Starting /dee2/code/volunteer_pipeline.sh SRR12917505 current disk space = 3053163466752 free memory = 1461370576 SRR12917505 SRAfilesize a882d4851819f83e7ec6e8def7ac5eb2 SRR12917505.sra SRR12917505.sra file validated SRR12917505 is paired end SRR12917505 is conventional basespace SRR12917505 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917505_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.65075 37.0 37.0 37.0 37.0 37.0 2 36.5 37.0 37.0 37.0 37.0 37.0 3 36.6205 37.0 37.0 37.0 37.0 37.0 4 36.6605 37.0 37.0 37.0 37.0 37.0 5 36.643 37.0 37.0 37.0 37.0 37.0 6 36.641 37.0 37.0 37.0 37.0 37.0 7 36.552 37.0 37.0 37.0 37.0 37.0 8 36.56 37.0 37.0 37.0 37.0 37.0 9 36.679 37.0 37.0 37.0 37.0 37.0 10-14 36.618900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6442 37.0 37.0 37.0 37.0 37.0 20-24 36.550599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5675 37.0 37.0 37.0 37.0 37.0 30-34 36.5087 37.0 37.0 37.0 37.0 37.0 35-39 36.4822 37.0 37.0 37.0 37.0 37.0 40-44 36.443999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4627 37.0 37.0 37.0 37.0 37.0 50-54 36.44 37.0 37.0 37.0 37.0 37.0 55-59 36.406800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3553 37.0 37.0 37.0 37.0 37.0 65-69 36.30640000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3067 37.0 37.0 37.0 37.0 37.0 75-79 36.337399999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3448 37.0 37.0 37.0 37.0 37.0 85-89 36.2793 37.0 37.0 37.0 37.0 37.0 90-94 36.2787 37.0 37.0 37.0 37.0 37.0 95-99 36.174 37.0 37.0 37.0 37.0 37.0 100-104 36.1332 37.0 37.0 37.0 37.0 37.0 105-109 36.088 37.0 37.0 37.0 37.0 37.0 110-114 36.094899999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0753 37.0 37.0 37.0 37.0 37.0 120-124 36.040299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9682 37.0 37.0 37.0 37.0 37.0 130-134 35.8784 37.0 37.0 37.0 37.0 37.0 135-139 35.7654 37.0 37.0 37.0 37.0 37.0 140-144 35.6979 37.0 37.0 37.0 37.0 37.0 145-149 35.6504 37.0 37.0 37.0 37.0 37.0 150-151 35.43575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 4.0 24 3.0 25 1.0 26 4.0 27 9.0 28 11.0 29 15.0 30 21.0 31 25.0 32 44.0 33 52.0 34 130.0 35 337.0 36 3003.0 37 339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.46136534133534 12.653163290822706 5.4513628407101775 36.434108527131784 2 18.95 11.475 36.8 32.775 3 17.175 16.425 28.925 37.475 4 21.625 22.85 24.925 30.599999999999998 5 24.05 28.025 25.2 22.725 6 20.7 34.25 22.375 22.675 7 16.075 28.95 40.225 14.75 8 17.1 26.8 32.05 24.05 9 17.424999999999997 23.875 35.425000000000004 23.275000000000002 10-14 19.6 29.604999999999997 27.485 23.31 15-19 19.78 27.815 27.500000000000004 24.905 20-24 20.064999999999998 28.754999999999995 27.389999999999997 23.79 25-29 19.855 28.165000000000003 28.000000000000004 23.98 30-34 19.470000000000002 28.044999999999998 27.534999999999997 24.95 35-39 20.080000000000002 28.645 27.29 23.985 40-44 19.830000000000002 28.68 27.42 24.07 45-49 19.86 28.634999999999998 26.825 24.68 50-54 20.39 28.285 27.55 23.775 55-59 19.68 28.92 27.560000000000002 23.84 60-64 20.26 28.92 26.75 24.07 65-69 19.62 28.470000000000002 27.195000000000004 24.715 70-74 19.805 28.505000000000003 27.255000000000003 24.435000000000002 75-79 20.515 28.055000000000003 27.495000000000005 23.935000000000002 80-84 19.845 28.63 27.134999999999998 24.39 85-89 19.634999999999998 28.555000000000003 27.715 24.095 