Starting /dee2/code/volunteer_pipeline.sh SRR12917515 current disk space = 3092688048128 free memory = 1430127868 SRR12917515 SRAfilesize 2ae9fb557829e1bfcf7a6b868cc5135b SRR12917515.sra SRR12917515.sra file validated SRR12917515 is paired end SRR12917515 is conventional basespace SRR12917515 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917515_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.64275 37.0 37.0 37.0 37.0 37.0 2 36.524 37.0 37.0 37.0 37.0 37.0 3 36.542 37.0 37.0 37.0 37.0 37.0 4 36.613 37.0 37.0 37.0 37.0 37.0 5 36.6235 37.0 37.0 37.0 37.0 37.0 6 36.609 37.0 37.0 37.0 37.0 37.0 7 36.5625 37.0 37.0 37.0 37.0 37.0 8 36.5515 37.0 37.0 37.0 37.0 37.0 9 36.6185 37.0 37.0 37.0 37.0 37.0 10-14 36.62179999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6066 37.0 37.0 37.0 37.0 37.0 20-24 36.5784 37.0 37.0 37.0 37.0 37.0 25-29 36.503 37.0 37.0 37.0 37.0 37.0 30-34 36.4847 37.0 37.0 37.0 37.0 37.0 35-39 36.4634 37.0 37.0 37.0 37.0 37.0 40-44 36.3975 37.0 37.0 37.0 37.0 37.0 45-49 36.1563 37.0 37.0 37.0 37.0 37.0 50-54 36.306400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0399 37.0 37.0 37.0 37.0 37.0 60-64 35.9833 37.0 37.0 37.0 37.0 37.0 65-69 35.8526 37.0 37.0 37.0 37.0 37.0 70-74 36.1183 37.0 37.0 37.0 37.0 37.0 75-79 36.2774 37.0 37.0 37.0 37.0 37.0 80-84 36.3288 37.0 37.0 37.0 37.0 37.0 85-89 36.30970000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.282500000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.203500000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1827 37.0 37.0 37.0 37.0 37.0 105-109 36.1183 37.0 37.0 37.0 37.0 37.0 110-114 36.143499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.058 37.0 37.0 37.0 37.0 37.0 120-124 36.075399999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.003499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.927299999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9345 37.0 37.0 37.0 37.0 37.0 140-144 35.801300000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6777 37.0 37.0 37.0 37.0 37.0 150-151 35.52725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 5.0 26 1.0 27 13.0 28 15.0 29 11.0 30 34.0 31 35.0 32 42.0 33 50.0 34 164.0 35 354.0 36 2936.0 37 335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.36352264198148 13.209907430572928 5.3039779834876155 30.122591943957964 2 18.725 12.75 34.725 33.800000000000004 3 16.275000000000002 15.0 31.474999999999998 37.25 4 21.95 21.675 24.45 31.924999999999997 5 26.05 26.450000000000003 24.525 22.975 6 23.7 30.925000000000004 23.1 22.275 7 15.925 31.025000000000002 37.5 15.55 8 15.475 28.749999999999996 33.35 22.425 9 20.0 21.675 33.875 24.45 10-14 19.175 30.464999999999996 27.16 23.200000000000003 15-19 20.43 27.860000000000003 27.54 24.169999999999998 20-24 19.85 29.244999999999997 26.584999999999997 24.32 25-29 20.325 28.125 26.884999999999998 24.665 30-34 19.335 28.384999999999998 27.79 24.490000000000002 35-39 20.735 27.544999999999998 28.144999999999996 23.575 40-44 19.325 28.58 27.800000000000004 24.295 45-49 20.195 28.134999999999998 27.560000000000002 24.11 50-54 21.275 27.500000000000004 26.83 24.395 55-59 19.865 26.88 28.46 24.795 60-64 20.155 27.255000000000003 28.505000000000003 24.085 65-69 20.41 29.335 26.805 23.45 70-74 23.0 27.055 26.27 23.674999999999997 75-79 22.465 27.485 26.61 23.44 80-84 