 20.835 75-79 23.69 28.310000000000002 27.279999999999998 20.72 80-84 23.68 27.905 27.139999999999997 21.275 85-89 24.58 27.800000000000004 27.04 20.580000000000002 90-94 24.224999999999998 27.61 27.35 20.815 95-99 24.67 27.33 27.115000000000002 20.885 100-104 24.815 28.105000000000004 26.365 20.715 105-109 24.34 27.834999999999997 27.54 20.285 110-114 25.195 27.47 26.795 20.54 115-119 25.665 28.4 25.755 20.18 120-124 26.334999999999997 28.139999999999997 25.88 19.645000000000003 125-129 26.865 27.355 26.655 19.125 130-134 27.544999999999998 28.09 25.805 18.56 135-139 27.694999999999997 27.205000000000002 26.415 18.685 140-144 28.610000000000003 26.865 25.779999999999998 18.745 145-149 29.93 26.419999999999998 25.650000000000002 18.0 150-151 30.425 25.7625 25.7375 18.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 1.5 22 3.0 23 3.0 24 4.0 25 4.5 26 3.5 27 7.0 28 9.5 29 7.5 30 12.0 31 19.0 32 25.0 33 35.5 34 47.0 35 57.0 36 69.5 37 93.0 38 124.0 39 152.5 40 188.0 41 232.5 42 252.5 43 274.0 44 276.5 45 259.5 46 259.0 47 252.5 48 237.5 49 202.0 50 166.5 51 151.0 52 132.0 53 103.0 54 76.0 55 63.0 56 53.5 57 35.0 58 20.0 59 16.0 60 16.5 61 11.5 62 7.5 63 6.0 64 4.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 1.5 99 1.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.70735090152566 81.75 2 8.099861303744799 14.6 3 0.9431345353675451 2.55 4 0.13869625520110956 0.5 5 0.08321775312066575 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027739251040221912 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CCGGAGCAAATAAGATCAAAGATTGTAGAAGGGCGTATAAGGAAGAGGCT 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.0750000000000002 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 90-91 1.5125000000000002 0.0 0.0 0.0 0.0 92-93 1.7125 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.4124999999999996 0.0 0.0 0.0 0.0 98-99 2.8125 0.0 0.0 0.0 0.0 100-101 3.1875 0.0 0.0 0.0 0.0 102-103 3.5625 0.0 0.0 0.0 0.0 104-105 3.9875 0.0 0.0 0.0 0.0 106-107 4.5375 0.0 0.0 0.0 0.0 108-109 5.325 0.0 0.0 0.0 0.0 110-111 5.8375 0.0 0.0 0.0 0.0 112-113 6.4 0.0 0.0 0.0 0.0 114-115 6.925000000000001 0.0 0.0 0.0 0.0 116-117 7.55 0.0 0.0 0.0 0.0 118-119 8.0875 0.0 0.0 0.0 0.0 120-121 8.85 0.0 0.0 0.0 0.0 122-123 9.85 0.0 0.0 0.0 0.0 124-125 10.649999999999999 0.0 0.0 0.0 0.0 126-127 11.5 0.0 0.0 0.0 0.0 128-129 12.2375 0.0 0.0 0.0 0.0 130-131 13.1375 0.0 0.0 0.0 0.0 132-133 13.95 0.0 0.0 0.0 0.0 134-135 14.8625 0.0 0.0 0.0 0.0 136-137 15.8 0.0 0.0 0.0 0.0 138-139 16.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATGG 10 0.006830828 145.0 9 >>END_MODULE Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828310 spots for SRR12917503.sra Written 828310 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra Read 828297 spots for SRR12917503.sra Written 828297 spots for SRR12917503.sra SRR ids: ['SRR12917503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x_sj7mna SRR12917503.sra spots: 16565953 blocks: [[1, 828297], [828298, 1656594], [1656595, 2484891], [2484892, 3313188], [3313189, 4141485], [4141486, 4969782], [4969783, 5798079], [5798080, 6626376], [6626377, 7454673], [7454674, 8282970], [8282971, 9111267], [9111268, 9939564], [9939565, 10767861], [10767862, 11596158], [11596159, 12424455], [12424456, 13252752], [13252753, 14081049], [14081050, 14909346], [14909347, 15737643], [15737644, 16565953]] SRR12917503 file size 5608135 SRR12917503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917503 SRR12917503_1.fastq SRR12917503_2.fastq Input file: SRR12917503_1.fastq Paired file: SRR12917503_2.fastq trimmed: SRR12917503-trimmed-pair1.fastq, SRR12917503-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:57:29 2025 >> started Thu Feb 13 09:06:30 2025 >> done (540.660s) 16565953 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 4792 ( 0.03%) empty read pairs filtered out after trimming by size control 16561049 (99.97%) read pairs available; of these: 3527100 (21.30%) trimmed read pairs available after processing 13033949 (78.