Starting /dee2/code/volunteer_pipeline.sh SRR12917504 current disk space = 3053174898688 free memory = 1424017576 SRR12917504 SRAfilesize 3a47f1b6da4cba051e574dd7427bc0bb SRR12917504.sra SRR12917504.sra file validated SRR12917504 is paired end SRR12917504 is conventional basespace SRR12917504 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59225 37.0 37.0 37.0 37.0 37.0 2 36.481 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.6165 37.0 37.0 37.0 37.0 37.0 5 36.6135 37.0 37.0 37.0 37.0 37.0 6 36.6455 37.0 37.0 37.0 37.0 37.0 7 36.5095 37.0 37.0 37.0 37.0 37.0 8 36.5085 37.0 37.0 37.0 37.0 37.0 9 36.6655 37.0 37.0 37.0 37.0 37.0 10-14 36.5795 37.0 37.0 37.0 37.0 37.0 15-19 36.5794 37.0 37.0 37.0 37.0 37.0 20-24 36.546400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.4871 37.0 37.0 37.0 37.0 37.0 30-34 36.501999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4673 37.0 37.0 37.0 37.0 37.0 40-44 36.418899999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4394 37.0 37.0 37.0 37.0 37.0 50-54 36.4159 37.0 37.0 37.0 37.0 37.0 55-59 36.3667 37.0 37.0 37.0 37.0 37.0 60-64 36.352199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3516 37.0 37.0 37.0 37.0 37.0 70-74 36.3113 37.0 37.0 37.0 37.0 37.0 75-79 36.3032 37.0 37.0 37.0 37.0 37.0 80-84 36.3399 37.0 37.0 37.0 37.0 37.0 85-89 36.2725 37.0 37.0 37.0 37.0 37.0 90-94 36.289199999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2104 37.0 37.0 37.0 37.0 37.0 100-104 36.1395 37.0 37.0 37.0 37.0 37.0 105-109 36.1581 37.0 37.0 37.0 37.0 37.0 110-114 36.157300000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.002100000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.011199999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9582 37.0 37.0 37.0 37.0 37.0 130-134 35.9209 37.0 37.0 37.0 37.0 37.0 135-139 35.8115 37.0 37.0 37.0 37.0 37.0 140-144 35.5862 37.0 37.0 37.0 37.0 37.0 145-149 35.515699999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.285 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 3.0 25 4.0 26 2.0 27 9.0 28 8.0 29 23.0 30 20.0 31 30.0 32 54.0 33 69.0 34 127.0 35 312.0 36 3026.0 37 310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.08377094273568 12.878219554888723 4.47611902975744 47.56189047261816 2 15.950000000000001 10.825 46.9 26.325 3 15.5 15.85 28.125 40.525 4 22.275 22.125 24.8 30.8 5 24.45 30.349999999999998 24.425 20.775 6 20.4 31.95 24.6 23.05 7 16.0 28.749999999999996 40.275 14.975 8 15.024999999999999 24.875 35.75 24.349999999999998 9 17.05 23.200000000000003 36.525 23.225 10-14 19.33 30.19 28.12 22.36 15-19 20.165 27.584999999999997 28.349999999999998 23.9 20-24 20.86 28.249999999999996 27.67 23.22 25-29 19.585 28.365000000000002 28.505000000000003 23.544999999999998 30-34 19.915 28.88 26.575 24.63 35-39 20.45 28.060000000000002 27.71 23.78 40-44 20.169999999999998 28.96 27.85 23.02 45-49 20.26 28.050000000000004 27.63 24.060000000000002 50-54 20.945 28.475 27.425 23.155 55-59 20.665 28.38 27.63 23.325000000000003 60-64 20.315 28.125 27.62 23.94 65-69 20.580000000000002 27.85 28.095 23.474999999999998 70-74 20.349999999999998 28.360000000000003 27.750000000000004 23.54 75-79 20.48 28.660000000000004 27.395000000000003 23.465 80-84 20.705000000000002 28.32 27.595 23.380000000000003 85-89 20.94 28.134999999999998 27.63 23.294999999999998 90-94 20.669999999999998 28.26 27.43 23.64 95-99 