Starting /dee2/code/volunteer_pipeline.sh SRR12917511 current disk space = 3052657852416 free memory = 1494312720 SRR12917511 SRAfilesize a4224ee483901dc2b91b080c737d5ed6 SRR12917511.sra SRR12917511.sra file validated SRR12917511 is paired end SRR12917511 is conventional basespace SRR12917511 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6525 37.0 37.0 37.0 37.0 37.0 2 36.5685 37.0 37.0 37.0 37.0 37.0 3 36.633 37.0 37.0 37.0 37.0 37.0 4 36.6655 37.0 37.0 37.0 37.0 37.0 5 36.6905 37.0 37.0 37.0 37.0 37.0 6 36.7235 37.0 37.0 37.0 37.0 37.0 7 36.641 37.0 37.0 37.0 37.0 37.0 8 36.6635 37.0 37.0 37.0 37.0 37.0 9 36.724 37.0 37.0 37.0 37.0 37.0 10-14 36.6802 37.0 37.0 37.0 37.0 37.0 15-19 36.6302 37.0 37.0 37.0 37.0 37.0 20-24 36.6533 37.0 37.0 37.0 37.0 37.0 25-29 36.5784 37.0 37.0 37.0 37.0 37.0 30-34 36.515499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5209 37.0 37.0 37.0 37.0 37.0 40-44 36.462199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4604 37.0 37.0 37.0 37.0 37.0 50-54 36.4387 37.0 37.0 37.0 37.0 37.0 55-59 36.3723 37.0 37.0 37.0 37.0 37.0 60-64 36.3287 37.0 37.0 37.0 37.0 37.0 65-69 36.2795 37.0 37.0 37.0 37.0 37.0 70-74 36.3185 37.0 37.0 37.0 37.0 37.0 75-79 36.3832 37.0 37.0 37.0 37.0 37.0 80-84 36.357600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2789 37.0 37.0 37.0 37.0 37.0 90-94 36.3258 37.0 37.0 37.0 37.0 37.0 95-99 36.182700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.216899999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.119099999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1373 37.0 37.0 37.0 37.0 37.0 115-119 36.1112 37.0 37.0 37.0 37.0 37.0 120-124 36.0442 37.0 37.0 37.0 37.0 37.0 125-129 35.9534 37.0 37.0 37.0 37.0 37.0 130-134 35.931 37.0 37.0 37.0 37.0 37.0 135-139 35.8559 37.0 37.0 37.0 37.0 37.0 140-144 35.693 37.0 37.0 37.0 37.0 37.0 145-149 35.5804 37.0 37.0 37.0 37.0 37.0 150-151 35.29025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 2.0 24 2.0 25 2.0 26 4.0 27 9.0 28 12.0 29 17.0 30 25.0 31 33.0 32 33.0 33 54.0 34 105.0 35 297.0 36 3043.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.46823411705853 13.10655327663832 7.728864432216108 42.69634817408704 2 20.549999999999997 12.775 36.525 30.15 3 17.25 15.9 25.874999999999996 40.975 4 21.9 23.200000000000003 23.95 30.95 5 23.775 30.025000000000002 23.275000000000002 22.925 6 20.65 33.95 23.825 21.575 7 15.0 29.25 39.225 16.525000000000002 8 15.225 28.599999999999998 33.650000000000006 22.525000000000002 9 17.275 24.0 34.475 24.25 10-14 19.68 31.209999999999997 26.950000000000003 22.16 15-19 20.200000000000003 28.854999999999997 27.22 23.724999999999998 20-24 19.564999999999998 29.38 27.48 23.575 25-29 19.785 29.965000000000003 27.105 23.145 30-34 19.935 29.099999999999998 27.150000000000002 23.815 35-39 20.025000000000002 28.895 27.265 23.815 40-44 20.630000000000003 29.244999999999997 26.419999999999998 23.705000000000002 45-49 19.645000000000003 29.709999999999997 26.745 23.9 50-54 20.82 28.48 27.235 23.465 55-59 20.155 28.405 26.855 24.585 60-64 20.599999999999998 28.799999999999997 26.945000000000004 23.655 65-69 20.865000000000002 28.415000000000003 26.825 23.895 70-74 20.825 29.470000000000002 26.11 23.595 75-79 20.169999999999998 28.405 26.8 24.625 80-84 