Starting /dee2/code/volunteer_pipeline.sh SRR12917507 current disk space = 3052648996864 free memory = 1571402148 SRR12917507 SRAfilesize d125ff363de46120861ef157ac6b6cdd SRR12917507.sra SRR12917507.sra file validated SRR12917507 is paired end SRR12917507 is conventional basespace SRR12917507 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917507_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.62825 37.0 37.0 37.0 37.0 37.0 2 36.4375 37.0 37.0 37.0 37.0 37.0 3 36.546 37.0 37.0 37.0 37.0 37.0 4 36.625 37.0 37.0 37.0 37.0 37.0 5 36.7235 37.0 37.0 37.0 37.0 37.0 6 36.702 37.0 37.0 37.0 37.0 37.0 7 36.5635 37.0 37.0 37.0 37.0 37.0 8 36.64 37.0 37.0 37.0 37.0 37.0 9 36.711 37.0 37.0 37.0 37.0 37.0 10-14 36.6265 37.0 37.0 37.0 37.0 37.0 15-19 36.63080000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.6139 37.0 37.0 37.0 37.0 37.0 25-29 36.553 37.0 37.0 37.0 37.0 37.0 30-34 36.5661 37.0 37.0 37.0 37.0 37.0 35-39 36.5129 37.0 37.0 37.0 37.0 37.0 40-44 36.5074 37.0 37.0 37.0 37.0 37.0 45-49 36.503 37.0 37.0 37.0 37.0 37.0 50-54 36.477 37.0 37.0 37.0 37.0 37.0 55-59 36.4106 37.0 37.0 37.0 37.0 37.0 60-64 36.4164 37.0 37.0 37.0 37.0 37.0 65-69 36.357600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.377300000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.4149 37.0 37.0 37.0 37.0 37.0 80-84 36.375 37.0 37.0 37.0 37.0 37.0 85-89 36.320100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.3283 37.0 37.0 37.0 37.0 37.0 95-99 36.2778 37.0 37.0 37.0 37.0 37.0 100-104 36.2307 37.0 37.0 37.0 37.0 37.0 105-109 36.217200000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.182900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1526 37.0 37.0 37.0 37.0 37.0 120-124 36.152699999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0717 37.0 37.0 37.0 37.0 37.0 130-134 36.038199999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.926 37.0 37.0 37.0 37.0 37.0 140-144 35.794200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7757 37.0 37.0 37.0 37.0 37.0 150-151 35.546 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 1.0 27 2.0 28 8.0 29 11.0 30 18.0 31 36.0 32 44.0 33 83.0 34 99.0 35 268.0 36 3071.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.61090272568142 14.603650912728183 5.85146286571643 35.93398349587397 2 20.4 11.75 36.375 31.474999999999998 3 17.0 15.950000000000001 28.799999999999997 38.25 4 21.2 21.875 24.7 32.225 5 23.974999999999998 28.1 23.75 24.175 6 21.575 33.225 23.025000000000002 22.175 7 14.524999999999999 26.924999999999997 41.4 17.150000000000002 8 16.25 27.1 32.875 23.775 9 16.6 23.724999999999998 35.125 24.55 10-14 19.235 29.470000000000002 28.165000000000003 23.13 15-19 20.53 27.87 27.065 24.535 20-24 20.265 28.18 27.565 23.990000000000002 25-29 20.265 28.044999999999998 27.025 24.665 30-34 19.785 28.249999999999996 27.575 24.39 35-39 20.369999999999997 27.77 27.3 24.560000000000002 40-44 20.51 27.994999999999997 27.04 24.455 45-49 20.525 27.74 27.389999999999997 24.345 50-54 20.66 27.87 27.279999999999998 24.19 55-59 20.365 28.205000000000002 27.57 23.86 60-64 20.330000000000002 27.860000000000003 27.615000000000002 24.195 65-69 20.39 26.979999999999997 28.235 24.395 70-74 20.19 28.13 27.500000000000004 24.18 75-79 20.515 27.38 27.68 24.425 80-84 20.979999999999997 27.54 26.815 24.665 85-89 20.830000000000002 27.71 27.21 24.25 90-94 20.535 27.99 26.655 24.82 95-99 21.04 27.045 27.705000000000002 24.21 100-104 20.86 28.33 27.029999999999998 23.78 105-109 21.055 27.3 27.584999999999997 24.060000000000002 110-114 20.895 27.675 27.405 24.025 115-119 21.09 27.99 26.625 24.295 120-124 20.674999999999997 27.505000000000003 27.439999999999998 24.38 125-129 20.805 26.915 27.345000000000002 24.935 130-134 21.035 27.700000000000003 26.924999999999997 24.34 135-139 21.32 27.500000000000004 27.365000000000002 23.815 140-144 21.73 27.575 26.645000000000003 24.05 145-149 21.425 27.525 26.575 24.474999999999998 150-151 22.375 28.075 26.174999999999997 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 2.5 24 3.0 25 3.0 26 4.5 27 5.0 28 8.0 29 17.0 30 25.0 31 26.5 32 28.0 33 39.0 34 52.5 35 63.0 36 84.5 37 97.5 38 114.0 39 138.5 40 164.5 41 189.5 42 197.5 43 211.5 44 226.0 45 240.0 46 237.0 47 231.5 48 224.0 49 220.0 50 212.5 51 177.5 52 150.5 53 130.5 54 113.5 55 84.5 56 63.0 57 60.0 58 50.5 59 34.0 60 18.5 61 13.0 62 14.5 63 9.5 64 3.5 65 2.0 66 1.