Starting /dee2/code/volunteer_pipeline.sh SRR12917509 current disk space = 3052672827392 free memory = 1580042988 SRR12917509 SRAfilesize 34eecbe22d4cb56e32addf020ddde478 SRR12917509.sra SRR12917509.sra file validated SRR12917509 is paired end SRR12917509 is conventional basespace SRR12917509 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.691 37.0 37.0 37.0 37.0 37.0 2 36.6025 37.0 37.0 37.0 37.0 37.0 3 36.7485 37.0 37.0 37.0 37.0 37.0 4 36.697 37.0 37.0 37.0 37.0 37.0 5 36.7375 37.0 37.0 37.0 37.0 37.0 6 36.715 37.0 37.0 37.0 37.0 37.0 7 36.5955 37.0 37.0 37.0 37.0 37.0 8 36.6285 37.0 37.0 37.0 37.0 37.0 9 36.664 37.0 37.0 37.0 37.0 37.0 10-14 36.71130000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6605 37.0 37.0 37.0 37.0 37.0 20-24 36.6293 37.0 37.0 37.0 37.0 37.0 25-29 36.5875 37.0 37.0 37.0 37.0 37.0 30-34 36.5531 37.0 37.0 37.0 37.0 37.0 35-39 36.54129999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.5699 37.0 37.0 37.0 37.0 37.0 45-49 36.4711 37.0 37.0 37.0 37.0 37.0 50-54 36.5001 37.0 37.0 37.0 37.0 37.0 55-59 36.4863 37.0 37.0 37.0 37.0 37.0 60-64 36.4048 37.0 37.0 37.0 37.0 37.0 65-69 36.3214 37.0 37.0 37.0 37.0 37.0 70-74 36.4148 37.0 37.0 37.0 37.0 37.0 75-79 36.3985 37.0 37.0 37.0 37.0 37.0 80-84 36.3883 37.0 37.0 37.0 37.0 37.0 85-89 36.3731 37.0 37.0 37.0 37.0 37.0 90-94 36.3169 37.0 37.0 37.0 37.0 37.0 95-99 36.294500000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2606 37.0 37.0 37.0 37.0 37.0 105-109 36.2024 37.0 37.0 37.0 37.0 37.0 110-114 36.20120000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1356 37.0 37.0 37.0 37.0 37.0 120-124 36.1546 37.0 37.0 37.0 37.0 37.0 125-129 36.0209 37.0 37.0 37.0 37.0 37.0 130-134 36.018899999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.8523 37.0 37.0 37.0 37.0 37.0 140-144 35.707800000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.486000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.162499999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 2.0 27 8.0 28 10.0 29 12.0 30 23.0 31 33.0 32 46.0 33 61.0 34 116.0 35 275.0 36 3064.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.775 15.55 5.0 45.675 2 18.15 12.65 39.65 29.549999999999997 3 16.650000000000002 16.400000000000002 28.7 38.25 4 21.099999999999998 23.925 22.525000000000002 32.45 5 23.3 30.225 23.7 22.775000000000002 6 20.3 35.3 23.200000000000003 21.2 7 14.575 30.599999999999998 39.25 15.575 8 16.125 26.450000000000003 35.025 22.400000000000002 9 16.675 25.1 34.2 24.025 10-14 19.215 31.730000000000004 27.47 21.584999999999997 15-19 20.265 29.325000000000003 27.084999999999997 23.325000000000003 20-24 19.555 29.98 27.339999999999996 23.125 25-29 20.175 29.525000000000002 27.189999999999998 23.11 30-34 19.39 30.159999999999997 26.76 23.69 35-39 19.275000000000002 29.555 26.645000000000003 24.525 40-44 20.115 29.7 26.424999999999997 23.76 45-49 19.93 29.085 27.22 23.765 50-54 20.185 28.860000000000003 27.115000000000002 23.84 55-59 20.0 28.845 27.43 23.724999999999998 60-64 20.945 28.525 26.669999999999998 23.86 65-69 20.345 28.884999999999998 27.185 23.585 70-74 19.715 