Starting /dee2/code/volunteer_pipeline.sh SRR12917514 current disk space = 3092705132544 free memory = 1448157948 SRR12917514 SRAfilesize 3703e119e277edff6113b8784d18d476 SRR12917514.sra SRR12917514.sra file validated SRR12917514 is paired end SRR12917514 is conventional basespace SRR12917514 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917514_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.61125 37.0 37.0 37.0 37.0 37.0 2 36.502 37.0 37.0 37.0 37.0 37.0 3 36.6325 37.0 37.0 37.0 37.0 37.0 4 36.628 37.0 37.0 37.0 37.0 37.0 5 36.6305 37.0 37.0 37.0 37.0 37.0 6 36.635 37.0 37.0 37.0 37.0 37.0 7 36.5625 37.0 37.0 37.0 37.0 37.0 8 36.588 37.0 37.0 37.0 37.0 37.0 9 36.6685 37.0 37.0 37.0 37.0 37.0 10-14 36.6481 37.0 37.0 37.0 37.0 37.0 15-19 36.597500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6065 37.0 37.0 37.0 37.0 37.0 25-29 36.528600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.508500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5065 37.0 37.0 37.0 37.0 37.0 40-44 36.4811 37.0 37.0 37.0 37.0 37.0 45-49 36.4815 37.0 37.0 37.0 37.0 37.0 50-54 36.4677 37.0 37.0 37.0 37.0 37.0 55-59 36.427299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3728 37.0 37.0 37.0 37.0 37.0 65-69 36.2761 37.0 37.0 37.0 37.0 37.0 70-74 36.3797 37.0 37.0 37.0 37.0 37.0 75-79 36.3642 37.0 37.0 37.0 37.0 37.0 80-84 36.3503 37.0 37.0 37.0 37.0 37.0 85-89 36.3207 37.0 37.0 37.0 37.0 37.0 90-94 36.3224 37.0 37.0 37.0 37.0 37.0 95-99 36.2538 37.0 37.0 37.0 37.0 37.0 100-104 36.1971 37.0 37.0 37.0 37.0 37.0 105-109 36.1672 37.0 37.0 37.0 37.0 37.0 110-114 36.200599999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.101800000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0868 37.0 37.0 37.0 37.0 37.0 125-129 36.0221 37.0 37.0 37.0 37.0 37.0 130-134 35.975 37.0 37.0 37.0 37.0 37.0 135-139 35.85979999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.81060000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.7321 37.0 37.0 37.0 37.0 37.0 150-151 35.47475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 5.0 26 5.0 27 1.0 28 14.0 29 7.0 30 27.0 31 25.0 32 36.0 33 64.0 34 119.0 35 308.0 36 3066.0 37 320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.28657164291073 13.87846961740435 4.526131532883221 35.3088272068017 2 18.375 10.274999999999999 41.05 30.3 3 16.0 17.025000000000002 29.4 37.574999999999996 4 20.75 23.5 25.3 30.45 5 23.9 30.075000000000003 24.625 21.4 6 21.075 33.4 23.400000000000002 22.125 7 14.524999999999999 28.925 41.475 15.075 8 15.975 25.25 34.425 24.349999999999998 9 16.650000000000002 23.175 35.275 24.9 10-14 19.66 29.015 28.595 22.73 15-19 19.919999999999998 28.194999999999997 27.205000000000002 24.68 20-24 19.835 28.555000000000003 27.42 24.19 25-29 20.46 28.115000000000002 28.255000000000003 23.169999999999998 30-34 19.73 28.365000000000002 28.084999999999997 23.82 35-39 19.85 27.950000000000003 28.610000000000003 23.59 40-44 20.54 28.435 27.625 23.400000000000002 45-49 20.599999999999998 27.389999999999997 28.12 23.89 50-54 19.900000000000002 27.505000000000003 28.165000000000003 24.43 55-59 20.145 28.000000000000004 27.794999999999998 24.060000000000002 60-64 19.985 28.095 28.275 23.645 65-69 20.119999999999997 28.355000000000004 27.96 23.565 70-74 20.294999999999998 28.485 27.575 23.645 75-79 19.615 28.139999999999997 28.23 24.015 80-84 20.665 28.15 27.12 24.065 85-89 20.24 28.189999999999998 27.47 24.099999999999998 90-94 20.03 28.449999999999996 27.700000000000003 23.82 95-99 20.325 27.52 28.410000000000004 23.745 100-104 20.645 28.63 26.784999999999997 23.94 105-109 20.66 28.050000000000004 27.875 23.415 110-114 20.52 28.24 27.634999999999998 23.605 115-119 21.02 27.925 27.744999999999997 23.31 120-124 20.69 28.175 27.52 23.615 125-129 21.05 27.735 27.49 23.724999999999998 130-134 20.66 28.125 27.415 23.799999999999997 135-139 21.505 27.51 27.485 23.5 140-144 21.235 27.944999999999997 27.565 23.255 145-149 21.22 28.249999999999996 26.845000000000002 23.685000000000002 150-151 21.5625 28.3625 26.200000000000003 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.5 24 4.5 25 5.0 26 6.0 27 6.5 28 11.0 29 21.0 30 22.5 31 19.0 32 28.0 33 37.5 34 56.0 35 69.0 36 81.5 37 108.0 38 129.0 39 142.0 40 175.0 41 213.5 42 222.5 43 231.5 44 261.0 45 267.5 46 247.5 47 250.5 48 253.0 49 221.0 50 192.0 51 157.0 52 120.0 53 109.5 54 89.5 55 73.0 56 56.0 57 31.5 58 17.0 59 17.0 60 15.0 61 8.0 62 5.0 63 3.5 64 2.