Starting /dee2/code/volunteer_pipeline.sh SRR12917510 current disk space = 3052792434688 free memory = 1579875676 SRR12917510 SRAfilesize 4d86a9904f8e12d8016e17318e030df4 SRR12917510.sra SRR12917510.sra file validated SRR12917510 is paired end SRR12917510 is conventional basespace SRR12917510 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917510_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63575 37.0 37.0 37.0 37.0 37.0 2 36.495 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.6835 37.0 37.0 37.0 37.0 37.0 5 36.679 37.0 37.0 37.0 37.0 37.0 6 36.694 37.0 37.0 37.0 37.0 37.0 7 36.601 37.0 37.0 37.0 37.0 37.0 8 36.625 37.0 37.0 37.0 37.0 37.0 9 36.64 37.0 37.0 37.0 37.0 37.0 10-14 36.6346 37.0 37.0 37.0 37.0 37.0 15-19 36.619099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.6092 37.0 37.0 37.0 37.0 37.0 25-29 36.544799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.509699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5184 37.0 37.0 37.0 37.0 37.0 40-44 36.516000000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4924 37.0 37.0 37.0 37.0 37.0 50-54 36.4665 37.0 37.0 37.0 37.0 37.0 55-59 36.454899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.406600000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.346999999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.35209999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3688 37.0 37.0 37.0 37.0 37.0 80-84 36.3514 37.0 37.0 37.0 37.0 37.0 85-89 36.3527 37.0 37.0 37.0 37.0 37.0 90-94 36.3454 37.0 37.0 37.0 37.0 37.0 95-99 36.2385 37.0 37.0 37.0 37.0 37.0 100-104 36.172 37.0 37.0 37.0 37.0 37.0 105-109 36.1804 37.0 37.0 37.0 37.0 37.0 110-114 36.1816 37.0 37.0 37.0 37.0 37.0 115-119 36.096199999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0927 37.0 37.0 37.0 37.0 37.0 125-129 36.00269999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.970600000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8575 37.0 37.0 37.0 37.0 37.0 140-144 35.75699999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.714999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.49875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 0.0 25 3.0 26 6.0 27 6.0 28 7.0 29 11.0 30 22.0 31 28.0 32 50.0 33 48.0 34 106.0 35 324.0 36 3055.0 37 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.51087771942986 13.053263315828959 3.9259814953738434 39.509877469367346 2 17.275 11.924999999999999 40.6 30.2 3 16.425 15.325 29.299999999999997 38.95 4 23.674999999999997 21.45 23.95 30.925000000000004 5 23.075000000000003 30.4 25.324999999999996 21.2 6 19.400000000000002 33.1 24.025 23.474999999999998 7 15.375 27.625 41.675000000000004 15.325 8 16.1 25.8 33.575 24.525 9 17.5 23.474999999999998 34.775 24.25 10-14 19.7 29.845 27.515 22.939999999999998 15-19 19.695 28.22 28.37 23.715 20-24 20.09 27.71 28.299999999999997 23.9 25-29 19.8 28.02 28.12 24.060000000000002 30-34 19.81 28.185 27.83 24.175 35-39 19.925 27.68 28.26 24.135 40-44 20.07 28.575 27.735 23.62 45-49 20.145 28.68 28.01 23.165 50-54 20.195 27.985 27.925 23.895 55-59 19.715 28.49 28.185 23.61 60-64 20.25 28.189999999999998 27.605 23.955000000000002 65-69 20.125 27.61 27.93 24.335 70-74 20.055 28.64 27.785 23.52 75-79 20.24 28.09 27.51 24.16 80-84 20.380000000000003 28.015 28.1 23.505000000000003 85-89 20.169999999999998 27.884999999999998 27.91 24.035 90-94 20.355 28.335 27.405 23.905 95-99 20.65 28.384999999999998 27.384999999999998 23.580000000000002 100-104 20.64 28.345 27.48 23.535 105-109 20.69 28.035 27.295 23.98 110-114 20.19 28.12 27.83 23.86 115-119 20.315 27.72 28.33 23.635 120-124 20.435 27.77 27.485 24.310000000000002 125-129 20.849999999999998 27.939999999999998 27.435 23.775 130-134 20.979999999999997 27.675 27.575 23.77 135-139 21.015 27.810000000000002 27.345000000000002 23.830000000000002 140-144 21.485000000000003 27.785 27.445000000000004 23.285 145-149 20.73 27.76 27.235 24.275 150-151 21.224999999999998 27.737499999999997 26.8625 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 4.5 25 5.0 26 5.5 27 7.5 28 12.0 29 14.0 30 12.0 31 21.0 32 32.0 33 41.0 34 46.5 35 65.0 36 93.0 37 102.5 38 126.5 39 169.5 40 196.0 41 208.0 42 235.5 43 259.5 44 255.0 45 254.5 46 263.5 47 260.5 48 244.0 49 204.5 50 154.5 51 144.0 52 126.0 53 93.5 54 79.5 55 61.0 56 52.0 57 39.5 58 24.5 59 21.5 60 19.0 61 13.5 62 8.0 63 4.5 64 4.5 65 4.0 66 2.