20.625 28.294999999999998 27.24 23.84 85-89 20.935000000000002 28.785 26.76 23.52 90-94 20.805 27.839999999999996 26.93 24.425 95-99 20.794999999999998 27.825 27.04 24.34 100-104 21.375 28.955 25.795 23.875 105-109 21.035 27.615000000000002 26.965 24.385 110-114 21.22 28.4 26.484999999999996 23.895 115-119 21.755 28.105000000000004 26.119999999999997 24.02 120-124 21.84 27.894999999999996 25.95 24.315 125-129 21.7 28.7 25.96 23.64 130-134 22.35 27.544999999999998 26.395000000000003 23.71 135-139 22.32 27.32 26.16 24.2 140-144 22.275 27.644999999999996 26.035000000000004 24.044999999999998 145-149 22.235 26.865 25.595000000000002 25.305 150-151 22.8875 28.225 25.4375 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 4.0 26 5.5 27 8.0 28 13.5 29 13.5 30 18.5 31 30.5 32 39.0 33 60.0 34 83.0 35 92.0 36 96.0 37 122.0 38 142.5 39 148.5 40 160.5 41 168.0 42 179.0 43 198.0 44 213.5 45 229.0 46 253.0 47 244.0 48 212.5 49 201.0 50 179.5 51 157.0 52 146.5 53 125.5 54 101.5 55 81.5 56 66.0 57 48.0 58 38.0 59 36.0 60 26.5 61 14.5 62 11.0 63 5.5 64 2.0 65 5.0 66 3.5 67 1.0 68 2.0 69 1.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6210295728368 83.65 2 7.584884994523549 13.850000000000001 3 0.52026286966046 1.425 4 0.19167579408543264 0.7000000000000001 5 0.08214676889375684 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAA 5 0.125 No Hit GCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAG 5 0.125 No Hit CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.775 0.0 0.0 0.0 0.0 104-105 3.2 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 4.0875 0.0 0.0 0.0 0.0 110-111 4.625 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.637499999999999 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.85 0.0 0.0 0.0 0.0 120-121 7.475 0.0 0.0 0.0 0.0 122-123 8.2625 0.0 0.0 0.0 0.0 124-125 8.850000000000001 0.0 0.0 0.0 0.0 126-127 9.7375 0.0 0.0 0.0 0.0 128-129 10.325 0.0 0.0 0.0 0.0 130-131 11.2375 0.0 0.0 0.0 0.0 132-133 12.125 0.0 0.0 0.0 0.0 134-135 12.975 0.0 0.0 0.0 0.0 136-137 13.8875 0.0 0.0 0.0 0.0 138-139 14.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGCCT 10 0.006830828 145.0 4 >>END_MODULE SRR12917511 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917511_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.304 37.0 37.0 37.0 37.0 37.0 2 36.2735 37.0 37.0 37.0 37.0 37.0 3 36.2425 37.0 37.0 37.0 37.0 37.0 4 36.3165 37.0 37.0 37.0 37.0 37.0 5 36.311 37.0 37.0 37.0 37.0 37.0 6 36.4 37.0 37.0 37.0 37.0 37.0 7 36.349 37.0 37.0 37.0 37.0 37.0 8 36.3795 37.0 37.0 37.0 37.0 37.0 9 36.3595 37.0 37.0 37.0 37.0 37.0 10-14 36.3808 37.0 37.0 37.0 37.0 37.0 15-19 36.313100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.289 37.0 37.0 37.0 37.0 37.0 25-29 36.181799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1575 37.0 37.0 37.0 37.0 37.0 35-39 36.05890000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0932 37.0 37.0 37.0 37.0 37.0 45-49 36.0356 37.0 37.0 37.0 37.0 37.0 50-54 35.9949 37.0 37.0 37.0 37.0 37.0 55-59 36.031099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0583 37.0 37.0 37.0 37.0 37.0 65-69 36.0173 37.0 37.0 37.0 37.0 37.0 70-74 35.9874 37.0 37.0 37.0 37.0 37.0 75-79 35.9021 37.0 37.0 37.0 37.0 37.0 80-84 35.960300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9623 