Starting /dee2/code/volunteer_pipeline.sh SRR12917516 current disk space = 3093078843392 free memory = 1416088708 SRR12917516 SRAfilesize ca1168c83514d1ac88254bcbe6316e5d SRR12917516.sra SRR12917516.sra file validated SRR12917516 is paired end SRR12917516 is conventional basespace SRR12917516 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57625 37.0 37.0 37.0 37.0 37.0 2 36.5335 37.0 37.0 37.0 37.0 37.0 3 36.685 37.0 37.0 37.0 37.0 37.0 4 36.6305 37.0 37.0 37.0 37.0 37.0 5 36.73 37.0 37.0 37.0 37.0 37.0 6 36.732 37.0 37.0 37.0 37.0 37.0 7 36.5185 37.0 37.0 37.0 37.0 37.0 8 36.6875 37.0 37.0 37.0 37.0 37.0 9 36.7215 37.0 37.0 37.0 37.0 37.0 10-14 36.6398 37.0 37.0 37.0 37.0 37.0 15-19 36.6184 37.0 37.0 37.0 37.0 37.0 20-24 36.564499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5153 37.0 37.0 37.0 37.0 37.0 30-34 36.4678 37.0 37.0 37.0 37.0 37.0 35-39 36.4579 37.0 37.0 37.0 37.0 37.0 40-44 36.450900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3814 37.0 37.0 37.0 37.0 37.0 50-54 36.4198 37.0 37.0 37.0 37.0 37.0 55-59 36.3161 37.0 37.0 37.0 37.0 37.0 60-64 36.2553 37.0 37.0 37.0 37.0 37.0 65-69 36.221900000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.2438 37.0 37.0 37.0 37.0 37.0 75-79 36.3332 37.0 37.0 37.0 37.0 37.0 80-84 36.276199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2642 37.0 37.0 37.0 37.0 37.0 90-94 36.2226 37.0 37.0 37.0 37.0 37.0 95-99 36.185700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1152 37.0 37.0 37.0 37.0 37.0 105-109 36.051199999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.061600000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.0268 37.0 37.0 37.0 37.0 37.0 120-124 35.9785 37.0 37.0 37.0 37.0 37.0 125-129 35.84439999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8843 37.0 37.0 37.0 37.0 37.0 135-139 35.788700000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.5382 37.0 37.0 37.0 37.0 37.0 145-149 35.5675 37.0 37.0 37.0 37.0 37.0 150-151 35.32275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.0 25 6.0 26 10.0 27 12.0 28 13.0 29 10.0 30 16.0 31 42.0 32 35.0 33 62.0 34 130.0 35 342.0 36 2988.0 37 326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.31032758189547 14.20355088772193 7.25181295323831 37.23430857714429 2 19.45 11.725 37.65 31.175000000000004 3 17.349999999999998 16.1 26.075 40.475 4 21.0 21.7 25.15 32.15 5 23.575 27.474999999999998 24.975 23.974999999999998 6 22.650000000000002 31.825 22.925 22.6 7 15.575 29.825000000000003 39.2 15.4 8 17.025000000000002 28.599999999999998 33.35 21.025 9 18.05 24.875 34.325 22.75 10-14 19.220000000000002 31.025000000000002 27.055 22.7 15-19 19.825 28.665000000000003 27.46 24.05 20-24 19.6 29.32 27.55 23.53 25-29 19.759999999999998 29.17 27.605 23.465 30-34 19.32 29.205 27.73 23.745 35-39 19.53 28.99 27.589999999999996 23.89 40-44 19.555 28.865000000000002 27.500000000000004 24.08 45-49 20.18 28.349999999999998 27.634999999999998 23.835 50-54 19.869999999999997 28.389999999999997 27.395000000000003 24.345 55-59 19.685 28.655 27.689999999999998 23.97 60-64 19.775000000000002 28.09 27.779999999999998 24.355 65-69 20.325 28.51 27.49 23.674999999999997 70-74 20.62 28.744999999999997 27.275 23.36 75-79 19.945 29.125 26.805 24.125 80-84 21.075 28.415000000000003 26.884999999999998 23.625 85-89 20.32 28.125 27.525 24.03 90-94 20.72 28.29 26.834999999999997 24.154999999999998 95-99 20.555 27.905 27.134999999999998 24.404999999999998 100-104 21.265 28.265 26.700000000000003 23.77 105-109 21.240000000000002 28.205000000000002 26.52 24.035 110-114 21.3 27.91 26.985 23.805 115-119 21.29 28.110000000000003 26.529999999999998 24.07 120-124 21.735 28.33 25.665 24.27 125-129 21.105 28.375 26.540000000000003 23.98 130-134 21.240000000000002 27.889999999999997 26.779999999999998 24.09 135-139 21.310000000000002 28.83 25.935000000000002 23.925 140-144 21.035 27.88 26.275 24.81 145-149 21.625 28.02 26.284999999999997 24.07 150-151 21.987499999999997 27.800000000000004 25.4875 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.5 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 1.0 19 0.5 20 1.5 21 3.0 22 2.5 23 1.0 24 2.0 25 3.0 26 4.0 27 5.5 28 7.0 29 14.5 30 21.5 31 32.5 32 44.5 33 55.5 34 64.5 35 71.5 36 100.5 37 124.5 38 133.5 39 165.0 40 197.5 41 197.5 42 205.0 43 234.0 44 238.0 45 231.5 46 241.0 47 236.0 48 217.5 49 189.0 50 164.5 51 145.5 52 113.0 53 104.0 54 88.5 55 65.5 56 55.5 57 40.0 58 35.0 59 31.5 60 22.0 61 12.5 62 6.5 63 7.0 64 7.0 65 13.0 66 12.5 67 4.5 68 4.5 69 3.0 70 2.0 71 1.0 72 1.0 73 1.5 74 2.0 75 1.