20.705000000000002 27.985 27.68 23.630000000000003 100-104 20.990000000000002 28.799999999999997 27.075 23.135 105-109 21.05 28.28 26.900000000000002 23.77 110-114 20.745 28.575 27.150000000000002 23.53 115-119 21.755 28.715000000000003 26.16 23.369999999999997 120-124 20.93 28.18 27.060000000000002 23.830000000000002 125-129 21.325 27.644999999999996 26.740000000000002 24.29 130-134 21.17 28.95 26.38 23.5 135-139 20.955 28.255000000000003 26.405 24.385 140-144 21.634999999999998 28.175 26.165 24.025 145-149 21.310000000000002 28.560000000000002 25.665 24.465 150-151 20.962500000000002 27.525 26.937499999999996 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 4.0 25 5.0 26 4.0 27 8.0 28 14.0 29 18.5 30 20.5 31 27.5 32 43.0 33 49.0 34 51.0 35 58.5 36 83.5 37 104.5 38 124.0 39 153.0 40 169.0 41 206.5 42 227.0 43 230.0 44 249.0 45 275.0 46 272.5 47 239.0 48 222.0 49 217.0 50 197.5 51 162.0 52 120.0 53 102.0 54 87.5 55 58.0 56 48.5 57 37.0 58 34.0 59 32.5 60 16.5 61 6.5 62 6.5 63 6.0 64 2.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81942544459645 83.89999999999999 2 7.22298221614227 13.200000000000001 3 0.7387140902872777 2.025 4 0.13679890560875513 0.5 5 0.08207934336525308 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCCGACGAACCACGAGACTCCACCGTTAGATATCTGAGAAAAAAGGTC 5 0.125 No Hit GTCGTCTTGTCTTCATCATCATAGCCAATCATGGCCAGAGTGTACTTGTG 5 0.125 No Hit GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 1.9625 0.0 0.0 0.0 0.0 100-101 2.3 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.3125 0.0 0.0 0.0 0.0 106-107 3.575 0.0 0.0 0.0 0.0 108-109 4.2875 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 5.175 0.0 0.0 0.0 0.0 114-115 5.6875 0.0 0.0 0.0 0.0 116-117 6.15 0.0 0.0 0.0 0.0 118-119 6.8125 0.0 0.0 0.0 0.0 120-121 7.2625 0.0 0.0 0.0 0.0 122-123 7.949999999999999 0.0 0.0 0.0 0.0 124-125 8.6875 0.0 0.0 0.0 0.0 126-127 9.287500000000001 0.0 0.0 0.0 0.0 128-129 9.725 0.0 0.0 0.0 0.0 130-131 10.6875 0.0 0.0 0.0 0.0 132-133 11.524999999999999 0.0 0.0 0.0 0.0 134-135 12.175 0.0 0.0 0.0 0.0 136-137 12.9875 0.0 0.0 0.0 0.0 138-139 13.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTAC 10 0.006830828 145.0 9 ACATCTA 10 0.006830828 145.0 8 GGGGGGG 50 0.0013298223 29.0 145 >>END_MODULE SRR12917504 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917504_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33425 37.0 37.0 37.0 37.0 37.0 2 36.1975 37.0 37.0 37.0 37.0 37.0 3 36.3035 37.0 37.0 37.0 37.0 37.0 4 36.243 37.0 37.0 37.0 37.0 37.0 5 36.4535 37.0 37.0 37.0 37.0 37.0 6 36.4405 37.0 37.0 37.0 37.0 37.0 7 36.3815 37.0 37.0 37.0 37.0 37.0 8 36.391 37.0 37.0 37.0 37.0 37.0 9 36.4185 37.0 37.0 37.0 37.0 37.0 10-14 36.4125 37.0 37.0 37.0 37.0 37.0 15-19 36.4009 37.0 37.0 37.0 37.0 37.0 20-24 36.3522 37.0 37.0 37.0 37.0 37.0 25-29 36.2567 37.0 37.0 37.0 37.0 37.0 30-34 36.2382 37.0 37.0 37.0 37.0 37.0 35-39 36.202999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1708 37.0 37.0 37.0 37.0 37.0 45-49 36.175 37.0 37.0 37.0 37.0 37.0 50-54 36.05069999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.12839999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.13289999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.089600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.096000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.995999999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0433 