Starting /dee2/code/volunteer_pipeline.sh SRR12917512 current disk space = 3052671315968 free memory = 1422596384 SRR12917512 SRAfilesize e219e39e33e1bfd4914f6159e970f486 SRR12917512.sra SRR12917512.sra file validated SRR12917512 is paired end SRR12917512 is conventional basespace SRR12917512 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5345 37.0 37.0 37.0 37.0 37.0 2 36.4835 37.0 37.0 37.0 37.0 37.0 3 36.558 37.0 37.0 37.0 37.0 37.0 4 36.668 37.0 37.0 37.0 37.0 37.0 5 36.631 37.0 37.0 37.0 37.0 37.0 6 36.711 37.0 37.0 37.0 37.0 37.0 7 36.587 37.0 37.0 37.0 37.0 37.0 8 36.5685 37.0 37.0 37.0 37.0 37.0 9 36.635 37.0 37.0 37.0 37.0 37.0 10-14 36.6102 37.0 37.0 37.0 37.0 37.0 15-19 36.587199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5464 37.0 37.0 37.0 37.0 37.0 25-29 36.5021 37.0 37.0 37.0 37.0 37.0 30-34 36.4874 37.0 37.0 37.0 37.0 37.0 35-39 36.4344 37.0 37.0 37.0 37.0 37.0 40-44 36.46920000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3622 37.0 37.0 37.0 37.0 37.0 50-54 36.3754 37.0 37.0 37.0 37.0 37.0 55-59 36.2979 37.0 37.0 37.0 37.0 37.0 60-64 36.247499999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1979 37.0 37.0 37.0 37.0 37.0 70-74 36.2481 37.0 37.0 37.0 37.0 37.0 75-79 36.2864 37.0 37.0 37.0 37.0 37.0 80-84 36.25020000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.26 37.0 37.0 37.0 37.0 37.0 90-94 36.23010000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1965 37.0 37.0 37.0 37.0 37.0 100-104 36.1115 37.0 37.0 37.0 37.0 37.0 105-109 36.032799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0594 37.0 37.0 37.0 37.0 37.0 115-119 36.052800000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0283 37.0 37.0 37.0 37.0 37.0 125-129 35.967 37.0 37.0 37.0 37.0 37.0 130-134 35.7915 37.0 37.0 37.0 37.0 37.0 135-139 35.7371 37.0 37.0 37.0 37.0 37.0 140-144 35.6003 37.0 37.0 37.0 37.0 37.0 145-149 35.5382 37.0 37.0 37.0 37.0 37.0 150-151 35.18275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.0 24 0.0 25 4.0 26 3.0 27 4.0 28 7.0 29 22.0 30 21.0 31 45.0 32 56.0 33 86.0 34 106.0 35 361.0 36 2969.0 37 310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.32266133066533 13.681840920460232 5.102551275637819 35.89294647323662 2 20.525 11.700000000000001 36.65 31.125000000000004 3 17.275 16.05 27.200000000000003 39.475 4 21.25 19.875 27.075 31.8 5 24.2 28.050000000000004 25.5 22.25 6 20.275000000000002 31.624999999999996 24.125 23.974999999999998 7 16.25 28.975 39.4 15.375 8 16.075 28.549999999999997 31.95 23.425 9 17.299999999999997 23.95 35.375 23.375 10-14 19.415 29.615000000000002 28.155 22.814999999999998 15-19 20.275000000000002 28.389999999999997 27.11 24.224999999999998 20-24 19.655 29.115000000000002 27.74 23.49 25-29 19.695 29.275000000000002 27.67 23.36 30-34 19.08 29.43 27.255000000000003 24.235 35-39 19.665 27.96 28.24 24.135 40-44 20.075000000000003 28.515 27.605 23.805 45-49 20.04 28.585 27.52 23.855 50-54 20.044999999999998 28.7 27.05 24.205 55-59 19.71 28.78 27.525 23.985 60-64 19.689999999999998 28.345 28.08 23.885 65-69 20.294999999999998 28.005000000000003 27.800000000000004 23.9 70-74 20.205000000000002 28.375 27.66 23.76 75-79 20.064999999999998 28.475 27.74 23.72 80-84 20.064999999999998 28.15 27.43 24.355 85-89 20.11 28.43 27.665 23.794999999999998 90-94 20.674999999999997 28.235 27.400000000000002 23.69 95-99 20.29 28.389999999999997 27.38 23.94 100-104 19.950000000000003 28.515 27.6 23.935000000000002 105-109 20.375 28.165000000000003 27.365000000000002 24.095 110-114 20.41 27.985 27.775 23.830000000000002 115-119 20.794999999999998 28.375 26.83 24.0 120-124 20.330000000000002 28.305000000000003 27.139999999999997 24.224999999999998 125-129 21.22 27.845 27.025 23.91 130-134 20.995 27.994999999999997 27.005000000000003 24.005000000000003 135-139 21.08 27.284999999999997 27.284999999999997 24.349999999999998 140-144 21.415 27.439999999999998 27.24 23.905 145-149 21.345 27.865000000000002 26.674999999999997 24.115000000000002 150-151 21.4 27.200000000000003 26.325 25.074999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 2.0 25 2.5 26 4.5 27 3.5 28 8.5 29 13.5 30 12.0 31 20.5 32 37.5 33 47.0 34 50.0 35 70.5 36 85.0 37 103.5 38 132.0 39 161.0 40 186.5 41 206.0 42 243.0 43 263.0 44 259.0 45 262.5 46 254.5 47 246.0 48 232.5 49 205.5 50 193.0 51 161.5 52 125.0 53 91.0 54 71.0 55 67.0 56 46.0 57 31.0 58 24.5 59 20.0 60 15.5 61 10.0 62 6.5 63 4.0 64 2.5 65 3.5 66 4.0 67 2.