22.415 27.639999999999997 27.0 22.945 85-89 23.395 27.625 26.174999999999997 22.805 90-94 23.855 26.51 26.25 23.385 95-99 22.6 26.945000000000004 26.974999999999998 23.48 100-104 23.04 26.779999999999998 26.265 23.915 105-109 23.145 26.815 26.77 23.27 110-114 22.939999999999998 27.224999999999998 26.05 23.785 115-119 23.715 26.825 26.36 23.1 120-124 23.630000000000003 26.935 26.064999999999998 23.369999999999997 125-129 23.09 26.445 26.334999999999997 24.13 130-134 23.455000000000002 26.51 26.39 23.645 135-139 23.405 26.889999999999997 26.540000000000003 23.165 140-144 23.405 26.715 26.395000000000003 23.485 145-149 23.855 27.155 25.66 23.330000000000002 150-151 24.5125 25.275 26.400000000000002 23.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.5 25 3.5 26 6.0 27 5.5 28 7.5 29 13.5 30 15.5 31 22.0 32 30.0 33 37.5 34 63.0 35 85.0 36 83.0 37 89.0 38 100.0 39 130.5 40 159.5 41 171.0 42 204.5 43 240.0 44 249.0 45 235.5 46 247.5 47 246.5 48 210.5 49 211.5 50 197.0 51 164.0 52 136.5 53 98.5 54 88.5 55 85.0 56 69.5 57 48.5 58 29.0 59 22.0 60 17.5 61 9.5 62 9.0 63 7.5 64 6.5 65 52.5 66 58.0 67 11.5 68 4.0 69 3.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.71813795061028 79.9 2 8.174850979279023 14.399999999999999 3 0.8515469770082317 2.25 4 0.19869429463525404 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02838489923360772 0.27499999999999997 >50 0.02838489923360772 2.475 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGTCGGTATCTCGTAT 99 2.475 TruSeq Adapter, Index 15 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTGTCGGTATCGCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 15 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.4 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 6.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAAAA 10 0.006830828 145.0 7 AAGAGCA 30 0.0017973486 72.5 7 GATCGGA 30 0.0017973486 72.5 1 TCGGAAG 30 0.0017973486 72.5 3 CGGAAGA 30 0.0017973486 72.5 4 AGAGCAC 30 0.0017973486 72.5 8 ATCGGAA 30 0.0017973486 72.5 2 GAAGAGC 35 0.0033124194 62.14286 6 GAGCACA 35 0.0033124194 62.14286 9 GGAAGAG 40 0.005621335 54.375 5 >>END_MODULE SRR12917515 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917515_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.271 37.0 37.0 37.0 37.0 37.0 2 36.094 37.0 37.0 37.0 37.0 37.0 3 36.021 37.0 37.0 37.0 37.0 37.0 4 36.132 37.0 37.0 37.0 37.0 37.0 5 36.193 37.0 37.0 37.0 37.0 37.0 6 36.135 37.0 37.0 37.0 37.0 37.0 7 36.107 37.0 37.0 37.0 37.0 37.0 8 36.1865 37.0 37.0 37.0 37.0 37.0 9 36.13 37.0 37.0 37.0 37.0 37.0 10-14 36.1109 37.0 37.0 37.0 37.0 37.0 15-19 36.1075 37.0 37.0 37.0 37.0 37.0 20-24 36.0202 37.0 37.0 37.0 37.0 37.0 25-29 35.843900000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.6881 37.0 37.0 37.0 37.0 37.0 35-39 35.458600000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.561 37.0 37.0 37.0 37.0 37.0 45-49 35.40859999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.4683 37.0 37.0 37.0 37.0 37.0 55-59 35.5756 37.0 37.0 37.0 37.0 37.0 60-64 35.7273 37.0 37.0 37.0 37.0 37.0 65-69 35.563900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.4026 37.0 37.0 37.0 37.0 37.0 75-79 35.352999999999994 37.0 37.0 37.0 34.6 37.0 80-84 35.53529999999999 37.0 37.0 37.0 34.6 37.0 85-89 35.630100000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.671499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.6703 