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 16 0.00% 21 8 0.00% 22 6 0.00% 23 9 0.00% 24 4 0.00% 25 11 0.00% 26 14 0.00% 27 9 0.00% 28 17 0.00% 29 19 0.00% 30 15 0.00% 31 18 0.00% 32 24 0.00% 33 27 0.00% 34 21 0.00% 35 22 0.00% 36 32 0.00% 37 31 0.00% 38 36 0.00% 39 41 0.00% 40 44 0.00% 41 58 0.00% 42 49 0.00% 43 89 0.00% 44 60 0.00% 45 78 0.00% 46 113 0.00% 47 116 0.00% 48 116 0.00% 49 176 0.00% 50 192 0.00% 51 259 0.00% 52 285 0.00% 53 316 0.00% 54 369 0.00% 55 396 0.00% 56 440 0.00% 57 561 0.00% 58 660 0.00% 59 725 0.00% 60 888 0.01% 61 1136 0.01% 62 1349 0.01% 63 1594 0.01% 64 1723 0.01% 65 1987 0.01% 66 2145 0.01% 67 2556 0.02% 68 2781 0.02% 69 3122 0.02% 70 3648 0.02% 71 4266 0.03% 72 5020 0.03% 73 5604 0.03% 74 6366 0.04% 75 7118 0.04% 76 7739 0.05% 77 8569 0.05% 78 9150 0.06% 79 10210 0.06% 80 11127 0.07% 81 12176 0.07% 82 13359 0.08% 83 14835 0.09% 84 16401 0.10% 85 17970 0.11% 86 19357 0.12% 87 20091 0.12% 88 21244 0.13% 89 22032 0.13% 90 23233 0.14% 91 24124 0.15% 92 25119 0.15% 93 27178 0.16% 94 29133 0.18% 95 31309 0.19% 96 32684 0.20% 97 33936 0.20% 98 34661 0.21% 99 35384 0.21% 100 36631 0.22% 101 36747 0.22% 102 37951 0.23% 103 39230 0.24% 104 40360 0.24% 105 42771 0.26% 106 44049 0.27% 107 45744 0.28% 108 46618 0.28% 109 46722 0.28% 110 47322 0.29% 111 47621 0.29% 112 48405 0.29% 113 49104 0.30% 114 50387 0.30% 115 52122 0.31% 116 53553 0.32% 117 55582 0.34% 118 56488 0.34% 119 57182 0.35% 120 57658 0.35% 121 58038 0.35% 122 58407 0.35% 123 58658 0.35% 124 58973 0.36% 125 59102 0.36% 126 61956 0.37% 127 62653 0.38% 128 63276 0.38% 129 65034 0.39% 130 65216 0.39% 131 64766 0.39% 132 64771 0.39% 133 65466 0.40% 134 64254 0.39% 135 64926 0.39% 136 66317 0.40% 137 67152 0.41% 138 67784 0.41% 139 69590 0.42% 140 69352 0.42% 141 69596 0.42% 142 69643 0.42% 143 68742 0.42% 144 69393 0.42% 145 69661 0.42% 146 69463 0.42% 147 69745 0.42% 148 71382 0.43% 149 70846 0.43% 150 72863 0.44% 151 13033949 78.70% 16561049 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=16 prefix-density=0.74 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=24.78 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=16 prefix-density=0.62 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=58.58 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.5 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12917503 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:24:53 Started mapping on | Feb 13 10:25:15 Finished on | Feb 13 11:05:41 Mapping speed, Million of reads per hour | 24.58 Number of input reads | 16561049 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15785020 Uniquely mapped reads % | 95.31% Average mapped length | 288.11 Number of splices: Total | 15212761 Number of splices: Annotated (sjdb) | 14914095 Number of splices: GT/AG | 14891471 Number of splices: GC/AG | 261757 Number of splices: AT/AC | 9058 Number of splices: Non-canonical | 50475 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355157 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 57669 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 420872 420872 420872 N_multimapping 355157 355157 355157 N_noFeature 511032 15520790 609843 N_ambiguous 273452 1234 107187 UnstrandedReadsAssigned:15000536 PositiveStrandReadsAssigned:262996 NegativeStrandReadsAssigned:15067990 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR12917503 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917503-trimmed-pair1.fastq SRR12917503-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,561,049 reads, 15,070,653 reads pseudoaligned [quant] estimated average fragment length: 225.357 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR12917503.ke.tsv 34699 SRR12917503.se.tsv 87100 total ==> SRR12917503.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.64 359 11.819 Potri.005G024800.1.v4.1 1035 810.643 373 27.1708 Potri.004G059700.1.v4.1 961 736.71 93 7.45435 Potri.007G009000.2.v4.1 1416 1191.64 0 0 Potri.003G141000.2.v4.1 2943 2718.64 672 14.5962 Potri.016G087400.1.v4.1 270 101.749 804.118 466.675 Potri.015G069301.1.v4.1 564 350.216 0 0 Potri.010G195200.1.v4.1 1773 1548.64 21 0.800739 Potri.012G127500.1.v4.1 977 752.677 268 21.0256 ==> SRR12917503.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 104 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12917503 completed mapping pipeline successfully