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.86903137789905 84.175 2 7.339699863574352 13.450000000000001 3 0.6275579809004093 1.725 4 0.10914051841746249 0.4 5 0.054570259208731244 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAATCTCATCATCAACCTTAAGAAAGCAGCTCCTGAAAGCTTTCTCC 5 0.125 No Hit GTCCGCCAGGGTAGGCTGGTTCTCCGGACCCACCCAAATACTTCTCGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 4.887499999999999 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGAT 10 0.006830828 145.0 7 GTCCTGA 10 0.006830828 145.0 1 >>END_MODULE SRR12917512 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917512_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.331 37.0 37.0 37.0 37.0 37.0 2 36.1445 37.0 37.0 37.0 37.0 37.0 3 36.1575 37.0 37.0 37.0 37.0 37.0 4 36.218 37.0 37.0 37.0 37.0 37.0 5 36.3025 37.0 37.0 37.0 37.0 37.0 6 36.1505 37.0 37.0 37.0 37.0 37.0 7 36.3085 37.0 37.0 37.0 37.0 37.0 8 36.25 37.0 37.0 37.0 37.0 37.0 9 36.306 37.0 37.0 37.0 37.0 37.0 10-14 36.282799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.274899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.2269 37.0 37.0 37.0 37.0 37.0 25-29 36.091 37.0 37.0 37.0 37.0 37.0 30-34 36.0842 37.0 37.0 37.0 37.0 37.0 35-39 36.0267 37.0 37.0 37.0 37.0 37.0 40-44 35.9752 37.0 37.0 37.0 37.0 37.0 45-49 35.873900000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.92229999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8879 37.0 37.0 37.0 37.0 37.0 60-64 35.9447 37.0 37.0 37.0 37.0 37.0 65-69 35.857 37.0 37.0 37.0 37.0 37.0 70-74 35.8154 37.0 37.0 37.0 37.0 37.0 75-79 35.7219 37.0 37.0 37.0 37.0 37.0 80-84 35.742399999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.77720000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8032 37.0 37.0 37.0 37.0 37.0 95-99 35.762800000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.72689999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.6366 37.0 37.0 37.0 37.0 37.0 110-114 35.639599999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.586200000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.453500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4272 37.0 37.0 37.0 37.0 37.0 130-134 35.361900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.3677 37.0 37.0 37.0 34.6 37.0 140-144 35.217 37.0 37.0 37.0 32.2 37.0 145-149 35.048500000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.56325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 3.0 16 2.0 17 4.0 18 2.0 19 3.0 20 2.0 21 2.0 22 8.0 23 5.0 24 6.0 25 9.0 26 8.0 27 8.0 28 17.0 29 13.0 30 30.0 31 44.0 32 61.0 33 121.0 34 232.0 35 576.0 36 2624.0 37 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 28.1 9.0 24.575 2 27.675 25.95 30.049999999999997 16.325 3 20.3 28.325 33.425 17.95 4 22.55 34.599999999999994 24.474999999999998 18.375 5 25.575 36.05 21.45 16.925 6 20.150000000000002 40.400000000000006 21.775 17.675 7 21.15 24.125 36.05 18.675 8 20.875 26.200000000000003 28.7 24.224999999999998 9 22.7 25.1 29.099999999999998 23.1 10-14 23.765 29.935000000000002 25.380000000000003 20.919999999999998 15-19 24.23 27.91 26.875 20.985 20-24 23.605 28.62 26.700000000000003 21.075 25-29 24.05 27.639999999999997 27.185 21.125 30-34 23.65 27.965 27.415 20.97 35-39 23.835 28.16 26.99 21.015 40-44 23.655 27.794999999999998 27.900000000000002 20.65 45-49 23.97 27.625 27.389999999999997 21.015 50-54 24.195 27.88 27.310000000000002 20.615 55-59 23.76 28.115000000000002 27.235 20.89 60-64 23.935000000000002 28.060000000000002 27.245 20.76 65-69 24.325 