37.0 37.0 37.0 37.0 37.0 100-104 35.714 37.0 37.0 37.0 37.0 37.0 105-109 35.623200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6195 37.0 37.0 37.0 37.0 37.0 115-119 35.5526 37.0 37.0 37.0 37.0 37.0 120-124 35.435500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4531 37.0 37.0 37.0 37.0 37.0 130-134 35.3771 37.0 37.0 37.0 34.6 37.0 135-139 35.393299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.188599999999994 37.0 37.0 37.0 27.4 37.0 145-149 35.050399999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.6635 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 8.0 15 3.0 16 5.0 17 2.0 18 6.0 19 2.0 20 4.0 21 3.0 22 1.0 23 8.0 24 10.0 25 2.0 26 5.0 27 15.0 28 15.0 29 25.0 30 38.0 31 56.0 32 86.0 33 122.0 34 227.0 35 641.0 36 2563.0 37 146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.85 26.224999999999998 7.625 20.3 2 32.275 25.1 27.05 15.575 3 23.7 26.85 32.25 17.2 4 26.6 32.725 22.175 18.5 5 29.799999999999997 35.55 18.725 15.925 6 23.525 37.925 20.05 18.5 7 25.374999999999996 23.275000000000002 33.074999999999996 18.275 8 24.95 25.724999999999998 26.025 23.3 9 23.65 23.849999999999998 29.299999999999997 23.200000000000003 10-14 26.51 28.265 25.39 19.835 15-19 26.63 27.395000000000003 24.959999999999997 21.015 20-24 26.174999999999997 27.74 25.585 20.5 25-29 26.445 26.865 26.279999999999998 20.41 30-34 26.200000000000003 27.325 26.32 20.155 35-39 26.045 27.015 26.575 20.365 40-44 25.919999999999998 27.46 26.265 20.355 45-49 25.85 27.084999999999997 26.150000000000002 20.915 50-54 26.27 26.545 26.16 21.025 55-59 26.625 26.58 26.205000000000002 20.59 60-64 26.384999999999998 26.245 26.290000000000003 21.08 65-69 26.695 26.015 25.985000000000003 21.305 70-74 26.02 26.85 26.035000000000004 21.095 75-79 25.985000000000003 26.584999999999997 26.240000000000002 21.19 80-84 26.029999999999998 26.810000000000002 26.05 21.11 85-89 26.665 27.089999999999996 25.56 20.685000000000002 90-94 26.889999999999997 27.1 25.19 20.82 95-99 26.810000000000002 27.02 25.924999999999997 20.244999999999997 100-104 27.37 27.185 25.585 19.86 105-109 26.525 26.8 26.575 20.1 110-114 27.125 26.85 26.025 20.0 115-119 26.840000000000003 27.229999999999997 25.665 20.265 120-124 27.045 27.415 25.474999999999998 20.064999999999998 125-129 27.529999999999998 26.88 25.505 20.085 130-134 27.705000000000002 26.875 25.324999999999996 20.095 135-139 27.765 26.32 26.605 19.31 140-144 28.095 25.785000000000004 26.450000000000003 19.67 145-149 28.24 26.85 25.035 19.875 150-151 28.65 25.724999999999998 26.2875 19.3375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.5 25 2.5 26 3.5 27 5.5 28 5.5 29 2.5 30 4.5 31 11.5 32 17.0 33 25.5 34 35.0 35 48.0 36 69.5 37 83.5 38 101.0 39 135.0 40 156.5 41 183.0 42 231.0 43 267.0 44 273.5 45 263.5 46 266.0 47 258.5 48 221.5 49 188.5 50 170.0 51 145.5 52 126.0 53 107.0 54 98.5 55 90.5 56 65.5 57 45.5 58 35.0 59 30.5 60 22.0 61 16.0 62 11.0 63 7.0 64 5.0 65 4.0 66 2.5 67 1.0 68 2.0 69 1.5 70 1.0 71 1.0 72 1.5 73 1.5 74 1.0 75 2.0 76 1.5 77 2.0 78 3.0 79 1.0 80 0.0 81 0.0 82 1.5 83 2.0 84 0.5 85 0.0 86 1.5 87 1.5 88 0.5 89 0.5 90 1.0 91 2.0 92 1.0 93 0.5 94 2.5 95 3.5 96 4.5 97 5.0 98 8.5 99 21.0 100 44.