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.04477611940298 82.35 2 7.628524046434494 13.8 3 1.105583195135434 3.0 4 0.16583747927031509 0.6 5 0.055279159756771695 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTTCTTTTGCCCAGCCAAAAGCAAAGTTGTATATTTCACGAAACTTCT 5 0.125 No Hit ATTTAAACTGTCACTTCGGTCACCATTTGTGCTTCCCATCAAAAGCTCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.475 0.0 0.0 0.0 0.0 126-127 3.85 0.0 0.0 0.0 0.0 128-129 4.199999999999999 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.387499999999999 0.0 0.0 0.0 0.0 136-137 6.2 0.0 0.0 0.0 0.0 138-139 6.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGATTC 10 0.006830828 145.0 3 AAAAAAA 40 0.0076550315 18.125 50-54 >>END_MODULE SRR12917514 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917514_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.287 37.0 37.0 37.0 37.0 37.0 2 36.266 37.0 37.0 37.0 37.0 37.0 3 36.1255 37.0 37.0 37.0 37.0 37.0 4 36.3485 37.0 37.0 37.0 37.0 37.0 5 36.3325 37.0 37.0 37.0 37.0 37.0 6 36.349 37.0 37.0 37.0 37.0 37.0 7 36.271 37.0 37.0 37.0 37.0 37.0 8 36.31 37.0 37.0 37.0 37.0 37.0 9 36.3635 37.0 37.0 37.0 37.0 37.0 10-14 36.385400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3369 37.0 37.0 37.0 37.0 37.0 20-24 36.3407 37.0 37.0 37.0 37.0 37.0 25-29 36.2059 37.0 37.0 37.0 37.0 37.0 30-34 36.1987 37.0 37.0 37.0 37.0 37.0 35-39 36.038199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.125600000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.029 37.0 37.0 37.0 37.0 37.0 50-54 36.0612 37.0 37.0 37.0 37.0 37.0 55-59 36.0468 37.0 37.0 37.0 37.0 37.0 60-64 35.993100000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.9923 37.0 37.0 37.0 37.0 37.0 70-74 35.9791 37.0 37.0 37.0 37.0 37.0 75-79 35.9172 37.0 37.0 37.0 37.0 37.0 80-84 35.903999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9305 37.0 37.0 37.0 37.0 37.0 90-94 35.9348 37.0 37.0 37.0 37.0 37.0 95-99 35.837 37.0 37.0 37.0 37.0 37.0 100-104 35.86290000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.731700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.77139999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6885 37.0 37.0 37.0 37.0 37.0 120-124 35.548899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.598299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4293 37.0 37.0 37.0 37.0 37.0 135-139 35.4506 37.0 37.0 37.0 37.0 37.0 140-144 35.2239 37.0 37.0 37.0 32.2 37.0 145-149 35.0139 37.0 37.0 37.0 25.0 37.0 150-151 34.698499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 3.0 17 3.0 18 0.0 19 1.0 20 1.0 21 2.0 22 5.0 23 2.0 24 4.0 25 8.0 26 3.0 27 6.0 28 13.0 29 25.0 30 28.0 31 31.0 32 54.0 33 113.0 34 209.0 35 592.0 36 2722.0 37 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 27.3 8.200000000000001 23.599999999999998 2 26.25 24.0 33.525 16.225 3 18.375 27.150000000000002 37.0 17.474999999999998 4 24.725 32.824999999999996 23.599999999999998 18.85 5 25.25 38.275 20.3 16.175 6 21.475 39.825 21.8 16.900000000000002 7 20.325 24.125 38.1 17.45 8 18.975 26.6 30.65 23.775 9 20.825 24.25 31.674999999999997 23.25 10-14 22.845 29.38 27.089999999999996 20.685000000000002 15-19 23.125 28.03 28.03 20.815 20-24 22.405 28.49 28.494999999999997 20.61 25-29 22.67 28.060000000000002 28.439999999999998 20.830000000000002 30-34 22.965 27.35 28.595 21.09 35-39 22.415 28.715000000000003 27.584999999999997 21.285 40-44 22.52 27.650000000000002 28.845 20.985 45-49 22.775000000000002 27.950000000000003 27.939999999999998 