37.0 37.0 37.0 37.0 37.0 85-89 36.0347 37.0 37.0 37.0 37.0 37.0 90-94 35.9992 37.0 37.0 37.0 37.0 37.0 95-99 35.951 37.0 37.0 37.0 37.0 37.0 100-104 35.916399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8344 37.0 37.0 37.0 37.0 37.0 110-114 35.856899999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7684 37.0 37.0 37.0 37.0 37.0 120-124 35.6337 37.0 37.0 37.0 37.0 37.0 125-129 35.636 37.0 37.0 37.0 37.0 37.0 130-134 35.4696 37.0 37.0 37.0 37.0 37.0 135-139 35.391999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.0219 37.0 37.0 37.0 25.0 37.0 145-149 34.852 37.0 37.0 37.0 25.0 37.0 150-151 34.30975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 0.0 22 2.0 23 4.0 24 2.0 25 4.0 26 4.0 27 9.0 28 11.0 29 18.0 30 32.0 31 38.0 32 56.0 33 106.0 34 229.0 35 600.0 36 2676.0 37 202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.58314578644661 27.231807951987996 8.902225556389096 31.282820705176295 2 25.974999999999998 25.1 36.05 12.875 3 17.925 27.975 35.275 18.825 4 21.475 33.900000000000006 25.05 19.575 5 25.674999999999997 37.425000000000004 20.5 16.400000000000002 6 19.7 40.550000000000004 22.075 17.675 7 20.925 22.825 38.05 18.2 8 19.075 25.75 30.85 24.325 9 22.275 23.200000000000003 31.75 22.775000000000002 10-14 22.96 28.599999999999998 27.02 21.42 15-19 23.200000000000003 28.415000000000003 26.634999999999998 21.75 20-24 22.66 28.854999999999997 26.935 21.55 25-29 23.535 27.465 27.83 21.17 30-34 23.305 27.865000000000002 27.99 20.84 35-39 22.455 28.325 27.485 21.735 40-44 22.95 28.565 27.994999999999997 20.49 45-49 23.0 27.47 27.834999999999997 21.695 50-54 23.335 27.83 27.42 21.415 55-59 23.200000000000003 26.965 28.24 21.595 60-64 23.405 27.3 28.005000000000003 21.29 65-69 23.005 27.62 27.950000000000003 21.425 70-74 23.0 27.455000000000002 28.1 21.445 75-79 22.155 27.955000000000002 27.62 22.27 80-84 23.175 27.935 26.915 21.975 85-89 23.615 27.215 27.134999999999998 22.035 90-94 23.01 27.634999999999998 27.33 22.025 95-99 23.945 27.47 27.685 20.9 100-104 24.154999999999998 27.975 26.595000000000002 21.275 105-109 24.215 27.505000000000003 27.284999999999997 20.995 110-114 24.6 27.965 27.01 20.424999999999997 115-119 24.224999999999998 28.655 26.515 20.605 120-124 24.64 28.605000000000004 26.87 19.885 125-129 25.369999999999997 28.299999999999997 26.255 20.075000000000003 130-134 25.785000000000004 28.015 26.235000000000003 19.965 135-139 25.605 27.58 26.645000000000003 20.169999999999998 140-144 26.384999999999998 27.12 26.855 19.64 145-149 27.3 27.450000000000003 25.855 19.395 150-151 27.825 28.4125 24.7 19.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.5 24 2.0 25 2.5 26 3.5 27 5.0 28 6.5 29 6.5 30 10.0 31 22.0 32 28.5 33 41.5 34 62.0 35 62.5 36 78.0 37 104.5 38 126.0 39 155.5 40 175.0 41 194.0 42 224.5 43 252.0 44 284.5 45 284.0 46 262.5 47 264.0 48 235.0 49 202.0 50 188.5 51 164.5 52 136.0 53 100.0 54 75.0 55 65.5 56 50.0 57 31.0 58 19.5 59 18.5 60 19.0 61 11.0 62 5.0 63 4.5 64 1.