Starting /dee2/code/volunteer_pipeline.sh SRR12917508 current disk space = 3053077118976 free memory = 1450181260 SRR12917508 SRAfilesize c4c90fc389d25b70cb139be41be103eb SRR12917508.sra SRR12917508.sra file validated SRR12917508 is paired end SRR12917508 is conventional basespace SRR12917508 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917508_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.667 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.582 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.663 37.0 37.0 37.0 37.0 37.0 6 36.6915 37.0 37.0 37.0 37.0 37.0 7 36.503 37.0 37.0 37.0 37.0 37.0 8 36.5395 37.0 37.0 37.0 37.0 37.0 9 36.6995 37.0 37.0 37.0 37.0 37.0 10-14 36.6157 37.0 37.0 37.0 37.0 37.0 15-19 36.6304 37.0 37.0 37.0 37.0 37.0 20-24 36.6333 37.0 37.0 37.0 37.0 37.0 25-29 36.5514 37.0 37.0 37.0 37.0 37.0 30-34 36.4782 37.0 37.0 37.0 37.0 37.0 35-39 36.51039999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.515499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4446 37.0 37.0 37.0 37.0 37.0 50-54 36.4324 37.0 37.0 37.0 37.0 37.0 55-59 36.3659 37.0 37.0 37.0 37.0 37.0 60-64 36.3656 37.0 37.0 37.0 37.0 37.0 65-69 36.2858 37.0 37.0 37.0 37.0 37.0 70-74 36.275 37.0 37.0 37.0 37.0 37.0 75-79 36.3129 37.0 37.0 37.0 37.0 37.0 80-84 36.2916 37.0 37.0 37.0 37.0 37.0 85-89 36.2904 37.0 37.0 37.0 37.0 37.0 90-94 36.2901 37.0 37.0 37.0 37.0 37.0 95-99 36.252399999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1836 37.0 37.0 37.0 37.0 37.0 105-109 36.1161 37.0 37.0 37.0 37.0 37.0 110-114 36.08 37.0 37.0 37.0 37.0 37.0 115-119 36.0169 37.0 37.0 37.0 37.0 37.0 120-124 35.9995 37.0 37.0 37.0 37.0 37.0 125-129 35.87330000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.7874 37.0 37.0 37.0 37.0 37.0 135-139 35.710699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5469 37.0 37.0 37.0 37.0 37.0 145-149 35.4566 37.0 37.0 37.0 37.0 37.0 150-151 35.15175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 3.0 23 3.0 24 3.0 25 0.0 26 2.0 27 8.0 28 9.0 29 20.0 30 18.0 31 39.0 32 44.0 33 72.0 34 135.0 35 313.0 36 3003.0 37 327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.0 11.700000000000001 5.375 32.925 2 19.7 12.025 37.65 30.625000000000004 3 16.825000000000003 17.275 28.999999999999996 36.9 4 21.55 24.125 24.925 29.4 5 23.799999999999997 31.525 23.225 21.45 6 19.8 34.849999999999994 24.099999999999998 21.25 7 15.35 27.325 40.9 16.425 8 15.65 26.3 32.875 25.174999999999997 9 16.7 22.55 36.225 24.525 10-14 19.975 29.609999999999996 27.775 22.64 15-19 20.02 27.97 27.77 24.240000000000002 20-24 20.3 28.04 28.389999999999997 23.27 25-29 20.01 28.349999999999998 28.015 23.625 30-34 20.055 28.595 28.03 23.32 35-39 19.54 29.14 27.785 23.535 40-44 19.994999999999997 28.910000000000004 27.33 23.765 45-49 19.765 28.15 28.515 23.57 50-54 20.455000000000002 28.499999999999996 27.42 23.625 55-59 19.79 28.455000000000002 27.900000000000002 23.855 60-64 20.215 28.52 27.395000000000003 23.87 65-69 