21.335 50-54 22.29 29.215000000000003 27.675 20.82 55-59 23.29 28.33 27.54 20.84 60-64 23.09 28.17 27.97 20.77 65-69 23.445 27.435 28.425 20.695 70-74 23.43 27.79 27.61 21.17 75-79 23.419999999999998 27.76 27.485 21.335 80-84 22.715 27.900000000000002 27.905 21.48 85-89 23.630000000000003 28.110000000000003 27.334999999999997 20.925 90-94 23.200000000000003 28.005000000000003 27.85 20.945 95-99 24.02 27.91 27.49 20.580000000000002 100-104 23.5 28.035 27.415 21.05 105-109 23.810000000000002 27.68 27.83 20.68 110-114 24.115000000000002 27.37 28.199999999999996 20.315 115-119 24.595 27.839999999999996 27.38 20.185 120-124 24.215 28.854999999999997 26.889999999999997 20.04 125-129 24.58 27.860000000000003 27.3 20.26 130-134 24.325 27.655 27.810000000000002 20.21 135-139 24.62 27.589999999999996 27.295 20.495 140-144 25.41 27.42 27.334999999999997 19.835 145-149 26.265 27.63 26.545 19.56 150-151 25.924999999999997 26.9625 26.937499999999996 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 2.0 22 4.5 23 5.0 24 4.0 25 4.5 26 5.0 27 7.0 28 11.0 29 12.0 30 13.0 31 17.0 32 34.0 33 52.5 34 65.0 35 72.5 36 84.0 37 114.0 38 137.5 39 176.5 40 222.0 41 220.0 42 252.5 43 264.0 44 242.5 45 259.0 46 261.0 47 254.5 48 233.5 49 194.0 50 151.5 51 122.0 52 106.0 53 88.0 54 80.0 55 65.0 56 40.5 57 27.0 58 21.0 59 19.0 60 12.5 61 8.0 62 4.0 63 5.0 64 3.5 65 0.0 66 0.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 91.19357518692883 82.325 2 7.39407366380504 13.350000000000001 3 1.1631127111603434 3.15 4 0.11077263915812793 0.4 5 0.05538631957906397 0.25 6 0.05538631957906397 0.3 7 0.0 0.0 8 0.0 0.0 9 0.027693159789531983 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit AAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CATTGGTGGATTACAATCACTGGGGGTCGATTCTTTGGACAAGTTTCGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0875 0.0 0.0 0.0 0.0 124-125 3.425 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 6.125 0.0 0.0 0.0 0.0 138-139 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGGAG 10 0.006830828 145.0 5 CATAACT 10 0.006830828 145.0 1 >>END_MODULE Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623513 spots for SRR12917514.sra Written 623513 spots for SRR12917514.sra Read 623521 spots for SRR12917514.sra Written 623521 spots for SRR12917514.sra SRR ids: ['SRR12917514.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a5t1gap2 SRR12917514.sra spots: 12470268 blocks: [[1, 623513], [623514, 1247026], [1247027, 1870539], [1870540, 2494052], [2494053, 3117565], [3117566, 3741078], [3741079, 4364591], [4364592, 4988104], [4988105, 5611617], [5611618, 6235130], [6235131, 6858643], [6858644, 7482156], [7482157, 8105669], [8105670, 8729182], [8729183, 9352695], [9352696, 9976208], [9976209, 10599721], [10599722, 11223234], [11223235, 11846747], [11846748, 12470268]] SRR12917514 file size 4216242 SRR12917514 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917514 SRR12917514_1.fastq SRR12917514_2.fastq Input file: SRR12917514_1.fastq Paired file: SRR12917514_2.fastq trimmed: SRR12917514-trimmed-pair1.fastq, SRR12917514-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 10:52:20 2025 >> started Thu Feb 13 10:56:16 2025 >> done (235.531s) 12470268 read pairs processed; of these: 121 ( 0.00%) short read pairs filtered out after trimming by size control 1224 ( 0.01%) empty read pairs filtered out after trimming by size control 12468923 (99.99%) read pairs available; of these: 1312293 (10.52%) trimmed read pairs available after processing 11156630 (89.