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.46557011430164 81.125 2 7.945358238081962 14.249999999999998 3 1.3381655979927516 3.5999999999999996 4 0.16727069974909395 0.6 5 0.05575689991636465 0.25 6 0.0 0.0 7 0.027878449958182325 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGCGGTGGAGCGGCACCGGACAATGGAGGCAGAAGGCAAGCGGAGGGT 7 0.17500000000000002 No Hit CGGCATGATGACCGGAGGCTATCCATATGATAGTTGTCAGGGTTTCAATA 5 0.125 No Hit GCTGACATACGATGAGCTTAGACTGTTCAACTGCCAAGATAATCCTAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.0875000000000004 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.7 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 5.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCAAG 10 0.006830828 145.0 3 >>END_MODULE SRR12917510 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917510_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3885 37.0 37.0 37.0 37.0 37.0 2 36.1555 37.0 37.0 37.0 37.0 37.0 3 36.1915 37.0 37.0 37.0 37.0 37.0 4 36.163 37.0 37.0 37.0 37.0 37.0 5 36.383 37.0 37.0 37.0 37.0 37.0 6 36.3785 37.0 37.0 37.0 37.0 37.0 7 36.3035 37.0 37.0 37.0 37.0 37.0 8 36.355 37.0 37.0 37.0 37.0 37.0 9 36.364 37.0 37.0 37.0 37.0 37.0 10-14 36.317400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.2678 37.0 37.0 37.0 37.0 37.0 20-24 36.195100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.109 37.0 37.0 37.0 37.0 37.0 30-34 36.067099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.046 37.0 37.0 37.0 37.0 37.0 40-44 36.075599999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9704 37.0 37.0 37.0 37.0 37.0 50-54 35.9374 37.0 37.0 37.0 37.0 37.0 55-59 35.940799999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9167 37.0 37.0 37.0 37.0 37.0 65-69 35.8656 37.0 37.0 37.0 37.0 37.0 70-74 35.8488 37.0 37.0 37.0 37.0 37.0 75-79 35.7753 37.0 37.0 37.0 37.0 37.0 80-84 35.7832 37.0 37.0 37.0 37.0 37.0 85-89 35.81570000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.7783 37.0 37.0 37.0 37.0 37.0 95-99 35.785700000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.72189999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.6891 37.0 37.0 37.0 37.0 37.0 110-114 35.671099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.5919 37.0 37.0 37.0 37.0 37.0 120-124 35.4428 37.0 37.0 37.0 37.0 37.0 125-129 35.3611 37.0 37.0 37.0 37.0 37.0 130-134 35.3031 37.0 37.0 37.0 32.2 37.0 135-139 35.3447 37.0 37.0 37.0 34.6 37.0 140-144 35.0107 37.0 37.0 37.0 25.0 37.0 145-149 34.9731 37.0 37.0 37.0 25.0 37.0 150-151 34.37875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 3.0 16 4.0 17 2.0 18 0.0 19 2.0 20 1.0 21 2.0 22 2.0 23 3.0 24 6.0 25 8.0 26 8.0 27 10.0 28 12.0 29 15.0 30 29.0 31 43.0 32 73.0 33 116.0 34 219.0 35 662.0 36 2610.0 37 163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.324999999999996 28.299999999999997 8.175 24.2 2 27.150000000000002 23.775 34.0 15.075 3 20.05 26.224999999999998 34.35 19.375 4 23.925 34.2 23.474999999999998 18.4 5 24.625 38.324999999999996 21.05 16.0 6 20.674999999999997 40.1 21.8 17.424999999999997 7 20.775 23.225 37.15 18.85 8 17.8 27.375 30.025000000000002 24.8 9 21.224999999999998 23.325000000000003 31.775 23.674999999999997 10-14 22.735 29.310000000000002 27.33 20.625 15-19 22.46 27.85 28.249999999999996 21.44 20-24 23.125 28.13 28.27 20.474999999999998 25-29 23.599999999999998 27.88 27.855 20.665 30-34 23.035 28.189999999999998 27.794999999999998 20.979999999999997 35-39 23.035 28.065 27.860000000000003 21.04 40-44 22.45 28.455000000000002 28.060000000000002 21.035 45-49 22.09 27.38 28.675 21.855 50-54 22.855 27.815 27.96 