Starting /dee2/code/volunteer_pipeline.sh SRR12917506 current disk space = 3052963758080 free memory = 1447065760 SRR12917506 SRAfilesize 6dc93c0ff376bfa56ed194294ced390a SRR12917506.sra SRR12917506.sra file validated SRR12917506 is paired end SRR12917506 is conventional basespace SRR12917506 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917506_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6295 37.0 37.0 37.0 37.0 37.0 2 36.5175 37.0 37.0 37.0 37.0 37.0 3 36.62 37.0 37.0 37.0 37.0 37.0 4 36.5975 37.0 37.0 37.0 37.0 37.0 5 36.6325 37.0 37.0 37.0 37.0 37.0 6 36.652 37.0 37.0 37.0 37.0 37.0 7 36.558 37.0 37.0 37.0 37.0 37.0 8 36.6785 37.0 37.0 37.0 37.0 37.0 9 36.593 37.0 37.0 37.0 37.0 37.0 10-14 36.610400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.593 37.0 37.0 37.0 37.0 37.0 20-24 36.6077 37.0 37.0 37.0 37.0 37.0 25-29 36.5745 37.0 37.0 37.0 37.0 37.0 30-34 36.5166 37.0 37.0 37.0 37.0 37.0 35-39 36.4814 37.0 37.0 37.0 37.0 37.0 40-44 36.4759 37.0 37.0 37.0 37.0 37.0 45-49 36.4646 37.0 37.0 37.0 37.0 37.0 50-54 36.4659 37.0 37.0 37.0 37.0 37.0 55-59 36.4271 37.0 37.0 37.0 37.0 37.0 60-64 36.4138 37.0 37.0 37.0 37.0 37.0 65-69 36.325 37.0 37.0 37.0 37.0 37.0 70-74 36.345299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3467 37.0 37.0 37.0 37.0 37.0 80-84 36.28580000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2787 37.0 37.0 37.0 37.0 37.0 90-94 36.2632 37.0 37.0 37.0 37.0 37.0 95-99 36.198800000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1545 37.0 37.0 37.0 37.0 37.0 105-109 36.1298 37.0 37.0 37.0 37.0 37.0 110-114 36.138 37.0 37.0 37.0 37.0 37.0 115-119 36.085699999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.05159999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.971 37.0 37.0 37.0 37.0 37.0 130-134 35.921499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.7821 37.0 37.0 37.0 37.0 37.0 140-144 35.659800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.414 37.0 37.0 37.0 34.6 37.0 150-151 35.15025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 2.0 26 1.0 27 3.0 28 12.0 29 14.0 30 27.0 31 34.0 32 47.0 33 77.0 34 135.0 35 334.0 36 2990.0 37 322.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.09804902451226 12.956478239119559 4.327163581790895 36.61830915457729 2 17.95 11.725 40.075 30.25 3 16.525000000000002 16.6 30.775000000000002 36.1 4 22.525000000000002 23.65 24.5 29.325000000000003 5 23.849999999999998 30.275000000000002 25.174999999999997 20.7 6 20.5 33.125 24.425 21.95 7 15.575 26.674999999999997 41.525 16.225 8 15.2 24.675 34.949999999999996 25.174999999999997 9 16.975 21.575 37.1 24.349999999999998 10-14 19.465 30.464999999999996 27.455000000000002 22.615 15-19 20.285 27.785 27.815 24.115000000000002 20-24 20.105 28.560000000000002 27.689999999999998 23.645 25-29 19.994999999999997 28.375 27.595 24.035 30-34 19.97 27.935 28.38 23.715 35-39 19.935 28.355000000000004 27.779999999999998 23.93 40-44 20.32 28.549999999999997 28.13 23.0 45-49 19.645000000000003 28.389999999999997 28.405 23.56 50-54 19.81 27.955000000000002 27.91 24.325 55-59 20.06 28.249999999999996 27.779999999999998 23.91 60-64 20.39 28.475 27.515 23.62 65-69 20.06 28.075 27.83 24.035 70-74 20.34 28.505000000000003 26.83 24.325 75-79 20.025000000000002 28.144999999999996 27.800000000000004 24.03 80-84 20.24 28.105000000000004 28.144999999999996 23.51 85-89 20.215 29.060000000000002 27.055 23.669999999999998 90-94 20.405 28.21 27.77 23.615 95-99 20.974999999999998 28.365000000000002 