20.064999999999998 28.09 28.044999999999998 23.799999999999997 70-74 19.66 28.939999999999998 27.474999999999998 23.925 75-79 20.544999999999998 27.76 28.310000000000002 23.385 80-84 20.615 28.425 27.150000000000002 23.810000000000002 85-89 20.085 28.935 27.3 23.68 90-94 20.46 28.810000000000002 26.87 23.86 95-99 20.445 28.32 27.495000000000005 23.74 100-104 19.97 28.904999999999998 27.065 24.060000000000002 105-109 20.72 28.52 27.185 23.575 110-114 20.315 29.01 26.33 24.345 115-119 20.805 28.84 26.77 23.585 120-124 20.995 28.725 26.505000000000003 23.775 125-129 20.46 28.865000000000002 26.619999999999997 24.055 130-134 21.099999999999998 28.88 26.265 23.755000000000003 135-139 20.715 28.810000000000002 26.179999999999996 24.295 140-144 21.44 27.900000000000002 26.51 24.15 145-149 21.55 28.265 26.334999999999997 23.849999999999998 150-151 22.0125 28.5875 25.137500000000003 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 3.5 25 4.5 26 5.0 27 9.0 28 14.5 29 20.0 30 24.5 31 28.0 32 34.0 33 40.5 34 62.0 35 76.0 36 86.5 37 101.0 38 123.0 39 156.5 40 184.0 41 199.5 42 212.5 43 246.0 44 264.5 45 258.5 46 261.5 47 248.5 48 232.5 49 214.5 50 174.5 51 145.5 52 125.0 53 103.0 54 79.5 55 58.5 56 50.5 57 45.0 58 29.0 59 20.0 60 15.5 61 9.0 62 6.0 63 4.5 64 3.5 65 4.5 66 3.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.81469475958941 85.9 2 6.4289573203673696 11.899999999999999 3 0.6753106428957321 1.875 4 0.05402485143165856 0.2 5 0.02701242571582928 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTCATCAGCAGCAGCCTTTGTGTCTGCAGATGGAGGAGTGGCAATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.32499999999999996 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.5875 0.0 0.0 0.0 0.0 74-75 0.7124999999999999 0.0 0.0 0.0 0.0 76-77 0.7875 0.0 0.0 0.0 0.0 78-79 0.925 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.35 0.0 0.0 0.0 0.0 86-87 1.6124999999999998 0.0 0.0 0.0 0.0 88-89 1.9375 0.0 0.0 0.0 0.0 90-91 2.2125 0.0 0.0 0.0 0.0 92-93 2.5374999999999996 0.0 0.0 0.0 0.0 94-95 2.95 0.0 0.0 0.0 0.0 96-97 3.3875 0.0 0.0 0.0 0.0 98-99 3.9124999999999996 0.0 0.0 0.0 0.0 100-101 4.25 0.0 0.0 0.0 0.0 102-103 4.625 0.0 0.0 0.0 0.0 104-105 5.2125 0.0 0.0 0.0 0.0 106-107 5.6 0.0 0.0 0.0 0.0 108-109 6.0 0.0 0.0 0.0 0.0 110-111 6.449999999999999 0.0 0.0 0.0 0.0 112-113 6.887499999999999 0.0 0.0 0.0 0.0 114-115 7.3 0.0 0.0 0.0 0.0 116-117 7.6875 0.0 0.0 0.0 0.0 118-119 8.0875 0.0 0.0 0.0 0.0 120-121 8.712499999999999 0.0 0.0 0.0 0.0 122-123 9.2375 0.0 0.0 0.0 0.0 124-125 9.9875 0.0 0.0 0.0 0.0 126-127 10.6875 0.0 0.0 0.0 0.0 128-129 11.325 0.0 0.0 0.0 0.0 130-131 11.8125 0.0 0.0 0.0 0.0 132-133 12.337499999999999 0.0 0.0 0.0 0.0 134-135 12.825 0.0 0.0 0.0 0.0 136-137 13.524999999999999 0.0 0.0 0.0 0.0 138-139 14.