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.75 #Duplication Level Percentage of deduplicated Percentage of total 1 91.1549295774648 80.9 2 7.661971830985916 13.600000000000001 3 0.7887323943661971 2.1 4 0.22535211267605634 0.8 5 0.056338028169014086 0.25 6 0.028169014084507043 0.15 7 0.0 0.0 8 0.028169014084507043 0.2 9 0.0 0.0 >10 0.028169014084507043 0.27499999999999997 >50 0.028169014084507043 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 69 1.725 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 11 0.27499999999999997 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 8 0.2 No Hit GAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.35 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.0125 0.0 0.0 0.0 0.0 130-131 4.425 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.1375 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGAG 10 0.006830828 145.0 145 GAATCAA 10 0.006830828 145.0 4 GATTATG 10 0.006830828 145.0 1 >>END_MODULE Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806714 spots for SRR12917515.sra Written 806714 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra Read 806698 spots for SRR12917515.sra Written 806698 spots for SRR12917515.sra SRR ids: ['SRR12917515.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_42cbolpu SRR12917515.sra spots: 16133976 blocks: [[1, 806698], [806699, 1613396], [1613397, 2420094], [2420095, 3226792], [3226793, 4033490], [4033491, 4840188], [4840189, 5646886], [5646887, 6453584], [6453585, 7260282], [7260283, 8066980], [8066981, 8873678], [8873679, 9680376], [9680377, 10487074], [10487075, 11293772], [11293773, 12100470], [12100471, 12907168], [12907169, 13713866], [13713867, 14520564], [14520565, 15327262], [15327263, 16133976]] SRR12917515 file size 5461330 SRR12917515 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917515 SRR12917515_1.fastq SRR12917515_2.fastq Input file: SRR12917515_1.fastq Paired file: SRR12917515_2.fastq trimmed: SRR12917515-trimmed-pair1.fastq, SRR12917515-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:05:45 2025 >> started Thu Feb 13 11:06:03 2025 >> done (18.570s) 16133976 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 459351 ( 2.85%) empty read pairs filtered out after trimming by size control 15674563 (97.15%) read pairs available; of these: 1654149 (10.55%) trimmed read pairs available after processing 14020414 (89.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 6 0.00% 21 12 0.00% 22 6 0.00% 23 15 0.00% 24 12 0.00% 25 17 0.00% 26 28 0.00% 27 28 0.00% 28 30 0.00% 29 30 0.00% 30 33 0.00% 31 37 0.00% 32 27 0.00% 33 30 0.00% 34 30 0.00% 35 17 0.00% 36 38 0.00% 37 39 0.00% 38 31 0.00% 39 46 0.00% 40 45 0.00% 41 42 0.00% 42 37 0.00% 43 45 0.00% 44 34 0.00% 45 49 0.00% 46 52 0.00% 47 62 0.00% 48 66 0.00% 49 77 0.00% 50 82 0.00% 51 94 0.00% 52 118 0.00% 53 133 0.00% 54 142 0.00% 55 163 0.00% 56 144 0.00% 57 179 0.00% 58 198 0.00% 59 272 0.00% 60 275 0.00% 61 277 0.00% 62 407 0.00% 63 465 0.00% 64 503 0.00% 65 571 0.00% 66 652 0.00% 67 710 0.00% 68 776 0.00% 69 880 0.01% 70 968 0.01% 71 1115 0.01% 72 1433 0.01% 73 1482 0.01% 74 1723 0.01% 75 1895 0.01% 76 2113 0.01% 77 2165 0.01% 78 2444 0.02% 79 2639 0.02% 80 2917 0.02% 81 3408 0.02% 82 3743 0.02% 83 4148 0.03% 84 4614 0.03% 85 5059 0.03% 86 5324 0.03% 87 5675 0.04% 88 6021 0.04% 89 6306 0.04% 90 6849 0.04% 91 7262 0.05% 92 7530 0.05% 93 8364 0.05% 94 8739 0.06% 95 9826 0.06% 96 