27.155 23.505000000000003 100-104 20.560000000000002 28.815 26.939999999999998 23.685000000000002 105-109 20.94 28.125 27.165 23.77 110-114 21.365000000000002 28.310000000000002 26.555 23.77 115-119 20.945 28.315 27.055 23.685000000000002 120-124 20.87 28.444999999999997 26.345000000000002 24.34 125-129 21.029999999999998 27.689999999999998 27.425 23.855 130-134 21.759999999999998 27.875 26.179999999999996 24.185000000000002 135-139 21.709999999999997 27.865000000000002 27.1 23.325000000000003 140-144 21.634999999999998 27.21 26.340000000000003 24.815 145-149 21.84 27.47 26.369999999999997 24.32 150-151 21.975 27.962500000000002 25.9875 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 5.0 26 8.5 27 9.0 28 12.5 29 16.0 30 20.0 31 28.0 32 30.5 33 35.5 34 51.5 35 61.5 36 76.0 37 101.0 38 128.5 39 144.5 40 172.5 41 210.0 42 234.5 43 250.5 44 262.0 45 285.0 46 277.5 47 239.5 48 239.5 49 229.5 50 191.0 51 158.5 52 118.5 53 97.0 54 84.0 55 62.5 56 40.5 57 31.5 58 24.0 59 16.0 60 14.5 61 10.5 62 4.0 63 1.5 64 1.5 65 0.5 66 2.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.84397163120568 84.175 2 7.310420076377524 13.4 3 0.7637752318603382 2.1 4 0.05455537370430987 0.2 5 0.027277686852154936 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCATTGCTCTAAAGATAATTAAAGAAGGGAATTTACAATTAGGACAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.7625 0.0 0.0 0.0 0.0 84-85 1.025 0.0 0.0 0.0 0.0 86-87 1.2375 0.0 0.0 0.0 0.0 88-89 1.5875 0.0 0.0 0.0 0.0 90-91 1.8375 0.0 0.0 0.0 0.0 92-93 2.1125 0.0 0.0 0.0 0.0 94-95 2.4875 0.0 0.0 0.0 0.0 96-97 2.9749999999999996 0.0 0.0 0.0 0.0 98-99 3.5250000000000004 0.0 0.0 0.0 0.0 100-101 3.95 0.0 0.0 0.0 0.0 102-103 4.4375 0.0 0.0 0.0 0.0 104-105 5.1375 0.0 0.0 0.0 0.0 106-107 5.725 0.0 0.0 0.0 0.0 108-109 6.3625 0.0 0.0 0.0 0.0 110-111 6.9125 0.0 0.0 0.0 0.0 112-113 7.300000000000001 0.0 0.0 0.0 0.0 114-115 8.0625 0.0 0.0 0.0 0.0 116-117 8.825 0.0 0.0 0.0 0.0 118-119 9.7125 0.0 0.0 0.0 0.0 120-121 10.4625 0.0 0.0 0.0 0.0 122-123 11.212499999999999 0.0 0.0 0.0 0.0 124-125 11.9875 0.0 0.0 0.0 0.0 126-127 12.575 0.0 0.0 0.0 0.0 128-129 13.2625 0.0 0.0 0.0 0.0 130-131 14.0625 0.0 0.0 0.0 0.0 132-133 14.8875 0.0 0.0 0.0 0.0 134-135 15.7625 0.0 0.0 0.0 0.0 136-137 16.6125 0.0 0.0 0.0 0.0 138-139 17.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 15-19 >>END_MODULE SRR12917506 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917506_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.39075 37.0 37.0 37.0 37.0 37.0 2 36.1005 37.0 37.0 37.0 37.0 37.0 3 36.1575 37.0 37.0 37.0 37.0 37.0 4 36.371 37.0 37.0 37.0 37.0 37.0 5 36.3585 37.0 37.0 37.0 37.0 37.0 6 36.1745 37.0 37.0 37.0 37.0 37.0 7 36.352 37.0 37.0 37.0 37.0 37.0 8 36.3745 37.0 37.0 37.0 37.0 37.0 9 36.369 37.0 37.0 37.0 37.0 37.0 10-14 36.3378 37.0 37.0 37.0 37.0 37.0 15-19 36.27669999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.267399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.1616 37.0 37.0 37.0 37.0 37.0 30-34 36.1167 37.0 37.0 37.0 37.0 37.0 35-39 36.065000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.0729 37.0 37.0 37.0 37.0 37.0 45-49 35.9947 37.0 37.0 37.0 37.0 37.0 50-54 35.999100000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.0193 37.0 37.0 37.0 37.0 37.0 60-64 36.0124 37.0 37.0 37.0 37.0 37.0 65-69 35.9721 37.0 37.0 37.0 37.0 37.0 70-74 35.9504 37.0 37.0 37.0 37.0 37.0 75-79 35.899 37.0 37.0 37.0 37.0 37.0 80-84 35.9276 37.0 37.0 37.0 37.0 37.0 85-89 