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.1 #Duplication Level Percentage of deduplicated Percentage of total 1 89.84287317620651 80.05 2 8.557800224466892 15.25 3 1.2065095398428731 3.225 4 0.33670033670033667 1.2 5 0.02805836139169473 0.125 6 0.02805836139169473 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCG 6 0.15 No Hit GTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.0875000000000004 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.0125 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTGT 10 0.006830828 145.0 3 CCGTAAT 10 0.006830828 145.0 1 AATATCA 10 0.006830828 145.0 5 >>END_MODULE SRR12917507 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917507_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.262 37.0 37.0 37.0 37.0 37.0 2 36.1935 37.0 37.0 37.0 37.0 37.0 3 36.206 37.0 37.0 37.0 37.0 37.0 4 36.1975 37.0 37.0 37.0 37.0 37.0 5 36.2965 37.0 37.0 37.0 37.0 37.0 6 36.15 37.0 37.0 37.0 37.0 37.0 7 36.244 37.0 37.0 37.0 37.0 37.0 8 36.3755 37.0 37.0 37.0 37.0 37.0 9 36.378 37.0 37.0 37.0 37.0 37.0 10-14 36.302699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2422 37.0 37.0 37.0 37.0 37.0 20-24 36.1758 37.0 37.0 37.0 37.0 37.0 25-29 36.15069999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.0544 37.0 37.0 37.0 37.0 37.0 35-39 36.0077 37.0 37.0 37.0 37.0 37.0 40-44 36.040200000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.8713 37.0 37.0 37.0 37.0 37.0 50-54 35.9045 37.0 37.0 37.0 37.0 37.0 55-59 35.926 37.0 37.0 37.0 37.0 37.0 60-64 35.919 37.0 37.0 37.0 37.0 37.0 65-69 35.8548 37.0 37.0 37.0 37.0 37.0 70-74 35.8421 37.0 37.0 37.0 37.0 37.0 75-79 35.7636 37.0 37.0 37.0 37.0 37.0 80-84 35.8562 37.0 37.0 37.0 37.0 37.0 85-89 35.859 37.0 37.0 37.0 37.0 37.0 90-94 35.8719 37.0 37.0 37.0 37.0 37.0 95-99 35.7748 37.0 37.0 37.0 37.0 37.0 100-104 35.7551 37.0 37.0 37.0 37.0 37.0 105-109 35.7019 37.0 37.0 37.0 37.0 37.0 110-114 35.656600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6139 37.0 37.0 37.0 37.0 37.0 120-124 35.5364 37.0 37.0 37.0 37.0 37.0 125-129 35.4401 37.0 37.0 37.0 37.0 37.0 130-134 35.4326 37.0 37.0 37.0 37.0 37.0 135-139 35.4159 37.0 37.0 37.0 37.0 37.0 140-144 35.2255 37.0 37.0 37.0 29.8 37.0 145-149 35.10209999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.701499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 6.0 16 3.0 17 1.0 18 1.0 19 3.0 20 0.0 21 2.0 22 7.0 23 4.0 24 4.0 25 9.0 26 3.0 27 11.0 28 3.0 29 24.0 30 26.0 31 43.0 32 60.0 33 113.0 34 192.0 35 674.0 36 2673.0 37 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.25 26.6 9.625 24.525 2 28.825 26.55 28.199999999999996 16.425 3 19.400000000000002 28.875 31.574999999999996 20.150000000000002 4 25.275 33.125 22.0 19.6 5 25.0 36.925000000000004 21.05 17.025000000000002 6 20.674999999999997 40.8 20.375 18.15 7 19.975 24.65 36.6 18.775 8 22.25 26.075 27.0 24.675 9 22.7 24.025 28.749999999999996 24.525 10-14 23.48 28.735 26.355 21.43 15-19 23.43 27.839999999999996 27.24 21.490000000000002 20-24 23.5 28.015 26.939999999999998 21.545 25-29 22.74 27.73 27.935 21.595 30-34 23.23 27.58 27.11 22.08 35-39 22.994999999999997 27.474999999999998 27.450000000000003 22.08 40-44 22.905 27.400000000000002 28.015 21.68 45-49 23.345 28.255000000000003 26.83 21.57 50-54 23.549999999999997 27.639999999999997 26.995 21.815 55-59 23.215 28.144999999999996 26.650000000000002 21.990000000000002 60-64 23.695 27.065 27.345000000000002 21.895 