90-94 20.4 28.155 27.295 24.15 95-99 20.605 28.139999999999997 27.415 23.84 100-104 20.34 28.42 27.325 23.915 105-109 20.595 28.285 27.275 23.845 110-114 20.26 27.950000000000003 27.185 24.605 115-119 20.625 27.97 27.169999999999998 24.235 120-124 20.645 27.800000000000004 26.76 24.795 125-129 20.880000000000003 28.075 26.224999999999998 24.82 130-134 21.18 27.544999999999998 26.865 24.41 135-139 21.490000000000002 27.435 26.729999999999997 24.345 140-144 20.845 28.199999999999996 26.490000000000002 24.465 145-149 21.23 27.395000000000003 26.779999999999998 24.595 150-151 21.349999999999998 27.9125 25.9625 24.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 2.5 25 2.0 26 2.5 27 2.5 28 5.5 29 8.5 30 16.5 31 22.0 32 30.0 33 43.0 34 51.0 35 68.5 36 85.5 37 99.5 38 118.0 39 143.5 40 167.0 41 206.0 42 232.0 43 243.0 44 271.5 45 271.0 46 255.5 47 263.0 48 263.5 49 227.0 50 183.5 51 143.5 52 112.0 53 96.0 54 80.5 55 66.0 56 49.5 57 37.5 58 33.0 59 22.0 60 12.0 61 11.5 62 8.0 63 4.5 64 4.0 65 6.0 66 6.5 67 3.0 68 4.0 69 3.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.75048463029631 81.925 2 7.892550540016615 14.249999999999998 3 1.1908058709498754 3.225 4 0.16615895873719191 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0125 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.07500000000000001 0.025 0.0 0.0 0.0 72-73 0.1375 0.025 0.0 0.0 0.0 74-75 0.175 0.025 0.0 0.0 0.0 76-77 0.23750000000000002 0.025 0.0 0.025 0.0 78-79 0.275 0.025 0.0 0.05 0.0 80-81 0.30000000000000004 0.025 0.0 0.05 0.0 82-83 0.3875 0.025 0.0 0.05 0.0 84-85 0.4375 0.025 0.0 0.05 0.0 86-87 0.45 0.025 0.0 0.05 0.0 88-89 0.5375 0.025 0.0 0.05 0.0 90-91 0.75 0.025 0.0 0.05 0.0 92-93 0.9 0.025 0.0 0.05 0.0 94-95 1.025 0.025 0.0 0.05 0.0 96-97 1.1625 0.025 0.0 0.05 0.0 98-99 1.3875000000000002 0.025 0.0 0.05 0.0 100-101 1.5625 0.025 0.0 0.05 0.0 102-103 1.75 0.025 0.0 0.05 0.0 104-105 1.9125 0.025 0.0 0.05 0.0 106-107 2.2375 0.025 0.0 0.05 0.0 108-109 2.525 0.025 0.0 0.05 0.0 110-111 2.8125 0.025 0.0 0.05 0.0 112-113 3.175 0.025 0.0 0.05 0.0 114-115 3.425 0.025 0.0 0.05 0.0 116-117 3.7625 0.025 0.0 0.05 0.0 118-119 4.4125 0.025 0.0 0.05 0.0 120-121 4.925 0.025 0.0 0.05 0.0 122-123 5.275 0.025 0.0 0.05 0.0 124-125 5.6 0.025 0.0 0.05 0.0 126-127 6.0375 0.025 0.0 0.05 0.0 128-129 6.55 0.025 0.0 0.05 0.0 130-131 7.0875 0.025 0.0 0.05 0.0 132-133 7.550000000000001 0.025 0.0 0.05 0.0 134-135 8.075 0.025 0.0 0.05 0.0 136-137 8.8125 0.025 0.0 0.05 0.0 138-139 9.524999999999999 0.025 0.0 0.05 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917505 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917505_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2835 37.0 37.0 37.0 37.0 37.0 2 36.2025 37.0 37.0 37.0 37.0 37.0 3 36.2405 37.0 37.0 37.0 37.0 37.0 4 36.304 37.0 37.0 37.0 37.0 37.0 5 36.3545 37.0 37.0 37.0 37.0 37.0 6 36.301 37.0 37.0 37.0 37.0 37.0 7 36.4045 37.0 37.0 37.0 37.0 37.0 8 36.428 37.0 37.0 37.0 37.0 37.0 9 36.3365 37.0 37.0 37.0 37.0 37.0 10-14 36.3709 37.0 37.0 37.0 37.0 37.0 15-19 36.3528 37.0 37.0 37.0 37.0 37.0 20-24 36.317099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1989 37.0 37.0 37.0 37.0 37.0 30-34 36.2014 37.0 37.0 37.0 37.0 37.0 35-39 36.0775 37.0 37.0 37.0 37.0 37.0 40-44 36.1234 37.0 37.0 37.0 37.0 37.0 45-49 36.060700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0323 37.0 37.0 37.0 37.0 37.0 