Starting /dee2/code/volunteer_pipeline.sh SRR12917513 current disk space = 3052657512448 free memory = 1451561524 SRR12917513 SRAfilesize 9c74373ee32478c72bf757c36fb4c945 SRR12917513.sra SRR12917513.sra file validated SRR12917513 is paired end SRR12917513 is conventional basespace SRR12917513 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56375 37.0 37.0 37.0 37.0 37.0 2 36.482 37.0 37.0 37.0 37.0 37.0 3 36.541 37.0 37.0 37.0 37.0 37.0 4 36.6075 37.0 37.0 37.0 37.0 37.0 5 36.6995 37.0 37.0 37.0 37.0 37.0 6 36.638 37.0 37.0 37.0 37.0 37.0 7 36.4735 37.0 37.0 37.0 37.0 37.0 8 36.49 37.0 37.0 37.0 37.0 37.0 9 36.6645 37.0 37.0 37.0 37.0 37.0 10-14 36.602799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.58290000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5904 37.0 37.0 37.0 37.0 37.0 25-29 36.5446 37.0 37.0 37.0 37.0 37.0 30-34 36.4407 37.0 37.0 37.0 37.0 37.0 35-39 36.4663 37.0 37.0 37.0 37.0 37.0 40-44 36.485699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.3738 37.0 37.0 37.0 37.0 37.0 50-54 36.3592 37.0 37.0 37.0 37.0 37.0 55-59 36.3534 37.0 37.0 37.0 37.0 37.0 60-64 36.3462 37.0 37.0 37.0 37.0 37.0 65-69 36.258300000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.2282 37.0 37.0 37.0 37.0 37.0 75-79 36.3055 37.0 37.0 37.0 37.0 37.0 80-84 36.2395 37.0 37.0 37.0 37.0 37.0 85-89 36.2487 37.0 37.0 37.0 37.0 37.0 90-94 36.2567 37.0 37.0 37.0 37.0 37.0 95-99 36.198100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.130100000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1084 37.0 37.0 37.0 37.0 37.0 110-114 36.041399999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.999199999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0068 37.0 37.0 37.0 37.0 37.0 125-129 35.902 37.0 37.0 37.0 37.0 37.0 130-134 35.7921 37.0 37.0 37.0 37.0 37.0 135-139 35.7812 37.0 37.0 37.0 37.0 37.0 140-144 35.6024 37.0 37.0 37.0 37.0 37.0 145-149 35.440200000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.2555 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 0.0 23 0.0 24 5.0 25 0.0 26 3.0 27 7.0 28 14.0 29 21.0 30 17.0 31 38.0 32 52.0 33 72.0 34 146.0 35 324.0 36 3025.0 37 272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.80945236309077 14.028507126781694 5.401350337584396 42.760690172543136 2 17.299999999999997 11.700000000000001 39.775 31.225 3 16.25 15.35 28.025 40.375 4 21.575 21.099999999999998 25.75 31.574999999999996 5 22.675 29.325000000000003 25.7 22.3 6 20.775 32.800000000000004 22.225 24.2 7 15.15 28.325 40.525 16.0 8 16.75 27.675 33.275 22.3 9 17.474999999999998 23.200000000000003 36.05 23.275000000000002 10-14 19.16 30.685000000000002 27.965 22.189999999999998 15-19 19.56 27.855 27.915 24.67 20-24 19.62 28.255000000000003 28.544999999999998 23.580000000000002 25-29 19.5 28.15 28.42 23.93 30-34 19.255 27.97 28.12 24.654999999999998 35-39 19.06 28.470000000000002 28.215 24.255 40-44 19.5 29.09 27.735 23.674999999999997 45-49 20.175 28.83 27.465 23.53 50-54 19.715 28.689999999999998 27.855 23.74 55-59 19.34 29.025000000000002 27.894999999999996 23.74 60-64 19.49 28.335 27.675 24.5 65-69 19.325 28.53 27.939999999999998 24.205 70-74 19.475 28.505000000000003 28.475 23.544999999999998 75-79 20.13 28.189999999999998 27.950000000000003 23.73 80-84 19.3 29.395 27.205000000000002 24.099999999999998 85-89 19.12 28.46 27.76 24.66 90-94 19.455 28.685 27.52 24.34 95-99 19.81 28.549999999999997 27.534999999999997 24.104999999999997 100-104 19.41 28.055000000000003 28.49 24.044999999999998 105-109 19.93 28.01 27.425 24.635 110-114 20.47 28.62 27.384999999999998 23.525 115-119 20.04 28.244999999999997 27.97 23.745 120-124 20.235 28.075 27.474999999999998 24.215 125-129 20.349999999999998 28.155 27.465 24.03 130-134 19.805 28.68 26.815 24.7 135-139 20.195 28.299999999999997 27.605 23.9 140-144 20.45 27.905 27.43 24.215 145-149 20.46 28.249999999999996 27.125 24.165 150-151 20.424999999999997 27.1125 27.6875 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 2.5 21 2.5 22 2.5 23 2.5 24 1.5 25 2.0 26 5.5 27 10.0 28 12.0 29 10.0 30 14.5 31 21.5 32 34.0 33 43.5 34 51.0 35 70.0 36 93.5 37 123.0 38 131.5 39 153.5 40 202.0 41 224.5 42 234.0 43 260.5 44 270.5 45 264.5 46 275.5 47 260.5 48 247.5 49 215.5 50 157.0 51 128.5 52 106.5 53 86.5 54 67.5 55 51.0 56 41.0 57 32.0 58 20.5 59 13.5 60 11.0 61 8.0 62 6.5 63 6.5 64 4.5 65 2.5 66 2.5 67 2.