35.954499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9043 37.0 37.0 37.0 37.0 37.0 95-99 35.8165 37.0 37.0 37.0 37.0 37.0 100-104 35.7935 37.0 37.0 37.0 37.0 37.0 105-109 35.738699999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.6755 37.0 37.0 37.0 37.0 37.0 115-119 35.634100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.397999999999996 37.0 37.0 37.0 34.6 37.0 125-129 35.350300000000004 37.0 37.0 37.0 34.6 37.0 130-134 35.2289 37.0 37.0 37.0 32.2 37.0 135-139 35.0785 37.0 37.0 37.0 27.4 37.0 140-144 34.7445 37.0 37.0 37.0 25.0 37.0 145-149 34.4963 37.0 37.0 37.0 25.0 37.0 150-151 33.927 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 2.0 16 0.0 17 0.0 18 1.0 19 3.0 20 0.0 21 1.0 22 1.0 23 3.0 24 4.0 25 9.0 26 9.0 27 13.0 28 9.0 29 19.0 30 29.0 31 59.0 32 71.0 33 130.0 34 245.0 35 664.0 36 2521.0 37 202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.43560890222556 25.95648912228057 7.501875468867217 24.10602650662666 2 27.175 25.174999999999997 32.65 15.0 3 19.7 27.250000000000004 34.775 18.275 4 23.95 35.0 23.45 17.599999999999998 5 25.5 36.925000000000004 21.175 16.400000000000002 6 21.775 39.175 22.475 16.575 7 21.45 23.125 38.05 17.375 8 20.525 26.375 29.2 23.9 9 23.1 23.95 30.425 22.525000000000002 10-14 23.599999999999998 29.275000000000002 26.640000000000004 20.485 15-19 23.925 27.705000000000002 27.91 20.46 20-24 23.94 27.55 28.005000000000003 20.505000000000003 25-29 23.155 27.58 28.075 21.19 30-34 22.825 28.165000000000003 27.785 21.224999999999998 35-39 23.244999999999997 27.650000000000002 27.79 21.315 40-44 23.26 27.77 27.625 21.345 45-49 23.405 26.82 28.505000000000003 21.27 50-54 23.225 27.700000000000003 27.855 21.22 55-59 23.72 27.589999999999996 27.534999999999997 21.154999999999998 60-64 23.54 27.334999999999997 27.61 21.515 65-69 23.630000000000003 26.790000000000003 28.505000000000003 21.075 70-74 24.415 26.545 27.944999999999997 21.095 75-79 23.225 27.735 28.065 20.974999999999998 80-84 23.885 27.889999999999997 27.495000000000005 20.73 85-89 23.34 28.02 27.200000000000003 21.44 90-94 23.425 27.689999999999998 28.075 20.810000000000002 95-99 24.115000000000002 27.474999999999998 28.005000000000003 20.405 100-104 24.665 28.025 27.089999999999996 20.22 105-109 24.38 27.744999999999997 27.685 20.19 110-114 25.224999999999998 27.650000000000002 27.395000000000003 19.73 115-119 25.5 27.555000000000003 26.395000000000003 20.549999999999997 120-124 26.135 27.33 27.115000000000002 19.42 125-129 26.405 27.785 26.634999999999998 19.175 130-134 26.334999999999997 26.85 27.365000000000002 19.45 135-139 27.055 26.655 27.12 19.17 140-144 28.185 27.115000000000002 26.419999999999998 18.279999999999998 145-149 29.060000000000002 25.94 26.6 18.4 150-151 29.562500000000004 26.187500000000004 26.700000000000003 17.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 5.5 27 9.5 28 11.0 29 13.0 30 15.5 31 21.5 32 33.0 33 35.5 34 41.0 35 56.0 36 77.5 37 110.5 38 139.0 39 157.5 40 175.5 41 204.5 42 238.0 43 252.0 44 274.5 45 268.5 46 250.0 47 246.0 48 229.0 49 220.5 50 194.0 51 155.5 52 125.5 53 99.0 54 80.0 55 65.5 56 45.5 57 31.5 58 27.0 59 21.5 60 14.0 61 12.5 62 10.0 63 6.5 64 3.5 65 0.5 66 1.0 67 1.0 68 1.