29.09 27.66 23.535 75-79 19.915 28.575 27.175 24.335 80-84 19.86 28.860000000000003 27.04 24.240000000000002 85-89 20.315 29.115000000000002 26.72 23.849999999999998 90-94 21.22 28.465 26.974999999999998 23.34 95-99 20.575 28.17 27.46 23.794999999999998 100-104 21.535 29.57 26.16 22.735 105-109 20.955 28.005000000000003 26.695 24.345 110-114 21.455 28.485 26.484999999999996 23.575 115-119 21.315 27.975 26.71 24.0 120-124 21.525 27.834999999999997 26.419999999999998 24.22 125-129 21.355 28.155 26.625 23.865 130-134 21.495 28.815 25.835 23.855 135-139 21.115000000000002 28.34 26.840000000000003 23.705000000000002 140-144 21.595 28.185 25.650000000000002 24.57 145-149 21.41 28.395 25.564999999999998 24.63 150-151 22.1875 28.375 25.275 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 2.5 23 3.0 24 1.0 25 3.0 26 4.0 27 9.5 28 16.5 29 15.5 30 25.5 31 38.5 32 46.0 33 51.0 34 61.0 35 80.5 36 104.0 37 124.0 38 148.5 39 169.5 40 172.0 41 185.0 42 210.0 43 229.0 44 231.0 45 237.0 46 240.0 47 233.0 48 229.5 49 210.0 50 193.0 51 165.5 52 115.0 53 105.5 54 97.5 55 68.5 56 51.0 57 32.0 58 20.0 59 17.0 60 13.0 61 7.0 62 7.5 63 6.5 64 4.0 65 3.5 66 4.5 67 4.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 92.020697167756 84.475 2 7.18954248366013 13.200000000000001 3 0.6535947712418301 1.7999999999999998 4 0.10893246187363835 0.4 5 0.027233115468409588 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.8499999999999996 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.5875 0.0 0.0 0.0 0.0 112-113 4.1125 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.425 0.0 0.0 0.0 0.0 120-121 5.9875 0.0 0.0 0.0 0.0 122-123 6.45 0.0 0.0 0.0 0.0 124-125 6.887499999999999 0.0 0.0 0.0 0.0 126-127 7.425 0.0 0.0 0.0 0.0 128-129 8.1 0.0 0.0 0.0 0.0 130-131 8.975000000000001 0.0 0.0 0.0 0.0 132-133 9.912500000000001 0.0 0.0 0.0 0.0 134-135 10.787500000000001 0.0 0.0 0.0 0.0 136-137 11.649999999999999 0.0 0.0 0.0 0.0 138-139 12.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 2.9585467E-4 21.75 15-19 >>END_MODULE SRR12917509 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917509_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5275 37.0 37.0 37.0 37.0 37.0 2 36.551 37.0 37.0 37.0 37.0 37.0 3 36.4865 37.0 37.0 37.0 37.0 37.0 4 36.603 37.0 37.0 37.0 37.0 37.0 5 36.617 37.0 37.0 37.0 37.0 37.0 6 36.5345 37.0 37.0 37.0 37.0 37.0 7 36.5605 37.0 37.0 37.0 37.0 37.0 8 36.6595 37.0 37.0 37.0 37.0 37.0 9 36.612 37.0 37.0 37.0 37.0 37.0 10-14 36.5976 37.0 37.0 37.0 37.0 37.0 15-19 36.5601 37.0 37.0 37.0 37.0 37.0 20-24 36.533100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4686 37.0 37.0 37.0 37.0 37.0 30-34 36.44840000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3623 37.0 37.0 37.0 37.0 37.0 40-44 36.4023 37.0 37.0 37.0 37.0 37.0 45-49 36.3145 37.0 37.0 37.0 37.0 37.0 50-54 36.3227 37.0 37.0 37.0 37.0 37.0 55-59 36.3361 37.0 37.0 37.0 37.0 37.0 60-64 36.295399999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.2895 37.0 37.0 37.0 37.0 37.0 70-74 36.3138 37.0 37.0 37.0 37.0 37.0 75-79 36.2391 37.0 37.0 37.0 37.0 37.0 80-84 36.2189 