65-69 24.145 27.229999999999997 27.245 21.38 70-74 23.805 27.455000000000002 26.529999999999998 22.21 75-79 23.53 27.355 26.75 22.365 80-84 24.465 28.005000000000003 25.729999999999997 21.8 85-89 24.355 27.49 26.545 21.61 90-94 24.19 27.52 26.179999999999996 22.11 95-99 24.884999999999998 27.810000000000002 26.44 20.865000000000002 100-104 23.77 28.48 26.0 21.75 105-109 24.215 27.355 27.060000000000002 21.37 110-114 24.51 26.845000000000002 27.355 21.29 115-119 24.25 28.105000000000004 26.66 20.985 120-124 24.709999999999997 27.98 26.02 21.29 125-129 24.365000000000002 28.084999999999997 26.240000000000002 21.310000000000002 130-134 24.75 28.005000000000003 26.205000000000002 21.04 135-139 24.654999999999998 27.725 26.995 20.625 140-144 24.775 27.355 27.655 20.215 145-149 25.424999999999997 28.050000000000004 25.814999999999998 20.71 150-151 26.674999999999997 26.700000000000003 26.474999999999998 20.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 1.5 24 2.0 25 4.5 26 5.0 27 5.0 28 6.5 29 8.5 30 11.0 31 16.0 32 24.5 33 28.5 34 30.0 35 49.0 36 75.0 37 100.0 38 117.0 39 137.5 40 165.0 41 187.5 42 229.5 43 246.0 44 266.0 45 278.0 46 250.5 47 235.0 48 227.5 49 205.5 50 184.0 51 167.0 52 139.5 53 120.5 54 99.5 55 71.0 56 57.5 57 58.5 58 45.5 59 30.5 60 27.0 61 20.0 62 13.0 63 10.0 64 4.5 65 1.0 66 0.5 67 1.0 68 1.0 69 1.5 70 2.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 1.0 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 1.5 86 1.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.45480067377878 80.55 2 7.860752386299831 14.000000000000002 3 1.1791128579449746 3.15 4 0.36496350364963503 1.3 5 0.028074115665356544 0.125 6 0.0 0.0 7 0.028074115665356544 0.17500000000000002 8 0.0 0.0 9 0.05614823133071309 0.44999999999999996 >10 0.028074115665356544 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.4124999999999996 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.3375 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACATT 10 0.006830828 145.0 2 TACATTC 10 0.006830828 145.0 3 >>END_MODULE Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra Read 621281 spots for SRR12917507.sra Written 621281 spots for SRR12917507.sra Read 621279 spots for SRR12917507.sra Written 621279 spots for SRR12917507.sra SRR ids: ['SRR12917507.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_283m2qsi SRR12917507.sra spots: 12425582 blocks: [[1, 621279], [621280, 1242558], [1242559, 1863837], [1863838, 2485116], [2485117, 3106395], [3106396, 3727674], [3727675, 4348953], [4348954, 4970232], [4970233, 5591511], [5591512, 6212790], [6212791, 6834069], [6834070, 7455348], [7455349, 8076627], [8076628, 8697906], [8697907, 9319185], [9319186, 9940464], [9940465, 10561743], [10561744, 11183022], [11183023, 11804301], [11804302, 12425582]] SRR12917507 file size 4201056 SRR12917507 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917507 SRR12917507_1.fastq SRR12917507_2.fastq Input file: SRR12917507_1.fastq Paired file: SRR12917507_2.fastq trimmed: SRR12917507-trimmed-pair1.fastq, SRR12917507-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:27:21 2025 >> started Thu Feb 13 08:34:24 2025 >> done (423.950s) 12425582 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 3790 ( 0.03%) empty read pairs filtered out after trimming by size control 12421747 (99.97%) read pairs available; of these: 836643 ( 6.74%) trimmed read pairs available after processing 11585104 (93.