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGT 10 0.006830828 145.0 1 GTTCTGC 10 0.006830828 145.0 6 GTATTCC 10 0.006830828 145.0 145 TCAGATT 10 0.006830828 145.0 2 CATGTTC 10 0.006830828 145.0 3 GGGGGGG 155 2.875396E-4 9.354839 145 >>END_MODULE SRR12917508 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917508_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.241 37.0 37.0 37.0 37.0 37.0 2 36.081 37.0 37.0 37.0 37.0 37.0 3 36.103 37.0 37.0 37.0 37.0 37.0 4 36.419 37.0 37.0 37.0 37.0 37.0 5 36.375 37.0 37.0 37.0 37.0 37.0 6 36.3145 37.0 37.0 37.0 37.0 37.0 7 36.3655 37.0 37.0 37.0 37.0 37.0 8 36.4125 37.0 37.0 37.0 37.0 37.0 9 36.422 37.0 37.0 37.0 37.0 37.0 10-14 36.3537 37.0 37.0 37.0 37.0 37.0 15-19 36.3514 37.0 37.0 37.0 37.0 37.0 20-24 36.3187 37.0 37.0 37.0 37.0 37.0 25-29 36.252599999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.1203 37.0 37.0 37.0 37.0 37.0 35-39 36.0717 37.0 37.0 37.0 37.0 37.0 40-44 36.1034 37.0 37.0 37.0 37.0 37.0 45-49 36.0324 37.0 37.0 37.0 37.0 37.0 50-54 36.0192 37.0 37.0 37.0 37.0 37.0 55-59 35.977799999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0592 37.0 37.0 37.0 37.0 37.0 65-69 35.9777 37.0 37.0 37.0 37.0 37.0 70-74 35.9893 37.0 37.0 37.0 37.0 37.0 75-79 35.871500000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.86899999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8765 37.0 37.0 37.0 37.0 37.0 90-94 35.927800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.846500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.7875 37.0 37.0 37.0 37.0 37.0 105-109 35.703500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6912 37.0 37.0 37.0 37.0 37.0 115-119 35.514300000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4678 37.0 37.0 37.0 37.0 37.0 125-129 35.3834 37.0 37.0 37.0 37.0 37.0 130-134 35.2368 37.0 37.0 37.0 29.8 37.0 135-139 35.00920000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.804700000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.493399999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.21125000000001 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 0.0 16 0.0 17 3.0 18 0.0 19 0.0 20 4.0 21 0.0 22 4.0 23 5.0 24 5.0 25 8.0 26 7.0 27 12.0 28 16.0 29 20.0 30 27.0 31 56.0 32 69.0 33 115.0 34 239.0 35 648.0 36 2587.0 37 171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.5 23.849999999999998 9.3 22.35 2 26.3 25.074999999999996 34.150000000000006 14.475 3 21.25 26.950000000000003 33.725 18.075 4 24.875 33.25 24.0 17.875 5 25.95 37.05 20.150000000000002 16.85 6 20.1 39.900000000000006 22.625 17.375 7 19.975 22.3 38.125 19.6 8 19.6 26.400000000000002 29.95 24.05 9 21.65 23.875 30.0 24.474999999999998 10-14 23.119999999999997 29.315 26.99 20.575 15-19 23.055 27.755000000000003 27.675 21.515 20-24 22.485 28.794999999999998 27.744999999999997 20.974999999999998 25-29 23.125 27.794999999999998 28.060000000000002 21.02 30-34 22.705000000000002 28.18 27.900000000000002 21.215 35-39 23.61 27.47 28.175 20.745 40-44 22.695 28.549999999999997 28.185 20.57 45-49 23.395 27.975 27.985 20.645 50-54 22.64 28.194999999999997 28.310000000000002 20.855 55-59 23.26 27.905 27.975 20.86 60-64 23.075000000000003 27.99 28.03 20.905 