55-59 36.03340000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.0817 37.0 37.0 37.0 37.0 37.0 65-69 36.016 37.0 37.0 37.0 37.0 37.0 70-74 35.986200000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9106 37.0 37.0 37.0 37.0 37.0 80-84 35.9456 37.0 37.0 37.0 37.0 37.0 85-89 35.9469 37.0 37.0 37.0 37.0 37.0 90-94 35.947399999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8428 37.0 37.0 37.0 37.0 37.0 100-104 35.853 37.0 37.0 37.0 37.0 37.0 105-109 35.84 37.0 37.0 37.0 37.0 37.0 110-114 35.775400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6412 37.0 37.0 37.0 37.0 37.0 120-124 35.6078 37.0 37.0 37.0 37.0 37.0 125-129 35.591899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4767 37.0 37.0 37.0 37.0 37.0 135-139 35.4293 37.0 37.0 37.0 37.0 37.0 140-144 35.27760000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.230900000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.82475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 1.0 16 1.0 17 4.0 18 0.0 19 0.0 20 3.0 21 3.0 22 2.0 23 6.0 24 7.0 25 4.0 26 5.0 27 5.0 28 11.0 29 13.0 30 19.0 31 30.0 32 64.0 33 96.0 34 191.0 35 634.0 36 2706.0 37 189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6 26.025 8.450000000000001 23.925 2 29.825000000000003 25.674999999999997 28.425 16.075 3 20.525 28.349999999999998 32.375 18.75 4 22.725 34.75 23.425 19.1 5 26.224999999999998 37.45 20.349999999999998 15.975 6 20.974999999999998 39.65 21.55 17.825 7 21.525 23.974999999999998 36.6 17.9 8 20.599999999999998 26.724999999999998 28.475 24.2 9 22.875 25.374999999999996 29.075 22.675 10-14 23.580000000000002 30.37 25.575 20.474999999999998 15-19 23.674999999999997 28.095 27.01 21.22 20-24 23.26 28.744999999999997 27.229999999999997 20.765 25-29 23.36 28.194999999999997 27.355 21.09 30-34 23.794999999999998 27.93 27.255000000000003 21.02 35-39 24.02 28.15 26.724999999999998 21.105 40-44 23.595 28.27 27.29 20.845 45-49 23.0 28.08 26.88 22.040000000000003 50-54 23.875 28.084999999999997 27.255000000000003 20.785 55-59 24.565 28.16 26.665 20.61 60-64 23.630000000000003 27.67 27.950000000000003 20.75 65-69 24.075 27.644999999999996 27.35 20.93 70-74 24.34 27.065 27.805000000000003 20.79 75-79 24.310000000000002 27.875 26.625 21.19 80-84 24.385 27.435 27.389999999999997 20.79 85-89 24.095 27.975 26.825 21.105 90-94 24.77 27.939999999999998 27.11 20.18 95-99 24.325 27.700000000000003 26.325 21.65 100-104 24.185000000000002 28.165000000000003 27.455000000000002 20.195 105-109 24.57 28.13 26.685 20.615 110-114 23.985 28.134999999999998 26.724999999999998 21.154999999999998 115-119 25.15 28.205000000000002 26.905 19.74 120-124 25.56 27.825 26.865 19.75 125-129 25.465 27.99 26.545 20.0 130-134 26.345000000000002 27.975 26.235000000000003 19.445 135-139 26.119999999999997 27.965 26.150000000000002 19.765 140-144 26.97 28.46 25.380000000000003 19.189999999999998 145-149 27.16 27.595 26.25 18.995 150-151 27.6 26.9625 25.3 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 1.5 24 3.0 25 2.5 26 1.5 27 3.5 28 4.0 29 3.0 30 8.0 31 13.5 32 19.0 33 28.5 34 37.5 35 48.5 36 68.5 37 94.0 38 123.5 39 162.0 40 184.5 41 198.5 42 237.5 43 279.0 44 291.5 45 276.0 46 274.5 47 266.0 48 241.5 49 216.0 50 182.5 51 153.5 52 122.5 53 96.0 54 85.0 55 65.0 56 39.5 57 32.5 58 28.0 59 25.5 60 18.5 61 11.5 62 9.5 63 6.0 64 5.5 65 5.0 66 1.5 67 0.5 68 1.