37.0 37.0 37.0 37.0 37.0 90-94 35.9645 37.0 37.0 37.0 37.0 37.0 95-99 35.903 37.0 37.0 37.0 37.0 37.0 100-104 35.8488 37.0 37.0 37.0 37.0 37.0 105-109 35.846700000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.762299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7391 37.0 37.0 37.0 37.0 37.0 120-124 35.5716 37.0 37.0 37.0 37.0 37.0 125-129 35.541399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.41610000000001 37.0 37.0 37.0 34.6 37.0 135-139 35.41330000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.127599999999994 37.0 37.0 37.0 27.4 37.0 145-149 34.9291 37.0 37.0 37.0 25.0 37.0 150-151 34.48650000000001 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 4.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 6.0 21 0.0 22 4.0 23 2.0 24 4.0 25 3.0 26 5.0 27 7.0 28 5.0 29 22.0 30 25.0 31 33.0 32 53.0 33 105.0 34 224.0 35 647.0 36 2678.0 37 166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.699999999999996 23.775 11.4 29.125 2 28.9 26.275 27.925 16.900000000000002 3 21.275 26.85 32.625 19.25 4 24.474999999999998 33.074999999999996 23.549999999999997 18.9 5 26.575 36.525 20.45 16.45 6 22.425 38.425 22.075 17.075000000000003 7 22.35 22.7 36.7 18.25 8 21.275 25.624999999999996 26.974999999999998 26.125 9 22.5 24.075 30.175 23.25 10-14 24.365000000000002 28.62 25.540000000000003 21.475 15-19 24.16 27.200000000000003 26.93 21.709999999999997 20-24 24.104999999999997 28.32 26.275 21.3 25-29 23.9 27.515 27.07 21.515 30-34 24.154999999999998 27.22 27.065 21.560000000000002 35-39 24.310000000000002 27.54 26.950000000000003 21.2 40-44 24.205 27.595 27.16 21.04 45-49 23.16 28.185 27.150000000000002 21.505 50-54 24.45 27.694999999999997 26.634999999999998 21.22 55-59 24.505 27.43 26.87 21.195 60-64 23.995 27.485 26.955000000000002 21.565 65-69 23.9 27.055 27.705000000000002 21.34 70-74 24.005000000000003 27.125 27.195000000000004 21.675 75-79 24.01 27.155 27.425 21.41 80-84 24.104999999999997 27.02 28.03 20.845 85-89 23.515 27.08 27.584999999999997 21.82 90-94 24.285 27.450000000000003 27.084999999999997 21.18 95-99 24.595 27.125 27.57 20.71 100-104 25.045 26.88 27.27 20.805 105-109 24.5 27.150000000000002 27.834999999999997 20.515 110-114 24.545 28.03 26.75 20.674999999999997 115-119 25.605 27.67 26.529999999999998 20.195 120-124 25.91 27.544999999999998 26.515 20.03 125-129 26.135 27.12 26.56 20.185 130-134 27.310000000000002 26.525 26.745 19.42 135-139 27.21 26.75 26.805 19.235 140-144 27.445000000000004 26.790000000000003 26.155 19.61 145-149 28.244999999999997 26.740000000000002 25.77 19.245 150-151 29.099999999999998 25.7625 26.875 18.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.5 25 2.5 26 2.0 27 2.0 28 4.5 29 7.0 30 12.5 31 17.5 32 24.0 33 30.0 34 36.5 35 52.5 36 73.0 37 93.0 38 107.5 39 132.0 40 162.5 41 187.5 42 218.0 43 237.5 44 253.0 45 257.5 46 272.0 47 273.0 48 241.5 49 221.0 50 195.0 51 157.5 52 135.0 53 121.0 54 98.0 55 82.0 56 63.0 57 48.0 58 45.5 59 35.0 60 21.0 61 15.0 62 12.0 63 8.5 64 3.5 65 2.0 66 2.5 67 2.5 68 1.