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 3 0.00% 21 11 0.00% 22 5 0.00% 23 9 0.00% 24 10 0.00% 25 8 0.00% 26 13 0.00% 27 8 0.00% 28 14 0.00% 29 10 0.00% 30 17 0.00% 31 16 0.00% 32 11 0.00% 33 18 0.00% 34 13 0.00% 35 15 0.00% 36 18 0.00% 37 20 0.00% 38 18 0.00% 39 17 0.00% 40 32 0.00% 41 20 0.00% 42 23 0.00% 43 27 0.00% 44 18 0.00% 45 33 0.00% 46 33 0.00% 47 51 0.00% 48 58 0.00% 49 59 0.00% 50 68 0.00% 51 69 0.00% 52 83 0.00% 53 82 0.00% 54 90 0.00% 55 134 0.00% 56 99 0.00% 57 126 0.00% 58 152 0.00% 59 188 0.00% 60 212 0.00% 61 243 0.00% 62 269 0.00% 63 324 0.00% 64 397 0.00% 65 432 0.00% 66 461 0.00% 67 549 0.00% 68 567 0.00% 69 658 0.01% 70 765 0.01% 71 890 0.01% 72 1030 0.01% 73 1167 0.01% 74 1392 0.01% 75 1280 0.01% 76 1553 0.01% 77 1569 0.01% 78 1697 0.01% 79 1919 0.02% 80 1909 0.02% 81 2222 0.02% 82 2329 0.02% 83 2530 0.02% 84 2897 0.02% 85 3081 0.02% 86 3236 0.03% 87 3329 0.03% 88 3727 0.03% 89 3626 0.03% 90 3825 0.03% 91 4128 0.03% 92 4262 0.03% 93 4680 0.04% 94 5094 0.04% 95 5211 0.04% 96 5667 0.05% 97 5985 0.05% 98 5764 0.05% 99 6138 0.05% 100 6154 0.05% 101 6288 0.05% 102 6643 0.05% 103 6864 0.06% 104 7324 0.06% 105 7550 0.06% 106 7938 0.06% 107 8311 0.07% 108 8342 0.07% 109 8860 0.07% 110 8759 0.07% 111 9027 0.07% 112 9128 0.07% 113 9462 0.08% 114 9992 0.08% 115 10129 0.08% 116 10823 0.09% 117 11263 0.09% 118 11792 0.09% 119 11717 0.09% 120 12068 0.10% 121 12382 0.10% 122 12625 0.10% 123 13200 0.11% 124 13363 0.11% 125 13716 0.11% 126 14432 0.12% 127 14700 0.12% 128 15416 0.12% 129 15651 0.13% 130 16029 0.13% 131 16042 0.13% 132 16384 0.13% 133 16748 0.13% 134 16976 0.14% 135 17500 0.14% 136 17915 0.14% 137 18778 0.15% 138 19089 0.15% 139 20084 0.16% 140 19976 0.16% 141 20757 0.17% 142 20879 0.17% 143 21115 0.17% 144 21869 0.18% 145 22209 0.18% 146 23157 0.19% 147 23512 0.19% 148 24450 0.20% 149 24518 0.20% 150 26015 0.21% 151 11585104 93.26% 12421747 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=1.15 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=240.97 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=18 prefix-density=0.93 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=21.53 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.9 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12917507 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:24:41 Started mapping on | Feb 13 09:25:06 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 7.41 Number of input reads | 12421747 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11405249 Uniquely mapped reads % | 91.82% Average mapped length | 297.27 Number of splices: Total | 11704088 Number of splices: Annotated (sjdb) | 11500409 Number of splices: GT/AG | 11449418 Number of splices: GC/AG | 205347 Number of splices: AT/AC | 8264 Number of splices: Non-canonical | 41059 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.03% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276918 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 266836 % of reads mapped to too many loci | 2.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 739580 739580 739580 N_multimapping 276918 276918 276918 N_noFeature 426577 11159952 479378 N_ambiguous 270796 804 77773 UnstrandedReadsAssigned:10707876 PositiveStrandReadsAssigned:244493 NegativeStrandReadsAssigned:10848098 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917507 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917507-trimmed-pair1.fastq SRR12917507-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,421,747 reads, 10,991,768 reads pseudoaligned [quant] estimated average fragment length: 278.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 991 rounds 52401 SRR12917507.ke.tsv 34699 SRR12917507.se.tsv 87100 total ==> SRR12917507.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.01 197 6.17779 Potri.005G024800.1.v4.1 1035 757.008 298 21.48 Potri.004G059700.1.v4.1 961 683.114 20 1.59755 Potri.007G009000.2.v4.1 1416 1138.01 0 0 Potri.003G141000.2.v4.1 2943 2665.01 553 11.3226 Potri.016G087400.1.v4.1 270 75.5781 825 595.629 Potri.015G069301.1.v4.1 564 301.985 0 0 Potri.010G195200.1.v4.1 1773 1495.01 11 0.401483 Potri.012G127500.1.v4.1 977 699.074 61 4.76129 ==> SRR12917507.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 130 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917507 completed mapping pipeline successfully