21.37 55-59 22.96 28.53 27.705000000000002 20.805 60-64 22.605 27.77 28.599999999999998 21.025 65-69 23.705000000000002 27.02 28.305000000000003 20.97 70-74 23.669999999999998 27.715 27.205000000000002 21.41 75-79 23.494999999999997 28.53 27.295 20.68 80-84 23.28 28.115000000000002 27.27 21.335 85-89 23.544999999999998 27.935 27.21 21.310000000000002 90-94 23.555 27.825 27.544999999999998 21.075 95-99 23.465 28.044999999999998 27.485 21.005 100-104 23.810000000000002 27.875 27.500000000000004 20.815 105-109 23.965 28.065 27.474999999999998 20.495 110-114 24.04 27.815 27.395000000000003 20.75 115-119 24.175 28.42 26.97 20.435 120-124 24.97 27.495000000000005 27.05 20.485 125-129 24.865000000000002 27.43 27.089999999999996 20.615 130-134 25.155 27.529999999999998 27.295 20.02 135-139 25.124999999999996 27.139999999999997 27.389999999999997 20.345 140-144 25.105 28.625 26.75 19.52 145-149 25.995 26.974999999999998 26.77 20.26 150-151 25.575 29.1625 25.912499999999998 19.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 1.5 15 1.0 16 0.0 17 1.0 18 2.5 19 1.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 5.5 26 10.5 27 14.0 28 13.0 29 10.0 30 12.5 31 24.5 32 28.5 33 38.5 34 56.0 35 61.0 36 79.5 37 118.5 38 143.0 39 157.5 40 189.0 41 225.0 42 257.0 43 268.0 44 276.0 45 269.5 46 259.0 47 249.0 48 209.5 49 189.0 50 160.5 51 133.5 52 114.5 53 84.5 54 75.5 55 58.0 56 48.5 57 45.5 58 24.0 59 16.5 60 15.0 61 7.0 62 3.0 63 4.5 64 5.5 65 2.5 66 1.0 67 0.5 68 0.0 69 1.5 70 2.0 71 1.0 72 0.5 73 0.0 74 0.5 75 1.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.5 96 1.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42166992460207 80.95 2 8.154146886344597 14.6 3 1.0332309410779112 2.775 4 0.16755096341803966 0.6 5 0.16755096341803966 0.75 6 0.027925160569673275 0.15 7 0.027925160569673275 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTCCTATCAGCAAAAACAGAAAAAAGAAAGATGGCCTCGGCATCATTT 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit GCAGACTCAAGTCTCATTGTGTCTGATAATGAGCTCCAAGCATGGTGGAC 5 0.125 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit ATTTGTTCGATTACGCGGGGTGCGTTGCCAAATTGAGGACCGATAATGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.3875 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTG 10 0.006830828 145.0 4 >>END_MODULE Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517966 spots for SRR12917510.sra Written 517966 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra Read 517954 spots for SRR12917510.sra Written 517954 spots for SRR12917510.sra SRR ids: ['SRR12917510.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q9pl855b SRR12917510.sra spots: 10359092 blocks: [[1, 517954], [517955, 1035908], [1035909, 1553862], [1553863, 2071816], [2071817, 2589770], [2589771, 3107724], [3107725, 3625678], [3625679, 4143632], [4143633, 4661586], [4661587, 5179540], [5179541, 5697494], [5697495, 6215448], [6215449, 6733402], [6733403, 7251356], [7251357, 7769310], [7769311, 8287264], [8287265, 8805218], [8805219, 9323172], [9323173, 9841126], [9841127, 10359092]] SRR12917510 file size 3498772 SRR12917510 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917510 SRR12917510_1.fastq SRR12917510_2.fastq Input file: SRR12917510_1.fastq Paired file: SRR12917510_2.fastq trimmed: SRR12917510-trimmed-pair1.fastq, SRR12917510-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:50:12 2025 >> started Thu Feb 13 08:53:34 2025 >> done (202.583s) 10359092 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 1205 ( 0.01%) empty read pairs filtered out after trimming by size control 10357789 (99.99%) read pairs available; of these: 946447 ( 9.14%) trimmed read pairs available after processing 9411342 (90.