37.0 37.0 37.0 37.0 37.0 85-89 36.2168 37.0 37.0 37.0 37.0 37.0 90-94 36.2635 37.0 37.0 37.0 37.0 37.0 95-99 36.205200000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1789 37.0 37.0 37.0 37.0 37.0 105-109 36.1378 37.0 37.0 37.0 37.0 37.0 110-114 36.1339 37.0 37.0 37.0 37.0 37.0 115-119 36.0305 37.0 37.0 37.0 37.0 37.0 120-124 35.9372 37.0 37.0 37.0 37.0 37.0 125-129 35.94579999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8192 37.0 37.0 37.0 37.0 37.0 135-139 35.7298 37.0 37.0 37.0 37.0 37.0 140-144 35.5141 37.0 37.0 37.0 37.0 37.0 145-149 35.4094 37.0 37.0 37.0 34.6 37.0 150-151 34.89675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 0.0 18 0.0 19 1.0 20 2.0 21 0.0 22 1.0 23 3.0 24 3.0 25 4.0 26 3.0 27 4.0 28 4.0 29 15.0 30 19.0 31 23.0 32 35.0 33 69.0 34 136.0 35 428.0 36 2954.0 37 293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.1 26.05 9.675 31.175000000000004 2 25.900000000000002 22.95 35.0 16.150000000000002 3 19.15 25.8 35.15 19.900000000000002 4 23.875 30.85 26.375 18.9 5 26.174999999999997 36.6 21.8 15.425 6 20.724999999999998 40.65 21.349999999999998 17.275 7 20.974999999999998 22.55 38.574999999999996 17.9 8 21.05 25.374999999999996 29.775000000000002 23.799999999999997 9 21.55 24.025 31.05 23.375 10-14 23.77 28.87 26.35 21.01 15-19 23.84 27.295 27.405 21.46 20-24 24.14 28.105000000000004 26.91 20.845 25-29 23.49 27.805000000000003 27.22 21.485000000000003 30-34 23.685000000000002 28.015 27.639999999999997 20.66 35-39 23.43 27.965 27.33 21.275 40-44 23.655 27.855 27.355 21.135 45-49 23.335 27.365000000000002 28.139999999999997 21.16 50-54 23.18 27.150000000000002 28.449999999999996 21.22 55-59 23.45 27.405 27.750000000000004 21.395 60-64 24.095 26.950000000000003 27.915 21.04 65-69 23.645 27.38 27.73 21.245 70-74 24.065 27.67 27.365000000000002 20.9 75-79 23.355 27.839999999999996 27.805000000000003 21.0 80-84 23.69 27.42 27.875 21.015 85-89 23.66 27.51 27.375 21.455 90-94 24.154999999999998 27.515 27.62 20.71 95-99 24.095 27.48 27.915 20.51 100-104 24.515 26.974999999999998 27.87 20.64 105-109 24.625 27.495000000000005 27.525 20.355 110-114 24.01 28.185 27.534999999999997 20.27 115-119 24.965 27.185 27.49 20.36 120-124 25.069999999999997 27.950000000000003 26.905 20.075000000000003 125-129 25.135 27.615000000000002 27.205000000000002 20.044999999999998 130-134 25.91 27.61 26.795 19.685 135-139 26.165 27.395000000000003 26.85 19.59 140-144 26.51 27.700000000000003 25.995 19.794999999999998 145-149 27.735 27.57 25.435000000000002 19.259999999999998 150-151 28.212500000000002 27.5625 26.387500000000003 17.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 2.0 26 5.5 27 4.5 28 3.0 29 8.0 30 10.5 31 16.0 32 25.0 33 31.0 34 44.5 35 54.0 36 71.5 37 110.5 38 127.5 39 149.0 40 191.5 41 208.5 42 238.5 43 261.5 44 239.0 45 252.0 46 270.5 47 270.5 48 248.0 49 205.0 50 183.0 51 151.5 52 123.5 53 112.5 54 99.0 55 79.0 56 54.5 57 42.0 58 38.5 59 22.5 60 12.0 61 7.5 62 4.5 63 4.5 64 3.