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.5 74 1.0 75 1.5 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.82389937106919 83.95 2 7.219031993437245 13.200000000000001 3 0.7656549083948592 2.1 4 0.16406890894175555 0.6 5 0.0 0.0 6 0.027344818156959255 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.8 0.0 0.0 0.0 0.0 104-105 3.2249999999999996 0.0 0.0 0.0 0.0 106-107 3.675 0.0 0.0 0.0 0.0 108-109 4.1375 0.0 0.0 0.0 0.0 110-111 4.675000000000001 0.0 0.0 0.0 0.0 112-113 5.237500000000001 0.0 0.0 0.0 0.0 114-115 5.6875 0.0 0.0 0.0 0.0 116-117 6.3875 0.0 0.0 0.0 0.0 118-119 6.925 0.0 0.0 0.0 0.0 120-121 7.575 0.0 0.0 0.0 0.0 122-123 8.3625 0.0 0.0 0.0 0.0 124-125 8.9375 0.0 0.0 0.0 0.0 126-127 9.8 0.0 0.0 0.0 0.0 128-129 10.375 0.0 0.0 0.0 0.0 130-131 11.3125 0.0 0.0 0.0 0.0 132-133 12.1875 0.0 0.0 0.0 0.0 134-135 13.037500000000001 0.0 0.0 0.0 0.0 136-137 13.9875 0.0 0.0 0.0 0.0 138-139 15.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAGC 10 0.006830828 145.0 6 TGATTGG 10 0.006830828 145.0 4 GATTGGA 10 0.006830828 145.0 5 >>END_MODULE Read 468266 spots for SRR12917511.sra Written 468266 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra Read 468262 spots for SRR12917511.sra Written 468262 spots for SRR12917511.sra SRR ids: ['SRR12917511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e13s3kvt SRR12917511.sra spots: 9365244 blocks: [[1, 468262], [468263, 936524], [936525, 1404786], [1404787, 1873048], [1873049, 2341310], [2341311, 2809572], [2809573, 3277834], [3277835, 3746096], [3746097, 4214358], [4214359, 4682620], [4682621, 5150882], [5150883, 5619144], [5619145, 6087406], [6087407, 6555668], [6555669, 7023930], [7023931, 7492192], [7492193, 7960454], [7960455, 8428716], [8428717, 8896978], [8896979, 9365244]] SRR12917511 file size 3162259 SRR12917511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917511 SRR12917511_1.fastq SRR12917511_2.fastq Input file: SRR12917511_1.fastq Paired file: SRR12917511_2.fastq trimmed: SRR12917511-trimmed-pair1.fastq, SRR12917511-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:25:40 2025 >> started Thu Feb 13 08:32:33 2025 >> done (412.797s) 9365244 read pairs processed; of these: 43 ( 0.00%) short read pairs filtered out after trimming by size control 6963 ( 0.07%) empty read pairs filtered out after trimming by size control 9358238 (99.93%) read pairs available; of these: 2056557 (21.98%) trimmed read pairs available after processing 7301681 (78.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 4 0.00% 22 2 0.00% 23 5 0.00% 24 7 0.00% 25 4 0.00% 26 4 0.00% 27 10 0.00% 28 9 0.00% 29 8 0.00% 30 6 0.00% 31 10 0.00% 32 10 0.00% 33 18 0.00% 34 9 0.00% 35 15 0.00% 36 21 0.00% 37 16 0.00% 38 22 0.00% 39 38 0.00% 40 33 0.00% 41 29 0.00% 42 25 0.00% 43 43 0.00% 44 37 0.00% 45 47 0.00% 46 45 0.00% 47 50 0.00% 48 68 0.00% 49 83 0.00% 50 83 0.00% 51 129 0.00% 52 129 0.00% 53 134 0.00% 54 161 0.00% 55 175 0.00% 56 206 0.00% 57 253 0.00% 58 290 0.00% 59 318 0.00% 60 415 0.00% 61 464 0.00% 62 567 0.01% 63 650 0.01% 64 665 0.01% 65 767 0.01% 66 838 0.01% 67 1015 0.01% 68 1057 0.01% 69 1292 0.01% 70 1461 0.02% 71 1742 0.02% 72 2029 0.02% 73 2364 0.03% 74 2609 0.03% 75 2899 0.03% 76 3315 0.04% 77 3426 0.04% 78 3830 0.04% 79 4350 0.05% 80 4729 0.05% 81 5302 0.06% 82 5983 0.06% 83 6639 0.07% 84 7526 0.08% 85 8304 0.09% 86 8880 0.09% 87 9474 0.10% 88 9851 0.11% 89 10505 0.11% 90 10957 0.12% 91 11604 0.12% 92 12278 0.13% 93 13636 0.15% 94 14655 0.16% 95 15517 0.17% 96 