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 92.40196078431373 84.82499999999999 2 6.535947712418301 12.0 3 0.8442265795206972 2.325 4 0.16339869281045752 0.6 5 0.054466230936819175 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTACAAGCACGATTTTTATTATTATTTTTTGCCCCAAAGGAGGGGGGAA 5 0.125 No Hit AACCTCTGCAACTGGCACCTTGGCCTTTCCAGCATAGAATGTCTTGGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0375 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.6624999999999996 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTGT 10 0.006830828 145.0 5 >>END_MODULE SRR12917513 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917513_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4715 37.0 37.0 37.0 37.0 37.0 2 36.3215 37.0 37.0 37.0 37.0 37.0 3 36.384 37.0 37.0 37.0 37.0 37.0 4 36.397 37.0 37.0 37.0 37.0 37.0 5 36.3595 37.0 37.0 37.0 37.0 37.0 6 36.2665 37.0 37.0 37.0 37.0 37.0 7 36.4525 37.0 37.0 37.0 37.0 37.0 8 36.4635 37.0 37.0 37.0 37.0 37.0 9 36.435 37.0 37.0 37.0 37.0 37.0 10-14 36.4476 37.0 37.0 37.0 37.0 37.0 15-19 36.3832 37.0 37.0 37.0 37.0 37.0 20-24 36.398 37.0 37.0 37.0 37.0 37.0 25-29 36.33 37.0 37.0 37.0 37.0 37.0 30-34 36.2474 37.0 37.0 37.0 37.0 37.0 35-39 36.2017 37.0 37.0 37.0 37.0 37.0 40-44 36.212399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1091 37.0 37.0 37.0 37.0 37.0 50-54 36.1284 37.0 37.0 37.0 37.0 37.0 55-59 36.1186 37.0 37.0 37.0 37.0 37.0 60-64 36.1455 37.0 37.0 37.0 37.0 37.0 65-69 36.067899999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.095200000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0119 37.0 37.0 37.0 37.0 37.0 80-84 36.0356 37.0 37.0 37.0 37.0 37.0 85-89 36.042100000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0059 37.0 37.0 37.0 37.0 37.0 95-99 36.0098 37.0 37.0 37.0 37.0 37.0 100-104 35.963300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9002 37.0 37.0 37.0 37.0 37.0 110-114 35.867599999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.82629999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.7249 37.0 37.0 37.0 37.0 37.0 125-129 35.74720000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.6984 37.0 37.0 37.0 37.0 37.0 135-139 35.5845 37.0 37.0 37.0 37.0 37.0 140-144 35.4617 37.0 37.0 37.0 37.0 37.0 145-149 35.30550000000001 37.0 37.0 37.0 29.8 37.0 150-151 34.7705 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 2.0 22 5.0 23 2.0 24 4.0 25 8.0 26 6.0 27 13.0 28 13.0 29 15.0 30 14.0 31 31.0 32 53.0 33 102.0 34 196.0 35 542.0 36 2768.0 37 224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.8 27.500000000000004 9.9 27.800000000000004 2 27.025 25.174999999999997 32.9 14.899999999999999 3 19.275000000000002 28.775000000000002 33.275 18.675 4 22.775000000000002 32.875 24.474999999999998 19.875 5 26.3 35.449999999999996 21.825 16.425 6 21.05 38.75 22.675 17.525 7 20.8 21.95 38.3 18.95 8 21.05 26.375 30.0 22.575 9 21.975 24.975 30.0 23.05 10-14 22.955000000000002 29.585 27.189999999999998 20.27 15-19 23.22 28.255000000000003 27.650000000000002 20.875 20-24 23.44 28.465 27.815 20.28 25-29 23.385 28.315 27.62 20.68 30-34 23.400000000000002 28.235 28.075 20.29 35-39 22.575 28.46 27.46 21.505 40-44 23.7 27.950000000000003 27.525 20.825 45-49 23.455000000000002 28.044999999999998 28.02 20.48 50-54 23.255 28.634999999999998 27.725 20.385 55-59 23.36 28.48 28.04 20.119999999999997 60-64 23.585 28.03 27.944999999999997 20.44 65-69 