65-69 23.61 27.55 27.785 21.055 70-74 23.305 27.534999999999997 27.985 21.175 75-79 23.855 27.785 27.315 21.044999999999998 80-84 22.955000000000002 28.335 27.815 20.895 85-89 24.610000000000003 27.735 27.435 20.22 90-94 24.04 28.244999999999997 27.07 20.645 95-99 23.825 28.194999999999997 27.36 20.62 100-104 25.0 27.99 26.775 20.235 105-109 24.38 27.894999999999996 27.115000000000002 20.61 110-114 25.240000000000002 27.534999999999997 27.67 19.555 115-119 25.474999999999998 28.349999999999998 26.795 19.38 120-124 25.119999999999997 28.255000000000003 27.029999999999998 19.595000000000002 125-129 25.724999999999998 27.63 26.790000000000003 19.855 130-134 26.045 28.215 26.31 19.43 135-139 26.265 28.21 26.02 19.505 140-144 28.03 27.029999999999998 25.535000000000004 19.405 145-149 28.89 27.395000000000003 25.665 18.05 150-151 29.6875 27.025 24.85 18.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 2.0 16 2.5 17 1.5 18 1.0 19 0.5 20 0.5 21 2.0 22 3.0 23 3.5 24 3.5 25 3.5 26 4.5 27 5.5 28 6.5 29 14.0 30 24.0 31 26.5 32 29.5 33 41.0 34 49.0 35 61.5 36 79.0 37 92.0 38 109.5 39 154.0 40 210.0 41 245.5 42 245.5 43 254.5 44 279.0 45 278.0 46 274.0 47 270.5 48 230.0 49 189.5 50 162.0 51 131.0 52 110.5 53 86.0 54 80.5 55 61.0 56 36.0 57 33.0 58 25.0 59 20.0 60 14.5 61 8.0 62 7.0 63 4.0 64 3.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.375 #Duplication Level Percentage of deduplicated Percentage of total 1 92.85520974289581 85.775 2 6.387009472259811 11.799999999999999 3 0.5953991880920162 1.6500000000000001 4 0.05412719891745603 0.2 5 0.08119079837618402 0.375 6 0.0 0.0 7 0.0 0.0 8 0.027063599458728015 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CTCAGGATACCAAGCCTCAAAGGACGATCTCACTGTTTTTACAGCATTTT 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2125 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.48750000000000004 0.0 0.0 0.0 0.0 72-73 0.6125 0.0 0.0 0.0 0.0 74-75 0.7375 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 1.0625 0.0 0.0 0.0 0.0 82-83 1.25 0.0 0.0 0.0 0.0 84-85 1.4 0.0 0.0 0.0 0.0 86-87 1.6375000000000002 0.0 0.0 0.0 0.0 88-89 1.9625000000000001 0.0 0.0 0.0 0.0 90-91 2.2375 0.0 0.0 0.0 0.0 92-93 2.5625 0.0 0.0 0.0 0.0 94-95 2.9749999999999996 0.0 0.0 0.0 0.0 96-97 3.425 0.0 0.0 0.0 0.0 98-99 3.9625 0.0 0.0 0.0 0.0 100-101 4.300000000000001 0.0 0.0 0.0 0.0 102-103 4.675000000000001 0.0 0.0 0.0 0.0 104-105 5.262499999999999 0.0 0.0 0.0 0.0 106-107 5.6375 0.0 0.0 0.0 0.0 108-109 6.05 0.0 0.0 0.0 0.0 110-111 6.5 0.0 0.0 0.0 0.0 112-113 6.9625 0.0 0.0 0.0 0.0 114-115 7.375 0.0 0.0 0.0 0.0 116-117 7.762499999999999 0.0 0.0 0.0 0.0 118-119 8.1625 0.0 0.0 0.0 0.0 120-121 8.787500000000001 0.0 0.0 0.0 0.0 122-123 9.3125 0.0 0.0 0.0 0.0 124-125 10.0375 0.0 0.0 0.0 0.0 126-127 10.7375 0.0 0.0 0.0 0.0 128-129 11.399999999999999 0.0 0.0 0.0 0.0 130-131 11.9 0.0 0.0 0.0 0.0 132-133 12.4375 0.0 0.0 0.0 0.0 134-135 12.925 0.0 0.0 0.0 0.0 136-137 13.6375 0.0 0.0 0.0 0.0 138-139 14.