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.05225911812738 84.55 2 7.18562874251497 13.200000000000001 3 0.6532389765922699 1.7999999999999998 4 0.05443658138268917 0.2 5 0.05443658138268917 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAAGTCTACGGACAAGCAGGGCAACGAAGTTAACTTATTCCAGCCTGC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.7625 0.0 0.0 0.0 0.0 84-85 1.05 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88-89 1.5875 0.0 0.0 0.0 0.0 90-91 1.8375 0.0 0.0 0.0 0.0 92-93 2.1125 0.0 0.0 0.0 0.0 94-95 2.4875 0.0 0.0 0.0 0.0 96-97 2.9749999999999996 0.0 0.0 0.0 0.0 98-99 3.5250000000000004 0.0 0.0 0.0 0.0 100-101 3.95 0.0 0.0 0.0 0.0 102-103 4.4375 0.0 0.0 0.0 0.0 104-105 5.1375 0.0 0.0 0.0 0.0 106-107 5.725 0.0 0.0 0.0 0.0 108-109 6.3125 0.0 0.0 0.0 0.0 110-111 6.8625 0.0 0.0 0.0 0.0 112-113 7.325 0.0 0.0 0.0 0.0 114-115 8.1125 0.0 0.0 0.0 0.0 116-117 8.8875 0.0 0.0 0.0 0.0 118-119 9.8125 0.0 0.0 0.0 0.0 120-121 10.5625 0.0 0.0 0.0 0.0 122-123 11.3125 0.0 0.0 0.0 0.0 124-125 12.125 0.0 0.0 0.0 0.0 126-127 12.725 0.0 0.0 0.0 0.0 128-129 13.425 0.0 0.0 0.0 0.0 130-131 14.2375 0.0 0.0 0.0 0.0 132-133 15.037500000000001 0.0 0.0 0.0 0.0 134-135 15.8875 0.0 0.0 0.0 0.0 136-137 16.7625 0.0 0.0 0.0 0.0 138-139 17.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATG 10 0.006830828 145.0 2 TCAATGC 10 0.006830828 145.0 3 GCTCCAG 10 0.006830828 145.0 5 GGGGGGG 125 0.005090842 17.4 145 >>END_MODULE Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra Read 578610 spots for SRR12917506.sra Written 578610 spots for SRR12917506.sra Read 578609 spots for SRR12917506.sra Written 578609 spots for SRR12917506.sra SRR ids: ['SRR12917506.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m0mg44to SRR12917506.sra spots: 11572181 blocks: [[1, 578609], [578610, 1157218], [1157219, 1735827], [1735828, 2314436], [2314437, 2893045], [2893046, 3471654], [3471655, 4050263], [4050264, 4628872], [4628873, 5207481], [5207482, 5786090], [5786091, 6364699], [6364700, 6943308], [6943309, 7521917], [7521918, 8100526], [8100527, 8679135], [8679136, 9257744], [9257745, 9836353], [9836354, 10414962], [10414963, 10993571], [10993572, 11572181]] SRR12917506 file size 3911033 SRR12917506 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917506 SRR12917506_1.fastq SRR12917506_2.fastq Input file: SRR12917506_1.fastq Paired file: SRR12917506_2.fastq trimmed: SRR12917506-trimmed-pair1.fastq, SRR12917506-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:50:28 2025 >> started Thu Feb 13 06:50:40 2025 >> done (12.333s) 11572181 read pairs processed; of these: 160 ( 0.00%) short read pairs filtered out after trimming by size control 2048 ( 0.02%) empty read pairs filtered out after trimming by size control 11569973 (99.98%) read pairs available; of these: 2563901 (22.16%) trimmed read pairs available after processing 9006072 (77.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 8 0.00% 20 15 0.00% 21 12 0.00% 22 14 0.00% 23 21 0.00% 24 33 0.00% 25 26 0.00% 26 16 0.00% 27 24 0.00% 28 31 0.00% 29 23 0.00% 30 31 0.00% 31 30 0.00% 32 33 0.00% 33 43 0.00% 34 39 0.00% 35 33 0.00% 36 37 0.00% 37 33 0.00% 38 61 0.00% 39 35 0.00% 40 66 0.00% 41 44 0.00% 42 78 0.00% 43 65 0.00% 44 74 0.00% 45 87 0.00% 46 79 0.00% 47 108 0.00% 48 133 0.00% 49 168 0.00% 50 196 0.00% 51 231 0.00% 52 252 0.00% 53 334 0.00% 54 308 0.00% 55 409 0.00% 56 393 0.00% 57 445 0.00% 58 584 0.01% 59 623 0.01% 60 807 0.01% 61 961 0.01% 62 1016 0.01% 63 1224 0.01% 64 1353 0.01% 65 1554 0.01% 66 1713 0.01% 67 1827 0.02% 68 2173 0.02% 69 2611 0.02% 70 3023 0.03% 71 3405 0.03% 72 3941 0.03% 73 4626 0.04% 74 5009 0.04% 75 5528 0.05% 76 6166 0.05% 77 6853 0.06% 78 7266 0.06% 79 7946 0.07% 80 8593 0.07% 81 9652 0.08% 82 10710 0.09% 83 11841 0.10% 84 12866 0.11% 85 14160 0.12% 86 