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35790046233342 84.89999999999999 2 6.77182485722056 12.45 3 0.7070981778623878 1.95 4 0.08158825129181398 0.3 5 0.054392167527875984 0.25 6 0.027196083763937992 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit TGTTTACAAGCTGGTGGAGAAACTTCGGGCCATTGGTGGCAACATTACTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.1749999999999998 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.7 0.0 0.0 0.0 0.0 98-99 1.9749999999999999 0.0 0.0 0.0 0.0 100-101 2.35 0.0 0.0 0.0 0.0 102-103 2.9124999999999996 0.0 0.0 0.0 0.0 104-105 3.375 0.0 0.0 0.0 0.0 106-107 3.65 0.0 0.0 0.0 0.0 108-109 4.3625 0.0 0.0 0.0 0.0 110-111 4.75 0.0 0.0 0.0 0.0 112-113 5.225 0.0 0.0 0.0 0.0 114-115 5.7125 0.0 0.0 0.0 0.0 116-117 6.175000000000001 0.0 0.0 0.0 0.0 118-119 6.8125 0.0 0.0 0.0 0.0 120-121 7.2625 0.0 0.0 0.0 0.0 122-123 7.9625 0.0 0.0 0.0 0.0 124-125 8.6625 0.0 0.0 0.0 0.0 126-127 9.2625 0.0 0.0 0.0 0.0 128-129 9.675 0.0 0.0 0.0 0.0 130-131 10.6125 0.0 0.0 0.0 0.0 132-133 11.45 0.0 0.0 0.0 0.0 134-135 12.100000000000001 0.0 0.0 0.0 0.0 136-137 12.912500000000001 0.0 0.0 0.0 0.0 138-139 13.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGATA 10 0.006830828 145.0 2 GGGGGGG 20 0.00593511 29.0 125-129 >>END_MODULE Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535223 spots for SRR12917504.sra Written 535223 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra Read 535208 spots for SRR12917504.sra Written 535208 spots for SRR12917504.sra SRR ids: ['SRR12917504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rdrcu50m SRR12917504.sra spots: 10704175 blocks: [[1, 535208], [535209, 1070416], [1070417, 1605624], [1605625, 2140832], [2140833, 2676040], [2676041, 3211248], [3211249, 3746456], [3746457, 4281664], [4281665, 4816872], [4816873, 5352080], [5352081, 5887288], [5887289, 6422496], [6422497, 6957704], [6957705, 7492912], [7492913, 8028120], [8028121, 8563328], [8563329, 9098536], [9098537, 9633744], [9633745, 10168952], [10168953, 10704175]] SRR12917504 file size 3616046 SRR12917504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917504 SRR12917504_1.fastq SRR12917504_2.fastq Input file: SRR12917504_1.fastq Paired file: SRR12917504_2.fastq trimmed: SRR12917504-trimmed-pair1.fastq, SRR12917504-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:09:25 2025 >> started Thu Feb 13 07:28:39 2025 >> done (1154.000s) 10704175 read pairs processed; of these: 295 ( 0.00%) short read pairs filtered out after trimming by size control 442 ( 0.00%) empty read pairs filtered out after trimming by size control 10703438 (99.99%) read pairs available; of these: 2136044 (19.96%) trimmed read pairs available after processing 8567394 (80.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 15 0.00% 20 21 0.00% 21 27 0.00% 22 21 0.00% 23 36 0.00% 24 25 0.00% 25 30 0.00% 26 23 0.00% 27 34 0.00% 28 40 0.00% 29 40 0.00% 30 29 0.00% 31 43 0.00% 32 29 0.00% 33 31 0.00% 34 39 0.00% 35 57 0.00% 36 51 0.00% 37 58 0.00% 38 39 0.00% 39 47 0.00% 40 53 0.00% 41 44 0.00% 42 61 0.00% 43 78 0.00% 44 52 0.00% 45 76 0.00% 46 75 0.00% 47 68 0.00% 48 95 0.00% 49 110 0.00% 50 131 0.00% 51 155 0.00% 52 136 0.00% 53 184 0.00% 54 190 0.00% 55 184 0.00% 56 205 0.00% 57 242 0.00% 58 319 0.00% 59 402 0.00% 60 453 0.00% 61 531 0.00% 62 538 0.01% 63 652 0.01% 64 793 0.01% 65 884 0.01% 66 873 0.01% 67 1179 0.01% 68 1260 0.01% 69 1399 0.01% 70 1618 0.02% 71 1821 0.02% 72 2185 0.02% 73 2576 0.02% 74 2865 0.03% 75 3199 0.03% 76 3644 0.03% 77 3821 0.04% 78 4262 0.04% 79 4641 0.04% 80 5177 0.05% 81 5873 0.05% 82 6738 0.06% 83 7237 0.07% 84 8189 0.08% 85 8717 0.08% 86 9506 0.09% 87 10137 0.09% 88 10922 0.10% 89 11440 0.11% 90 12119 0.11% 91 12958 0.12% 92 13598 0.13% 93 14854 0.14% 94 15754 0.15% 