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTTA 10 0.006830828 145.0 2 GTTTCTT 10 0.006830828 145.0 1 TTACAAC 10 0.006830828 145.0 6 GCAAAGG 10 0.006830828 145.0 6 TTCTTAC 10 0.006830828 145.0 3 TCTTACA 10 0.006830828 145.0 4 ACAACAA 25 8.7132835E-4 87.0 8 GGGGGGG 90 1.0830317E-6 16.11111 140-144 >>END_MODULE Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629933 spots for SRR12917508.sra Written 629933 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra Read 629924 spots for SRR12917508.sra Written 629924 spots for SRR12917508.sra SRR ids: ['SRR12917508.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2scr37nn SRR12917508.sra spots: 12598489 blocks: [[1, 629924], [629925, 1259848], [1259849, 1889772], [1889773, 2519696], [2519697, 3149620], [3149621, 3779544], [3779545, 4409468], [4409469, 5039392], [5039393, 5669316], [5669317, 6299240], [6299241, 6929164], [6929165, 7559088], [7559089, 8189012], [8189013, 8818936], [8818937, 9448860], [9448861, 10078784], [10078785, 10708708], [10708709, 11338632], [11338633, 11968556], [11968557, 12598489]] SRR12917508 file size 4259817 SRR12917508 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917508 SRR12917508_1.fastq SRR12917508_2.fastq Input file: SRR12917508_1.fastq Paired file: SRR12917508_2.fastq trimmed: SRR12917508-trimmed-pair1.fastq, SRR12917508-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:40:08 2025 >> started Thu Feb 13 06:40:21 2025 >> done (13.427s) 12598489 read pairs processed; of these: 123 ( 0.00%) short read pairs filtered out after trimming by size control 1435 ( 0.01%) empty read pairs filtered out after trimming by size control 12596931 (99.99%) read pairs available; of these: 2453537 (19.48%) trimmed read pairs available after processing 10143394 (80.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 11 0.00% 21 6 0.00% 22 15 0.00% 23 10 0.00% 24 17 0.00% 25 13 0.00% 26 16 0.00% 27 11 0.00% 28 20 0.00% 29 24 0.00% 30 16 0.00% 31 20 0.00% 32 31 0.00% 33 21 0.00% 34 25 0.00% 35 32 0.00% 36 29 0.00% 37 32 0.00% 38 34 0.00% 39 34 0.00% 40 46 0.00% 41 64 0.00% 42 68 0.00% 43 63 0.00% 44 95 0.00% 45 92 0.00% 46 92 0.00% 47 133 0.00% 48 152 0.00% 49 183 0.00% 50 235 0.00% 51 290 0.00% 52 362 0.00% 53 377 0.00% 54 463 0.00% 55 496 0.00% 56 594 0.00% 57 711 0.01% 58 798 0.01% 59 903 0.01% 60 1122 0.01% 61 1356 0.01% 62 1628 0.01% 63 1694 0.01% 64 2075 0.02% 65 2266 0.02% 66 2440 0.02% 67 2891 0.02% 68 3182 0.03% 69 3778 0.03% 70 4406 0.03% 71 4845 0.04% 72 5475 0.04% 73 6087 0.05% 74 6720 0.05% 75 7459 0.06% 76 7936 0.06% 77 8532 0.07% 78 9395 0.07% 79 10083 0.08% 80 10401 0.08% 81 11529 0.09% 82 12741 0.10% 83 13378 0.11% 84 14598 0.12% 85 15423 0.12% 86 15928 0.13% 87 16698 0.13% 88 17398 0.14% 89 17897 0.14% 90 18848 0.15% 91 19358 0.15% 92 20290 0.16% 93 21518 0.17% 94 22374 0.18% 95 23235 0.18% 96 24557 0.19% 97 24637 0.20% 98 25026 0.20% 99 25969 0.21% 100 26360 0.21% 101 26618 0.21% 102 27749 0.22% 103 28424 0.23% 104 28894 0.23% 105 29879 0.24% 