22.945 28.599999999999998 28.060000000000002 20.395 70-74 23.735 28.325 27.395000000000003 20.544999999999998 75-79 23.445 28.305000000000003 27.705000000000002 20.544999999999998 80-84 24.2 28.13 27.025 20.645 85-89 23.26 28.244999999999997 27.615000000000002 20.880000000000003 90-94 24.154999999999998 28.185 27.229999999999997 20.43 95-99 23.835 27.88 27.685 20.599999999999998 100-104 24.555 28.315 27.045 20.085 105-109 24.055 29.21 27.29 19.445 110-114 24.345 27.894999999999996 28.139999999999997 19.62 115-119 24.55 28.345 27.315 19.79 120-124 24.855 28.01 27.115000000000002 20.02 125-129 24.425 28.299999999999997 27.325 19.950000000000003 130-134 25.31 27.884999999999998 27.400000000000002 19.405 135-139 25.119999999999997 28.37 26.82 19.689999999999998 140-144 24.345 27.839999999999996 27.755000000000003 20.06 145-149 26.064999999999998 27.744999999999997 27.05 19.139999999999997 150-151 24.65 28.249999999999996 27.925 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 3.5 26 4.0 27 5.0 28 10.5 29 14.0 30 15.0 31 18.5 32 24.0 33 35.0 34 50.5 35 68.0 36 86.0 37 108.0 38 132.0 39 165.5 40 211.5 41 250.0 42 262.5 43 279.0 44 289.5 45 276.5 46 272.5 47 254.0 48 225.0 49 212.0 50 169.0 51 114.5 52 99.5 53 85.0 54 69.0 55 48.0 56 29.5 57 23.0 58 21.0 59 20.0 60 13.5 61 8.5 62 5.0 63 3.5 64 1.5 65 0.5 66 1.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.27620087336244 84.52499999999999 2 6.604803493449782 12.1 3 0.8460698689956333 2.325 4 0.24563318777292578 0.8999999999999999 5 0.0 0.0 6 0.02729257641921397 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGCAGCCGCTTAGCCAGAGAAAGCAGAGGCACAGCTACAATGGTGTCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0375 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.025 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.45 0.0 0.0 0.0 0.0 136-137 7.025 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560686 spots for SRR12917513.sra Written 560686 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra Read 560669 spots for SRR12917513.sra Written 560669 spots for SRR12917513.sra SRR ids: ['SRR12917513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lklmmvxi SRR12917513.sra spots: 11213397 blocks: [[1, 560669], [560670, 1121338], [1121339, 1682007], [1682008, 2242676], [2242677, 2803345], [2803346, 3364014], [3364015, 3924683], [3924684, 4485352], [4485353, 5046021], [5046022, 5606690], [5606691, 6167359], [6167360, 6728028], [6728029, 7288697], [7288698, 7849366], [7849367, 8410035], [8410036, 8970704], [8970705, 9531373], [9531374, 10092042], [10092043, 10652711], [10652712, 11213397]] SRR12917513 file size 3789102 SRR12917513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917513 SRR12917513_1.fastq SRR12917513_2.fastq Input file: SRR12917513_1.fastq Paired file: SRR12917513_2.fastq trimmed: SRR12917513-trimmed-pair1.fastq, SRR12917513-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:28:39 2025 >> started Thu Feb 13 08:36:10 2025 >> done (450.759s) 11213397 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 3772 ( 0.03%) empty read pairs filtered out after trimming by size control 11209534 (99.97%) read pairs available; of these: 1194789 (10.66%) trimmed read pairs available after processing 10014745 (89.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 5 0.00% 21 14 0.00% 22 23 0.00% 23 13 0.00% 24 19 0.00% 25 15 0.00% 26 21 0.00% 27 12 0.00% 28 23 0.00% 29 17 0.00% 30 18 0.00% 31 25 0.00% 32 19 0.00% 33 16 0.00% 34 27 0.00% 35 32 0.00% 36 30 0.00% 37 25 0.00% 38 30 0.00% 39 23 0.00% 40 32 0.00% 41 35 0.00% 42 33 0.00% 43 38 0.00% 44 43 0.00% 45 33 0.00% 46 59 0.00% 47 54 0.00% 48 52 0.00% 49 53 0.00% 50 93 0.00% 51 79 0.00% 52 111 0.00% 53 96 0.00% 54 102 0.00% 55 118 0.00% 56 129 0.00% 57 169 0.00% 58 188 0.00% 59 196 0.00% 60 238 0.00% 61 275 0.00% 62 321 0.00% 63 342 0.00% 64 388 0.00% 65 417 0.00% 66 523 0.00% 