16421 0.18% 97 17523 0.19% 98 18140 0.19% 99 18374 0.20% 100 18731 0.20% 101 19130 0.20% 102 20163 0.22% 103 20974 0.22% 104 21953 0.23% 105 23244 0.25% 106 24570 0.26% 107 24997 0.27% 108 25969 0.28% 109 26243 0.28% 110 26856 0.29% 111 27276 0.29% 112 27859 0.30% 113 28314 0.30% 114 28815 0.31% 115 30756 0.33% 116 31435 0.34% 117 32786 0.35% 118 33263 0.36% 119 33825 0.36% 120 34269 0.37% 121 33838 0.36% 122 34432 0.37% 123 34756 0.37% 124 35574 0.38% 125 36404 0.39% 126 37316 0.40% 127 38181 0.41% 128 38647 0.41% 129 39669 0.42% 130 40166 0.43% 131 40151 0.43% 132 40070 0.43% 133 40818 0.44% 134 40950 0.44% 135 40944 0.44% 136 41352 0.44% 137 42528 0.45% 138 42892 0.46% 139 43722 0.47% 140 43719 0.47% 141 44350 0.47% 142 44137 0.47% 143 43783 0.47% 144 43770 0.47% 145 43859 0.47% 146 43543 0.47% 147 44210 0.47% 148 45200 0.48% 149 45096 0.48% 150 46429 0.50% 151 7301681 78.02% 9358238 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=37 prefix-density=0.61 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=63.98 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.4 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.65 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=74.29 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12917511 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:02:48 Started mapping on | Feb 13 09:02:53 Finished on | Feb 13 09:37:23 Mapping speed, Million of reads per hour | 16.28 Number of input reads | 9358238 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 8644487 Uniquely mapped reads % | 92.37% Average mapped length | 288.64 Number of splices: Total | 7309922 Number of splices: Annotated (sjdb) | 7169606 Number of splices: GT/AG | 7133083 Number of splices: GC/AG | 145862 Number of splices: AT/AC | 6196 Number of splices: Non-canonical | 24781 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239107 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 94502 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474644 474644 474644 N_multimapping 239107 239107 239107 N_noFeature 221373 8467549 273815 N_ambiguous 191379 688 66503 UnstrandedReadsAssigned:8231735 PositiveStrandReadsAssigned:176250 NegativeStrandReadsAssigned:8304169 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR12917511 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917511-trimmed-pair1.fastq SRR12917511-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,358,238 reads, 8,384,682 reads pseudoaligned [quant] estimated average fragment length: 216.106 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12917511.ke.tsv 34699 SRR12917511.se.tsv 87100 total ==> SRR12917511.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.89 165 8.38975 Potri.005G024800.1.v4.1 1035 819.894 144 16.1005 Potri.004G059700.1.v4.1 961 745.904 65 7.98851 Potri.007G009000.2.v4.1 1416 1200.89 0 0 Potri.003G141000.2.v4.1 2943 2727.89 358 12.0307 Potri.016G087400.1.v4.1 270 100.373 526 480.404 Potri.015G069301.1.v4.1 564 355.271 0 0 Potri.010G195200.1.v4.1 1773 1557.89 14 0.823807 Potri.012G127500.1.v4.1 977 761.904 531 63.8895 ==> SRR12917511.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 162 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12917511 completed mapping pipeline successfully