106 30704 0.24% 107 31276 0.25% 108 32027 0.25% 109 32157 0.26% 110 32419 0.26% 111 32806 0.26% 112 33176 0.26% 113 33588 0.27% 114 34602 0.27% 115 35419 0.28% 116 36242 0.29% 117 37084 0.29% 118 36928 0.29% 119 37374 0.30% 120 38234 0.30% 121 38153 0.30% 122 38442 0.31% 123 39267 0.31% 124 39431 0.31% 125 39732 0.32% 126 40918 0.32% 127 41269 0.33% 128 41609 0.33% 129 42383 0.34% 130 42612 0.34% 131 42194 0.33% 132 42956 0.34% 133 42668 0.34% 134 42472 0.34% 135 43438 0.34% 136 44115 0.35% 137 43482 0.35% 138 44377 0.35% 139 45114 0.36% 140 45058 0.36% 141 45459 0.36% 142 45468 0.36% 143 44902 0.36% 144 46240 0.37% 145 46169 0.37% 146 45481 0.36% 147 45958 0.36% 148 46497 0.37% 149 46347 0.37% 150 47551 0.38% 151 10143394 80.52% 12596931 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=376.08 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=0.47 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=72.48 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.4 sequence=ACACAGAGAACACATTCATAC SRR12917508 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:41:09 Started mapping on | Feb 13 06:41:09 Finished on | Feb 13 06:42:29 Mapping speed, Million of reads per hour | 566.86 Number of input reads | 12596931 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11740092 Uniquely mapped reads % | 93.20% Average mapped length | 288.05 Number of splices: Total | 11281252 Number of splices: Annotated (sjdb) | 11011710 Number of splices: GT/AG | 11058901 Number of splices: GC/AG | 174817 Number of splices: AT/AC | 8152 Number of splices: Non-canonical | 39382 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284982 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 35000 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 571857 571857 571857 N_multimapping 284982 284982 284982 N_noFeature 423218 11583339 491128 N_ambiguous 174682 707 85404 UnstrandedReadsAssigned:11142192 PositiveStrandReadsAssigned:156046 NegativeStrandReadsAssigned:11163560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917508 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917508-trimmed-pair1.fastq SRR12917508-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,596,931 reads, 11,234,057 reads pseudoaligned [quant] estimated average fragment length: 238.754 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR12917508.ke.tsv 34699 SRR12917508.se.tsv 87100 total ==> SRR12917508.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.25 397 20.5453 Potri.005G024800.1.v4.1 1035 797.246 532 61.4781 Potri.004G059700.1.v4.1 961 723.378 29 3.69346 Potri.007G009000.2.v4.1 1416 1178.25 0 0 Potri.003G141000.2.v4.1 2943 2705.25 474 16.1426 Potri.016G087400.1.v4.1 270 102.441 767.419 690.174 Potri.015G069301.1.v4.1 564 341.796 0 0 Potri.010G195200.1.v4.1 1773 1535.25 77 4.62077 Potri.012G127500.1.v4.1 977 739.296 1389 173.095 ==> SRR12917508.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12917508 completed mapping pipeline successfully