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 92.11956521739131 84.75 2 7.119565217391305 13.100000000000001 3 0.7065217391304348 1.95 4 0.05434782608695652 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.15 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.45 0.0 0.0 0.0 0.0 120-121 6.0125 0.0 0.0 0.0 0.0 122-123 6.487500000000001 0.0 0.0 0.0 0.0 124-125 6.9125 0.0 0.0 0.0 0.0 126-127 7.45 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.9875 0.0 0.0 0.0 0.0 132-133 9.912500000000001 0.0 0.0 0.0 0.0 134-135 10.787500000000001 0.0 0.0 0.0 0.0 136-137 11.649999999999999 0.0 0.0 0.0 0.0 138-139 12.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACCAA 10 0.006830828 145.0 6 ACTACCA 10 0.006830828 145.0 5 >>END_MODULE Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra Read 513194 spots for SRR12917509.sra Written 513194 spots for SRR12917509.sra Read 513178 spots for SRR12917509.sra Written 513178 spots for SRR12917509.sra SRR ids: ['SRR12917509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7_fljcpu SRR12917509.sra spots: 10263576 blocks: [[1, 513178], [513179, 1026356], [1026357, 1539534], [1539535, 2052712], [2052713, 2565890], [2565891, 3079068], [3079069, 3592246], [3592247, 4105424], [4105425, 4618602], [4618603, 5131780], [5131781, 5644958], [5644959, 6158136], [6158137, 6671314], [6671315, 7184492], [7184493, 7697670], [7697671, 8210848], [8210849, 8724026], [8724027, 9237204], [9237205, 9750382], [9750383, 10263576]] SRR12917509 file size 3466311 SRR12917509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917509 SRR12917509_1.fastq SRR12917509_2.fastq Input file: SRR12917509_1.fastq Paired file: SRR12917509_2.fastq trimmed: SRR12917509-trimmed-pair1.fastq, SRR12917509-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:24:58 2025 >> started Thu Feb 13 08:28:02 2025 >> done (184.377s) 10263576 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 4931 ( 0.05%) empty read pairs filtered out after trimming by size control 10258594 (99.95%) read pairs available; of these: 1979374 (19.29%) trimmed read pairs available after processing 8279220 (80.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 7 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 12 0.00% 25 8 0.00% 26 10 0.00% 27 9 0.00% 28 6 0.00% 29 14 0.00% 30 9 0.00% 31 11 0.00% 32 21 0.00% 33 18 0.00% 34 16 0.00% 35 15 0.00% 36 15 0.00% 37 18 0.00% 38 33 0.00% 39 31 0.00% 40 36 0.00% 41 39 0.00% 42 44 0.00% 43 44 0.00% 44 55 0.00% 45 45 0.00% 46 58 0.00% 47 62 0.00% 48 95 0.00% 49 107 0.00% 50 89 0.00% 51 96 0.00% 52 136 0.00% 53 146 0.00% 54 152 0.00% 55 154 0.00% 56 195 0.00% 57 203 0.00% 58 249 0.00% 59 309 0.00% 60 361 0.00% 61 412 0.00% 62 514 0.01% 63 543 0.01% 64 629 0.01% 65 705 0.01% 66 755 0.01% 67 817 0.01% 68 920 0.01% 69 1037 0.01% 70 1230 0.01% 71 1464 0.01% 72 1640 0.02% 73 1905 0.02% 74 2299 0.02% 75 2470 0.02% 76 2666 0.03% 77 2904 0.03% 78 3134 0.03% 79 3652 0.04% 80 3970 0.04% 81 4340 0.04% 82 4939 0.05% 83 5232 0.05% 84 6151 0.06% 85 6396 0.06% 86 7122 0.07% 87 7645 0.07% 88 7905 0.08% 89 8466 0.08% 90 8908 0.09% 91 9547 0.09% 92 10082 0.10% 93 10926 0.11% 94 11728 0.11% 95 12846 0.13% 96 13422 0.13% 97 14255 0.14% 98 14850 0.14% 99 15243 0.15% 