14843 0.13% 87 15831 0.14% 88 16568 0.14% 89 17009 0.15% 90 18081 0.16% 91 19093 0.17% 92 20532 0.18% 93 21710 0.19% 94 22940 0.20% 95 25066 0.22% 96 25423 0.22% 97 26349 0.23% 98 26804 0.23% 99 27374 0.24% 100 28053 0.24% 101 28404 0.25% 102 29898 0.26% 103 30799 0.27% 104 31662 0.27% 105 32606 0.28% 106 33700 0.29% 107 35250 0.30% 108 34898 0.30% 109 35262 0.30% 110 35533 0.31% 111 36295 0.31% 112 36463 0.32% 113 37215 0.32% 114 37993 0.33% 115 38906 0.34% 116 39917 0.35% 117 40472 0.35% 118 41194 0.36% 119 41055 0.35% 120 42008 0.36% 121 41697 0.36% 122 41706 0.36% 123 42965 0.37% 124 42809 0.37% 125 43412 0.38% 126 44824 0.39% 127 44773 0.39% 128 44904 0.39% 129 45464 0.39% 130 45393 0.39% 131 44909 0.39% 132 45459 0.39% 133 45476 0.39% 134 45787 0.40% 135 45972 0.40% 136 46432 0.40% 137 46154 0.40% 138 47776 0.41% 139 47872 0.41% 140 47173 0.41% 141 47446 0.41% 142 47447 0.41% 143 47005 0.41% 144 47665 0.41% 145 47603 0.41% 146 47233 0.41% 147 47310 0.41% 148 48188 0.42% 149 47655 0.41% 150 48077 0.42% 151 9006072 77.84% 11569973 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=16 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=8.86 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=3.4 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=18 prefix-density=0.83 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=22.49 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=ACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR12917506 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:51:22 Started mapping on | Feb 13 06:51:22 Finished on | Feb 13 06:52:26 Mapping speed, Million of reads per hour | 650.81 Number of input reads | 11569973 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 10840619 Uniquely mapped reads % | 93.70% Average mapped length | 286.62 Number of splices: Total | 10412971 Number of splices: Annotated (sjdb) | 10198825 Number of splices: GT/AG | 10193314 Number of splices: GC/AG | 177838 Number of splices: AT/AC | 7058 Number of splices: Non-canonical | 34761 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239947 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 64978 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489407 489407 489407 N_multimapping 239947 239947 239947 N_noFeature 399328 10697325 456743 N_ambiguous 158308 582 72075 UnstrandedReadsAssigned:10282983 PositiveStrandReadsAssigned:142712 NegativeStrandReadsAssigned:10311801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR12917506 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917506-trimmed-pair1.fastq SRR12917506-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,569,973 reads, 10,382,644 reads pseudoaligned [quant] estimated average fragment length: 225.748 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12917506.ke.tsv 34699 SRR12917506.se.tsv 87100 total ==> SRR12917506.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.25 285 16.012 Potri.005G024800.1.v4.1 1035 810.252 308 38.2976 Potri.004G059700.1.v4.1 961 736.407 31 4.24116 Potri.007G009000.2.v4.1 1416 1191.25 0 0 Potri.003G141000.2.v4.1 2943 2718.25 407.398 15.0998 Potri.016G087400.1.v4.1 270 104.633 666 641.28 Potri.015G069301.1.v4.1 564 351.368 0 0 Potri.010G195200.1.v4.1 1773 1548.25 9 0.585655 Potri.012G127500.1.v4.1 977 752.341 508 68.0284 ==> SRR12917506.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 147 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12917506 completed mapping pipeline successfully