95 17352 0.16% 96 18004 0.17% 97 19011 0.18% 98 19353 0.18% 99 19965 0.19% 100 20562 0.19% 101 20778 0.19% 102 22005 0.21% 103 22789 0.21% 104 23943 0.22% 105 25186 0.24% 106 26185 0.24% 107 26963 0.25% 108 27360 0.26% 109 28059 0.26% 110 27842 0.26% 111 28808 0.27% 112 29606 0.28% 113 30256 0.28% 114 30644 0.29% 115 32040 0.30% 116 33140 0.31% 117 33994 0.32% 118 34856 0.33% 119 34926 0.33% 120 35935 0.34% 121 35512 0.33% 122 36294 0.34% 123 36222 0.34% 124 36570 0.34% 125 37433 0.35% 126 39267 0.37% 127 39570 0.37% 128 39615 0.37% 129 40788 0.38% 130 40448 0.38% 131 40521 0.38% 132 40953 0.38% 133 41285 0.39% 134 41069 0.38% 135 41660 0.39% 136 42260 0.39% 137 42627 0.40% 138 43135 0.40% 139 44523 0.42% 140 44141 0.41% 141 43863 0.41% 142 44316 0.41% 143 44030 0.41% 144 43828 0.41% 145 44315 0.41% 146 44495 0.42% 147 44155 0.41% 148 45972 0.43% 149 44993 0.42% 150 46588 0.44% 151 8567394 80.04% 10703438 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=15 prefix-density=0.65 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=82.40 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.7 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=19 prefix-density=0.49 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=72.21 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR12917504 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 07:55:16 Started mapping on | Feb 13 07:55:29 Finished on | Feb 13 08:58:49 Mapping speed, Million of reads per hour | 10.14 Number of input reads | 10703438 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10121950 Uniquely mapped reads % | 94.57% Average mapped length | 289.34 Number of splices: Total | 9677170 Number of splices: Annotated (sjdb) | 9478529 Number of splices: GT/AG | 9458624 Number of splices: GC/AG | 184117 Number of splices: AT/AC | 5760 Number of splices: Non-canonical | 28669 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261033 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 22051 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 320455 320455 320455 N_multimapping 261033 261033 261033 N_noFeature 329452 9987075 377657 N_ambiguous 159572 493 72629 UnstrandedReadsAssigned:9632926 PositiveStrandReadsAssigned:134382 NegativeStrandReadsAssigned:9671664 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917504 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917504-trimmed-pair1.fastq SRR12917504-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,703,438 reads, 9,720,132 reads pseudoaligned [quant] estimated average fragment length: 230.56 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR12917504.ke.tsv 34699 SRR12917504.se.tsv 87100 total ==> SRR12917504.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.44 208.561 12.0346 Potri.005G024800.1.v4.1 1035 805.44 126 16.1441 Potri.004G059700.1.v4.1 961 731.561 80 11.2853 Potri.007G009000.2.v4.1 1416 1186.44 0 0 Potri.003G141000.2.v4.1 2943 2713.44 370 14.072 Potri.016G087400.1.v4.1 270 100.02 451.686 466.042 Potri.015G069301.1.v4.1 564 346.108 0 0 Potri.010G195200.1.v4.1 1773 1543.44 11 0.735492 Potri.012G127500.1.v4.1 977 747.487 173 23.8846 ==> SRR12917504.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 148 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 112 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12917504 completed mapping pipeline successfully