100 15535 0.15% 101 15998 0.16% 102 16925 0.16% 103 17789 0.17% 104 18750 0.18% 105 19594 0.19% 106 20721 0.20% 107 21751 0.21% 108 22209 0.22% 109 22938 0.22% 110 23457 0.23% 111 23924 0.23% 112 24613 0.24% 113 25045 0.24% 114 26042 0.25% 115 27767 0.27% 116 28539 0.28% 117 29205 0.28% 118 30549 0.30% 119 31057 0.30% 120 31524 0.31% 121 32091 0.31% 122 32463 0.32% 123 32504 0.32% 124 34231 0.33% 125 34347 0.33% 126 35644 0.35% 127 37325 0.36% 128 37952 0.37% 129 39289 0.38% 130 39815 0.39% 131 40119 0.39% 132 40433 0.39% 133 41030 0.40% 134 41518 0.40% 135 41803 0.41% 136 43020 0.42% 137 44102 0.43% 138 44797 0.44% 139 46041 0.45% 140 46704 0.46% 141 46408 0.45% 142 47182 0.46% 143 46898 0.46% 144 46994 0.46% 145 47580 0.46% 146 47979 0.47% 147 48082 0.47% 148 50260 0.49% 149 50768 0.49% 150 51445 0.50% 151 8279220 80.71% 10258594 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=35 prefix-density=0.57 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=46.31 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.8 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=97.09 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12917509 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:25:06 Started mapping on | Feb 13 09:25:31 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 6.15 Number of input reads | 10258594 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 9770931 Uniquely mapped reads % | 95.25% Average mapped length | 290.98 Number of splices: Total | 8180777 Number of splices: Annotated (sjdb) | 8045896 Number of splices: GT/AG | 7979736 Number of splices: GC/AG | 173635 Number of splices: AT/AC | 6187 Number of splices: Non-canonical | 21219 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310046 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 33833 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 177617 177617 177617 N_multimapping 310046 310046 310046 N_noFeature 222394 9630946 262658 N_ambiguous 164627 541 64633 UnstrandedReadsAssigned:9383910 PositiveStrandReadsAssigned:139444 NegativeStrandReadsAssigned:9443640 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917509 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917509-trimmed-pair1.fastq SRR12917509-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,258,594 reads, 9,571,662 reads pseudoaligned [quant] estimated average fragment length: 214.031 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,263 rounds 52401 SRR12917509.ke.tsv 34699 SRR12917509.se.tsv 87100 total ==> SRR12917509.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.97 144 7.00019 Potri.005G024800.1.v4.1 1035 821.969 134 14.3043 Potri.004G059700.1.v4.1 961 747.994 14 1.64228 Potri.007G009000.2.v4.1 1416 1202.97 0 0 Potri.003G141000.2.v4.1 2943 2729.97 265 8.51737 Potri.016G087400.1.v4.1 270 95.7278 823 754.36 Potri.015G069301.1.v4.1 564 355.481 0 0 Potri.010G195200.1.v4.1 1773 1559.97 7 0.393731 Potri.012G127500.1.v4.1 977 763.989 364 41.8053 ==> SRR12917509.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12917509 completed mapping pipeline successfully