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 13 0.00% 21 9 0.00% 22 13 0.00% 23 21 0.00% 24 15 0.00% 25 23 0.00% 26 18 0.00% 27 29 0.00% 28 28 0.00% 29 10 0.00% 30 17 0.00% 31 21 0.00% 32 22 0.00% 33 30 0.00% 34 24 0.00% 35 28 0.00% 36 17 0.00% 37 23 0.00% 38 38 0.00% 39 22 0.00% 40 37 0.00% 41 23 0.00% 42 31 0.00% 43 24 0.00% 44 29 0.00% 45 35 0.00% 46 40 0.00% 47 40 0.00% 48 47 0.00% 49 57 0.00% 50 74 0.00% 51 77 0.00% 52 83 0.00% 53 91 0.00% 54 111 0.00% 55 101 0.00% 56 121 0.00% 57 132 0.00% 58 178 0.00% 59 186 0.00% 60 216 0.00% 61 240 0.00% 62 308 0.00% 63 311 0.00% 64 387 0.00% 65 382 0.00% 66 437 0.00% 67 489 0.00% 68 588 0.00% 69 638 0.01% 70 701 0.01% 71 872 0.01% 72 1036 0.01% 73 1142 0.01% 74 1355 0.01% 75 1511 0.01% 76 1575 0.01% 77 1698 0.01% 78 1836 0.01% 79 1972 0.02% 80 2229 0.02% 81 2528 0.02% 82 2836 0.02% 83 3188 0.03% 84 3495 0.03% 85 3810 0.03% 86 4060 0.03% 87 4334 0.03% 88 4696 0.04% 89 4833 0.04% 90 5163 0.04% 91 5563 0.04% 92 5950 0.05% 93 6585 0.05% 94 7268 0.06% 95 7434 0.06% 96 7871 0.06% 97 8214 0.07% 98 8629 0.07% 99 9112 0.07% 100 9578 0.08% 101 9608 0.08% 102 10279 0.08% 103 10793 0.09% 104 11329 0.09% 105 11858 0.10% 106 12434 0.10% 107 12940 0.10% 108 13182 0.11% 109 13644 0.11% 110 14171 0.11% 111 14473 0.12% 112 14947 0.12% 113 15321 0.12% 114 16261 0.13% 115 17037 0.14% 116 17397 0.14% 117 18539 0.15% 118 19161 0.15% 119 19227 0.15% 120 20054 0.16% 121 20202 0.16% 122 20564 0.16% 123 21314 0.17% 124 22043 0.18% 125 22511 0.18% 126 23951 0.19% 127 24330 0.20% 128 25355 0.20% 129 25729 0.21% 130 26651 0.21% 131 26105 0.21% 132 26859 0.22% 133 27777 0.22% 134 27669 0.22% 135 28727 0.23% 136 30107 0.24% 137 29986 0.24% 138 31281 0.25% 139 32446 0.26% 140 32648 0.26% 141 33088 0.27% 142 33491 0.27% 143 33754 0.27% 144 34503 0.28% 145 35095 0.28% 146 35935 0.29% 147 36202 0.29% 148 37431 0.30% 149 37704 0.30% 150 39158 0.31% 151 11156630 89.48% 12468923 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.83 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=42.99 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.8 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=18 prefix-density=1.01 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.25 sequence-density-rank=18 fanout-score=11.66 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=4.8 sequence=AGCAATGGCAGC SRR12917514 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:05:57 Started mapping on | Feb 13 11:05:57 Finished on | Feb 13 11:07:09 Mapping speed, Million of reads per hour | 623.45 Number of input reads | 12468923 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11839640 Uniquely mapped reads % | 94.95% Average mapped length | 295.48 Number of splices: Total | 11913609 Number of splices: Annotated (sjdb) | 11663163 Number of splices: GT/AG | 11664545 Number of splices: GC/AG | 201303 Number of splices: AT/AC | 7539 Number of splices: Non-canonical | 40222 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253515 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 36631 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 375768 375768 375768 N_multimapping 253515 253515 253515 N_noFeature 441500 11672318 502696 N_ambiguous 192273 617 85767 UnstrandedReadsAssigned:11205867 PositiveStrandReadsAssigned:166705 NegativeStrandReadsAssigned:11251177 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917514 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917514-trimmed-pair1.fastq SRR12917514-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,468,923 reads, 11,218,790 reads pseudoaligned [quant] estimated average fragment length: 257.289 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 965 rounds 52401 SRR12917514.ke.tsv 34699 SRR12917514.se.tsv 87100 total ==> SRR12917514.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.71 326 15.1677 Potri.005G024800.1.v4.1 1035 778.711 339 35.6828 Potri.004G059700.1.v4.1 961 704.839 17 1.97695 Potri.007G009000.2.v4.1 1416 1159.71 0 0 Potri.003G141000.2.v4.1 2943 2686.71 543 16.5659 Potri.016G087400.1.v4.1 270 84.1459 535 521.143 Potri.015G069301.1.v4.1 564 321.321 0 0 Potri.010G195200.1.v4.1 1773 1516.71 33 1.78339 Potri.012G127500.1.v4.1 977 720.788 83 9.43857 ==> SRR12917514.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 121 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR12917514 completed mapping pipeline successfully