67 596 0.01% 68 584 0.01% 69 697 0.01% 70 790 0.01% 71 956 0.01% 72 1107 0.01% 73 1202 0.01% 74 1385 0.01% 75 1560 0.01% 76 1696 0.02% 77 1835 0.02% 78 2015 0.02% 79 2212 0.02% 80 2362 0.02% 81 2531 0.02% 82 3041 0.03% 83 3371 0.03% 84 3660 0.03% 85 4064 0.04% 86 4330 0.04% 87 4524 0.04% 88 4909 0.04% 89 5060 0.05% 90 5528 0.05% 91 5609 0.05% 92 6056 0.05% 93 6466 0.06% 94 6942 0.06% 95 7584 0.07% 96 8012 0.07% 97 8549 0.08% 98 8681 0.08% 99 8923 0.08% 100 9136 0.08% 101 9290 0.08% 102 9818 0.09% 103 10433 0.09% 104 11022 0.10% 105 11627 0.10% 106 12041 0.11% 107 12716 0.11% 108 13010 0.12% 109 13341 0.12% 110 13435 0.12% 111 13830 0.12% 112 14262 0.13% 113 14519 0.13% 114 15026 0.13% 115 15867 0.14% 116 16559 0.15% 117 17220 0.15% 118 17866 0.16% 119 18177 0.16% 120 18283 0.16% 121 18783 0.17% 122 18753 0.17% 123 19138 0.17% 124 19811 0.18% 125 20361 0.18% 126 21177 0.19% 127 22067 0.20% 128 22436 0.20% 129 22842 0.20% 130 23698 0.21% 131 24163 0.22% 132 23999 0.21% 133 24554 0.22% 134 24788 0.22% 135 25279 0.23% 136 26032 0.23% 137 26677 0.24% 138 27424 0.24% 139 28325 0.25% 140 28596 0.26% 141 28887 0.26% 142 29039 0.26% 143 29271 0.26% 144 30020 0.27% 145 30032 0.27% 146 30707 0.27% 147 31016 0.28% 148 31680 0.28% 149 32455 0.29% 150 33823 0.30% 151 10014745 89.34% 11209534 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.67 fanout-score-rank=12 prefix-density=0.30 prefix-fanout=3.6 sequence=TGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=71.72 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=18.4 sequence=CCTTCTTCACAAT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=41 prefix-density=0.18 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=342.96 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=11.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917513 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:33:42 Started mapping on | Feb 13 10:34:15 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 21.41 Number of input reads | 11209534 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10600174 Uniquely mapped reads % | 94.56% Average mapped length | 295.31 Number of splices: Total | 9937062 Number of splices: Annotated (sjdb) | 9723482 Number of splices: GT/AG | 9759015 Number of splices: GC/AG | 139799 Number of splices: AT/AC | 9684 Number of splices: Non-canonical | 28564 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283169 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 45576 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 326191 326191 326191 N_multimapping 283169 283169 283169 N_noFeature 370162 10476957 424219 N_ambiguous 127392 670 57856 UnstrandedReadsAssigned:10102620 PositiveStrandReadsAssigned:122547 NegativeStrandReadsAssigned:10118099 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917513 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917513-trimmed-pair1.fastq SRR12917513-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,209,534 reads, 10,152,959 reads pseudoaligned [quant] estimated average fragment length: 258.252 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR12917513.ke.tsv 34699 SRR12917513.se.tsv 87100 total ==> SRR12917513.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.75 375 20.0218 Potri.005G024800.1.v4.1 1035 777.748 116 14.0213 Potri.004G059700.1.v4.1 961 703.895 54 7.21198 Potri.007G009000.2.v4.1 1416 1158.75 0 0 Potri.003G141000.2.v4.1 2943 2685.75 383.54 13.425 Potri.016G087400.1.v4.1 270 84.8333 1217.13 1348.77 Potri.015G069301.1.v4.1 564 320.759 0 0 Potri.010G195200.1.v4.1 1773 1515.75 67 4.15543 Potri.012G127500.1.v4.1 977 719.832 5056 660.305 ==> SRR12917513.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 146 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 162 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 2 SRR12917513 completed mapping pipeline successfully