10099 0.06% 97 10694 0.07% 98 10965 0.07% 99 11212 0.07% 100 11650 0.07% 101 12202 0.08% 102 12588 0.08% 103 13396 0.09% 104 14285 0.09% 105 14967 0.10% 106 15328 0.10% 107 16119 0.10% 108 16609 0.11% 109 17308 0.11% 110 17522 0.11% 111 17938 0.11% 112 18955 0.12% 113 19120 0.12% 114 20102 0.13% 115 21092 0.13% 116 21666 0.14% 117 22848 0.15% 118 23337 0.15% 119 24372 0.16% 120 25253 0.16% 121 25293 0.16% 122 25991 0.17% 123 26804 0.17% 124 27517 0.18% 125 28407 0.18% 126 29572 0.19% 127 30676 0.20% 128 31233 0.20% 129 32467 0.21% 130 32992 0.21% 131 33442 0.21% 132 34018 0.22% 133 34670 0.22% 134 35028 0.22% 135 36662 0.23% 136 37024 0.24% 137 37969 0.24% 138 38911 0.25% 139 40755 0.26% 140 40851 0.26% 141 42048 0.27% 142 42243 0.27% 143 42405 0.27% 144 43880 0.28% 145 44833 0.29% 146 45307 0.29% 147 46178 0.29% 148 47852 0.31% 149 48271 0.31% 150 49393 0.32% 151 14020414 89.45% 15674563 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.92 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=72.43 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=12.3 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=14 prefix-density=1.20 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=39.12 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.7 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12917515 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:06:57 Started mapping on | Feb 13 11:06:57 Finished on | Feb 13 11:08:49 Mapping speed, Million of reads per hour | 503.83 Number of input reads | 15674563 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14593480 Uniquely mapped reads % | 93.10% Average mapped length | 295.43 Number of splices: Total | 14384645 Number of splices: Annotated (sjdb) | 14113069 Number of splices: GT/AG | 14054994 Number of splices: GC/AG | 264473 Number of splices: AT/AC | 10272 Number of splices: Non-canonical | 54906 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.09 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368215 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 184001 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712868 712868 712868 N_multimapping 368215 368215 368215 N_noFeature 433063 14273489 511431 N_ambiguous 367100 1512 124425 UnstrandedReadsAssigned:13793317 PositiveStrandReadsAssigned:318479 NegativeStrandReadsAssigned:13957624 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917515 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917515-trimmed-pair1.fastq SRR12917515-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,674,563 reads, 14,114,374 reads pseudoaligned [quant] estimated average fragment length: 253.35 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR12917515.ke.tsv 34699 SRR12917515.se.tsv 87100 total ==> SRR12917515.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.65 383 10.1885 Potri.005G024800.1.v4.1 1035 782.65 637 38.2286 Potri.004G059700.1.v4.1 961 708.693 69 4.57306 Potri.007G009000.2.v4.1 1416 1163.65 0 0 Potri.003G141000.2.v4.1 2943 2690.65 539 9.40909 Potri.016G087400.1.v4.1 270 83.9778 1247 697.458 Potri.015G069301.1.v4.1 564 323.414 0 0 Potri.010G195200.1.v4.1 1773 1520.65 49 1.5135 Potri.012G127500.1.v4.1 977 724.669 261 16.9168 ==> SRR12917515.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12917515 completed mapping pipeline successfully