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.5 90 1.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.73509015256587 81.77499999999999 2 7.850208044382802 14.149999999999999 3 1.1927877947295422 3.225 4 0.1941747572815534 0.7000000000000001 5 0.0 0.0 6 0.027739251040221912 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.23750000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.225 0.0 0.0 0.0 0.0 124-125 5.550000000000001 0.0 0.0 0.0 0.0 126-127 5.9875 0.0 0.0 0.0 0.0 128-129 6.525 0.0 0.0 0.0 0.0 130-131 7.0625 0.0 0.0 0.0 0.0 132-133 7.5125 0.0 0.0 0.0 0.0 134-135 8.0 0.0 0.0 0.0 0.0 136-137 8.725000000000001 0.0 0.0 0.0 0.0 138-139 9.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 90 0.0048656333 16.11111 145 >>END_MODULE Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616340 spots for SRR12917505.sra Written 616340 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra Read 616332 spots for SRR12917505.sra Written 616332 spots for SRR12917505.sra SRR ids: ['SRR12917505.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f80wl8yi SRR12917505.sra spots: 12326648 blocks: [[1, 616332], [616333, 1232664], [1232665, 1848996], [1848997, 2465328], [2465329, 3081660], [3081661, 3697992], [3697993, 4314324], [4314325, 4930656], [4930657, 5546988], [5546989, 6163320], [6163321, 6779652], [6779653, 7395984], [7395985, 8012316], [8012317, 8628648], [8628649, 9244980], [9244981, 9861312], [9861313, 10477644], [10477645, 11093976], [11093977, 11710308], [11710309, 12326648]] SRR12917505 file size 4167433 SRR12917505 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917505 SRR12917505_1.fastq SRR12917505_2.fastq Input file: SRR12917505_1.fastq Paired file: SRR12917505_2.fastq trimmed: SRR12917505-trimmed-pair1.fastq, SRR12917505-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:09:55 2025 >> started Thu Feb 13 07:21:21 2025 >> done (685.369s) 12326648 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 10086 ( 0.08%) empty read pairs filtered out after trimming by size control 12316492 (99.92%) read pairs available; of these: 1688756 (13.71%) trimmed read pairs available after processing 10627736 (86.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 10 0.00% 21 9 0.00% 22 7 0.00% 23 10 0.00% 24 17 0.00% 25 26 0.00% 26 23 0.00% 27 16 0.00% 28 14 0.00% 29 14 0.00% 30 27 0.00% 31 22 0.00% 32 30 0.00% 33 28 0.00% 34 23 0.00% 35 21 0.00% 36 39 0.00% 37 19 0.00% 38 33 0.00% 39 31 0.00% 40 29 0.00% 41 33 0.00% 42 42 0.00% 43 29 0.00% 44 29 0.00% 45 41 0.00% 46 49 0.00% 47 41 0.00% 48 72 0.00% 49 74 0.00% 50 87 0.00% 51 107 0.00% 52 127 0.00% 53 133 0.00% 54 104 0.00% 55 140 0.00% 56 174 0.00% 57 176 0.00% 58 212 0.00% 59 244 0.00% 60 350 0.00% 61 401 0.00% 62 400 0.00% 63 465 0.00% 64 523 0.00% 65 602 0.00% 66 609 0.00% 67 743 0.01% 68 825 0.01% 69 915 0.01% 70 1156 0.01% 71 1297 0.01% 72 1618 0.01% 73 1717 0.01% 74 2077 0.02% 75 2247 0.02% 76 2438 0.02% 77 2571 0.02% 78 2925 0.02% 79 3073 0.02% 80 3540 0.03% 81 3750 0.03% 82 4260 0.03% 83 4783 0.04% 84 5301 0.04% 85 5903 0.05% 86 6401 0.05% 87 6582 0.05% 88 7136 0.06% 89 6901 0.06% 90 7419 0.06% 91 7812 0.06% 92 8464 0.07% 93 9224 0.07% 94 9896 0.08% 95 10662 0.09% 96 11865 0.10% 97 12015 0.10% 98 12357 0.10% 99 12629 0.10% 100 12898 0.10% 101 13352 0.11% 102 13863 0.11% 103 14967 0.12% 104 15598 0.13% 105 16933 0.14% 106 17716 0.14% 107 18443 0.15% 108 18877 0.15% 