27.839999999999996 27.694999999999997 20.14 70-74 24.48 28.025 26.695 20.8 75-79 23.905 28.610000000000003 26.695 20.79 80-84 24.085 27.525 27.389999999999997 21.0 85-89 23.965 28.425 26.939999999999998 20.669999999999998 90-94 24.365000000000002 28.075 26.97 20.59 95-99 24.115000000000002 27.455000000000002 27.18 21.25 100-104 24.41 28.355000000000004 27.08 20.155 105-109 24.27 27.93 27.155 20.645 110-114 24.709999999999997 28.365000000000002 26.35 20.575 115-119 24.85 27.145000000000003 27.400000000000002 20.605 120-124 25.009999999999998 28.175 26.314999999999998 20.5 125-129 24.610000000000003 27.650000000000002 27.235 20.505000000000003 130-134 24.965 28.235 26.834999999999997 19.965 135-139 25.31 28.08 26.855 19.755 140-144 25.019999999999996 27.74 26.55 20.69 145-149 26.115 28.305000000000003 26.369999999999997 19.21 150-151 26.674999999999997 28.449999999999996 25.75 19.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 2.0 27 2.5 28 6.5 29 7.5 30 11.0 31 17.0 32 23.0 33 30.5 34 37.5 35 47.5 36 72.0 37 100.0 38 122.0 39 161.5 40 195.5 41 222.0 42 252.0 43 272.5 44 280.5 45 286.0 46 277.5 47 261.5 48 239.5 49 204.5 50 177.0 51 149.5 52 121.0 53 91.0 54 60.5 55 51.5 56 46.5 57 32.0 58 25.0 59 21.0 60 14.0 61 6.0 62 3.5 63 6.0 64 6.0 65 5.0 66 5.0 67 2.5 68 1.5 69 1.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 1.5 92 1.5 93 1.0 94 0.5 95 1.5 96 1.5 97 1.0 98 1.0 99 1.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20708446866485 84.6 2 7.002724795640327 12.85 3 0.6539509536784741 1.7999999999999998 4 0.10899182561307902 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027247956403269755 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8499999999999996 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.7875 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 4.887499999999999 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 5.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035366106 20.714287 70-74 >>END_MODULE Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587512 spots for SRR12917512.sra Written 587512 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra Read 587507 spots for SRR12917512.sra Written 587507 spots for SRR12917512.sra SRR ids: ['SRR12917512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u3lrzkbz SRR12917512.sra spots: 11750145 blocks: [[1, 587507], [587508, 1175014], [1175015, 1762521], [1762522, 2350028], [2350029, 2937535], [2937536, 3525042], [3525043, 4112549], [4112550, 4700056], [4700057, 5287563], [5287564, 5875070], [5875071, 6462577], [6462578, 7050084], [7050085, 7637591], [7637592, 8225098], [8225099, 8812605], [8812606, 9400112], [9400113, 9987619], [9987620, 10575126], [10575127, 11162633], [11162634, 11750145]] SRR12917512 file size 3971512 SRR12917512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917512 SRR12917512_1.fastq SRR12917512_2.fastq Input file: SRR12917512_1.fastq Paired file: SRR12917512_2.fastq trimmed: SRR12917512-trimmed-pair1.fastq, SRR12917512-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:26:36 2025 >> started Thu Feb 13 08:30:06 2025 >> done (209.546s) 11750145 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 10838 ( 0.09%) empty read pairs filtered out after trimming by size control 11739223 (99.91%) read pairs available; of these: 962325 ( 8.20%) trimmed read pairs available after processing 10776898 (91.