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 4 0.00% 21 3 0.00% 22 10 0.00% 23 11 0.00% 24 9 0.00% 25 17 0.00% 26 13 0.00% 27 10 0.00% 28 10 0.00% 29 9 0.00% 30 10 0.00% 31 13 0.00% 32 13 0.00% 33 18 0.00% 34 22 0.00% 35 24 0.00% 36 16 0.00% 37 16 0.00% 38 16 0.00% 39 27 0.00% 40 37 0.00% 41 27 0.00% 42 31 0.00% 43 29 0.00% 44 26 0.00% 45 29 0.00% 46 36 0.00% 47 51 0.00% 48 52 0.00% 49 68 0.00% 50 71 0.00% 51 87 0.00% 52 72 0.00% 53 80 0.00% 54 104 0.00% 55 110 0.00% 56 113 0.00% 57 134 0.00% 58 154 0.00% 59 157 0.00% 60 197 0.00% 61 251 0.00% 62 276 0.00% 63 322 0.00% 64 359 0.00% 65 397 0.00% 66 429 0.00% 67 457 0.00% 68 575 0.01% 69 656 0.01% 70 711 0.01% 71 826 0.01% 72 936 0.01% 73 1166 0.01% 74 1277 0.01% 75 1343 0.01% 76 1409 0.01% 77 1562 0.02% 78 1793 0.02% 79 1916 0.02% 80 2000 0.02% 81 2284 0.02% 82 2511 0.02% 83 2775 0.03% 84 3103 0.03% 85 3116 0.03% 86 3580 0.03% 87 3772 0.04% 88 3918 0.04% 89 4004 0.04% 90 4309 0.04% 91 4410 0.04% 92 4870 0.05% 93 5106 0.05% 94 5549 0.05% 95 5878 0.06% 96 6194 0.06% 97 6542 0.06% 98 6658 0.06% 99 6895 0.07% 100 7238 0.07% 101 7183 0.07% 102 7476 0.07% 103 7952 0.08% 104 8399 0.08% 105 8675 0.08% 106 9250 0.09% 107 9712 0.09% 108 9934 0.10% 109 9954 0.10% 110 10118 0.10% 111 10506 0.10% 112 10763 0.10% 113 11100 0.11% 114 11425 0.11% 115 11959 0.12% 116 12791 0.12% 117 13127 0.13% 118 13894 0.13% 119 13839 0.13% 120 14210 0.14% 121 14425 0.14% 122 14722 0.14% 123 15085 0.15% 124 15573 0.15% 125 15991 0.15% 126 16959 0.16% 127 16965 0.16% 128 17395 0.17% 129 17888 0.17% 130 18634 0.18% 131 18754 0.18% 132 18809 0.18% 133 19545 0.19% 134 19544 0.19% 135 20198 0.20% 136 20544 0.20% 137 21354 0.21% 138 21639 0.21% 139 22419 0.22% 140 22584 0.22% 141 23187 0.22% 142 23702 0.23% 143 23987 0.23% 144 24710 0.24% 145 24491 0.24% 146 24907 0.24% 147 25813 0.25% 148 26758 0.26% 149 26496 0.26% 150 27780 0.27% 151 9411342 90.86% 10357789 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.63 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=9.67 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=23 prefix-density=0.80 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=16 fanout-score=13.88 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=6.0 sequence=AGCAATGGCAGCA SRR12917510 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:52:03 Started mapping on | Feb 13 09:52:13 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 8.46 Number of input reads | 10357789 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 9794389 Uniquely mapped reads % | 94.56% Average mapped length | 295.92 Number of splices: Total | 9858355 Number of splices: Annotated (sjdb) | 9644049 Number of splices: GT/AG | 9652796 Number of splices: GC/AG | 164245 Number of splices: AT/AC | 6032 Number of splices: Non-canonical | 35282 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222687 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 27151 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 340713 340713 340713 N_multimapping 222687 222687 222687 N_noFeature 367091 9660080 410011 N_ambiguous 162547 491 70910 UnstrandedReadsAssigned:9264751 PositiveStrandReadsAssigned:133818 NegativeStrandReadsAssigned:9313468 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917510 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917510-trimmed-pair1.fastq SRR12917510-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,357,789 reads, 9,291,110 reads pseudoaligned [quant] estimated average fragment length: 267.092 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR12917510.ke.tsv 34699 SRR12917510.se.tsv 87100 total ==> SRR12917510.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.91 418 23.8245 Potri.005G024800.1.v4.1 1035 768.908 183 23.7649 Potri.004G059700.1.v4.1 961 695.058 61 8.76331 Potri.007G009000.2.v4.1 1416 1149.91 0 0 Potri.003G141000.2.v4.1 2943 2676.91 446 16.6365 Potri.016G087400.1.v4.1 270 81.8352 598.799 730.635 Potri.015G069301.1.v4.1 564 313.779 0 0 Potri.010G195200.1.v4.1 1773 1506.91 30 1.9879 Potri.012G127500.1.v4.1 977 710.976 129 18.1173 ==> SRR12917510.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 82 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12917510 completed mapping pipeline successfully