109 19137 0.16% 110 19161 0.16% 111 19685 0.16% 112 20166 0.16% 113 20858 0.17% 114 22037 0.18% 115 23368 0.19% 116 24462 0.20% 117 24901 0.20% 118 25893 0.21% 119 25870 0.21% 120 26607 0.22% 121 26763 0.22% 122 26620 0.22% 123 27736 0.23% 124 28602 0.23% 125 29642 0.24% 126 30788 0.25% 127 31617 0.26% 128 32705 0.27% 129 33263 0.27% 130 33576 0.27% 131 33817 0.27% 132 34049 0.28% 133 34319 0.28% 134 34906 0.28% 135 35747 0.29% 136 36476 0.30% 137 38421 0.31% 138 38640 0.31% 139 39552 0.32% 140 39255 0.32% 141 40073 0.33% 142 40434 0.33% 143 40219 0.33% 144 40970 0.33% 145 41553 0.34% 146 42027 0.34% 147 42682 0.35% 148 43393 0.35% 149 44593 0.36% 150 45307 0.37% 151 10627736 86.29% 12316492 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=7.78 fanout-score-rank=13 prefix-density=0.48 prefix-fanout=3.8 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=97.89 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=15.4 sequence=TCCTTCTTCACAATG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.3 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=355.88 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=18.9 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAACACTGACGCTATTTCTGCTGTTTGTCAAGATGGGGTTCTGACTGTTACTGTTGAGAAATTACCACCTCCTGAGCCTAAGAAGCCTAAGACTAT SRR12917505 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 08:29:28 Started mapping on | Feb 13 08:29:31 Finished on | Feb 13 10:40:11 Mapping speed, Million of reads per hour | 5.66 Number of input reads | 12316492 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11327474 Uniquely mapped reads % | 91.97% Average mapped length | 293.56 Number of splices: Total | 10243002 Number of splices: Annotated (sjdb) | 10027077 Number of splices: GT/AG | 10040516 Number of splices: GC/AG | 151271 Number of splices: AT/AC | 13653 Number of splices: Non-canonical | 37562 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295902 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 78094 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.81% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 693116 693116 693116 N_multimapping 295902 295902 295902 N_noFeature 268458 11169152 345899 N_ambiguous 151100 874 69624 UnstrandedReadsAssigned:10907916 PositiveStrandReadsAssigned:157448 NegativeStrandReadsAssigned:10911951 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917505 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917505-trimmed-pair1.fastq SRR12917505-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,316,492 reads, 11,006,516 reads pseudoaligned [quant] estimated average fragment length: 246.007 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR12917505.ke.tsv 34699 SRR12917505.se.tsv 87100 total ==> SRR12917505.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.99 381 17.6185 Potri.005G024800.1.v4.1 1035 789.993 165 17.1242 Potri.004G059700.1.v4.1 961 716.043 41 4.69456 Potri.007G009000.2.v4.1 1416 1170.99 2 0.140031 Potri.003G141000.2.v4.1 2943 2697.99 340 10.3321 Potri.016G087400.1.v4.1 270 90.4047 1356.48 1230.19 Potri.015G069301.1.v4.1 564 331.375 0 0 Potri.010G195200.1.v4.1 1773 1527.99 26 1.39509 Potri.012G127500.1.v4.1 977 732.024 13332 1493.21 ==> SRR12917505.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 131 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 61 SRR12917505 completed mapping pipeline successfully