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 11 0.00% 21 10 0.00% 22 5 0.00% 23 18 0.00% 24 17 0.00% 25 16 0.00% 26 14 0.00% 27 10 0.00% 28 21 0.00% 29 31 0.00% 30 28 0.00% 31 26 0.00% 32 37 0.00% 33 43 0.00% 34 36 0.00% 35 35 0.00% 36 30 0.00% 37 39 0.00% 38 41 0.00% 39 29 0.00% 40 38 0.00% 41 46 0.00% 42 43 0.00% 43 37 0.00% 44 38 0.00% 45 58 0.00% 46 63 0.00% 47 61 0.00% 48 66 0.00% 49 76 0.00% 50 89 0.00% 51 95 0.00% 52 100 0.00% 53 106 0.00% 54 111 0.00% 55 133 0.00% 56 133 0.00% 57 160 0.00% 58 186 0.00% 59 187 0.00% 60 232 0.00% 61 261 0.00% 62 344 0.00% 63 337 0.00% 64 435 0.00% 65 412 0.00% 66 456 0.00% 67 514 0.00% 68 622 0.01% 69 622 0.01% 70 808 0.01% 71 843 0.01% 72 971 0.01% 73 1142 0.01% 74 1306 0.01% 75 1392 0.01% 76 1558 0.01% 77 1577 0.01% 78 1760 0.01% 79 1798 0.02% 80 2033 0.02% 81 2369 0.02% 82 2581 0.02% 83 2869 0.02% 84 3110 0.03% 85 3537 0.03% 86 3683 0.03% 87 3837 0.03% 88 4070 0.03% 89 4167 0.04% 90 4478 0.04% 91 4798 0.04% 92 5016 0.04% 93 5193 0.04% 94 5843 0.05% 95 6194 0.05% 96 6583 0.06% 97 6855 0.06% 98 6919 0.06% 99 7193 0.06% 100 7391 0.06% 101 7641 0.07% 102 7962 0.07% 103 8249 0.07% 104 8790 0.07% 105 9229 0.08% 106 9786 0.08% 107 10157 0.09% 108 10246 0.09% 109 10589 0.09% 110 10732 0.09% 111 11174 0.10% 112 11230 0.10% 113 11426 0.10% 114 11974 0.10% 115 12497 0.11% 116 12940 0.11% 117 13584 0.12% 118 14087 0.12% 119 14079 0.12% 120 14482 0.12% 121 14741 0.13% 122 14689 0.13% 123 14895 0.13% 124 15602 0.13% 125 16102 0.14% 126 16844 0.14% 127 17277 0.15% 128 17991 0.15% 129 18209 0.16% 130 18624 0.16% 131 19122 0.16% 132 19390 0.17% 133 19521 0.17% 134 19815 0.17% 135 20267 0.17% 136 20853 0.18% 137 21562 0.18% 138 22026 0.19% 139 22246 0.19% 140 22963 0.20% 141 23408 0.20% 142 23608 0.20% 143 23722 0.20% 144 24236 0.21% 145 24853 0.21% 146 24980 0.21% 147 25166 0.21% 148 26187 0.22% 149 26930 0.23% 150 27193 0.23% 151 10776898 91.80% 11739223 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.99 fanout-score-rank=22 prefix-density=0.30 prefix-fanout=4.1 sequence=CAATTTTCTCAATAGCTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=76.06 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.6 sequence=AACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTGT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.5 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=535.83 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=19.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGA SRR12917512 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:03:01 Started mapping on | Feb 13 09:03:31 Finished on | Feb 13 09:58:27 Mapping speed, Million of reads per hour | 12.82 Number of input reads | 11739223 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11102973 Uniquely mapped reads % | 94.58% Average mapped length | 296.50 Number of splices: Total | 10595046 Number of splices: Annotated (sjdb) | 10392980 Number of splices: GT/AG | 10389509 Number of splices: GC/AG | 163329 Number of splices: AT/AC | 12775 Number of splices: Non-canonical | 29433 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.25 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299836 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 56955 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336414 336414 336414 N_multimapping 299836 299836 299836 N_noFeature 249401 10968931 296160 N_ambiguous 150445 621 62829 UnstrandedReadsAssigned:10703127 PositiveStrandReadsAssigned:133421 NegativeStrandReadsAssigned:10743984 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917512 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917512-trimmed-pair1.fastq SRR12917512-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,739,223 reads, 10,806,001 reads pseudoaligned [quant] estimated average fragment length: 271.831 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR12917512.ke.tsv 34699 SRR12917512.se.tsv 87100 total ==> SRR12917512.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.17 377 17.2136 Potri.005G024800.1.v4.1 1035 764.169 110 11.4834 Potri.004G059700.1.v4.1 961 690.322 42 4.85359 Potri.007G009000.2.v4.1 1416 1145.17 0 0 Potri.003G141000.2.v4.1 2943 2672.17 427.198 12.7535 Potri.016G087400.1.v4.1 270 79.7332 1009 1009.53 Potri.015G069301.1.v4.1 564 309.248 0 0 Potri.010G195200.1.v4.1 1773 1502.17 56 2.97396 Potri.012G127500.1.v4.1 977 706.239 11971 1352.21 ==> SRR12917512.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 300 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917512 completed mapping pipeline successfully