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.08002192381474 84.0 2 6.851192107426693 12.5 3 0.8769525897506167 2.4 4 0.13702384214853383 0.5 5 0.0 0.0 6 0.027404768429706773 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027404768429706773 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATACCACATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 22 (97% over 38bp) GTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.8625 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.525 0.0 0.0 0.0 0.0 106-107 2.8499999999999996 0.0 0.0 0.0 0.0 108-109 3.1625 0.0 0.0 0.0 0.0 110-111 3.6 0.0 0.0 0.0 0.0 112-113 3.9375 0.0 0.0 0.0 0.0 114-115 4.2125 0.0 0.0 0.0 0.0 116-117 4.6625 0.0 0.0 0.0 0.0 118-119 5.0625 0.0 0.0 0.0 0.0 120-121 5.525 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.575 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.774999999999999 0.0 0.0 0.0 0.0 134-135 9.4875 0.0 0.0 0.0 0.0 136-137 10.337499999999999 0.0 0.0 0.0 0.0 138-139 11.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGTTC 10 0.006830828 145.0 3 CTCCTGT 10 0.006830828 145.0 1 TAATTGT 10 0.006830828 145.0 6 TCCTGTT 10 0.006830828 145.0 2 CTGTTCA 10 0.006830828 145.0 4 >>END_MODULE SRR12917516 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917516_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35225 37.0 37.0 37.0 37.0 37.0 2 36.33 37.0 37.0 37.0 37.0 37.0 3 36.3495 37.0 37.0 37.0 37.0 37.0 4 36.372 37.0 37.0 37.0 37.0 37.0 5 36.4 37.0 37.0 37.0 37.0 37.0 6 36.307 37.0 37.0 37.0 37.0 37.0 7 36.445 37.0 37.0 37.0 37.0 37.0 8 36.4785 37.0 37.0 37.0 37.0 37.0 9 36.42 37.0 37.0 37.0 37.0 37.0 10-14 36.4196 37.0 37.0 37.0 37.0 37.0 15-19 36.3635 37.0 37.0 37.0 37.0 37.0 20-24 36.3159 37.0 37.0 37.0 37.0 37.0 25-29 36.2152 37.0 37.0 37.0 37.0 37.0 30-34 36.154900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1267 37.0 37.0 37.0 37.0 37.0 40-44 36.069 37.0 37.0 37.0 37.0 37.0 45-49 36.033 37.0 37.0 37.0 37.0 37.0 50-54 35.9905 37.0 37.0 37.0 37.0 37.0 55-59 36.045700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.08069999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.05159999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.982 37.0 37.0 37.0 37.0 37.0 75-79 35.93 37.0 37.0 37.0 37.0 37.0 80-84 35.9248 37.0 37.0 37.0 37.0 37.0 85-89 35.968399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.011900000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0082 37.0 37.0 37.0 37.0 37.0 100-104 35.9379 37.0 37.0 37.0 37.0 37.0 105-109 35.899300000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8317 37.0 37.0 37.0 37.0 37.0 115-119 35.832 37.0 37.0 37.0 37.0 37.0 120-124 35.745400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.687400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.632 37.0 37.0 37.0 37.0 37.0 135-139 35.5261 37.0 37.0 37.0 37.0 37.0 140-144 35.2688 37.0 37.0 37.0 34.6 37.0 145-149 35.0877 37.0 37.0 37.0 29.8 37.0 150-151 34.5865 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 4.0 16 4.0 17 3.0 18 5.0 19 3.0 20 3.0 21 0.0 22 7.0 23 5.0 24 6.0 25 4.0 26 11.0 27 13.0 28 8.0 29 11.0 30 20.0 31 36.0 32 26.0 33 89.0 34 171.0 35 485.0 36 2825.0 37 254.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.41010252563141 24.981245311327832 10.527631907976994 24.081020255063766 2 30.025000000000002 24.3 28.825 16.85 3 21.0 26.900000000000002 33.2 18.9 4 24.15 33.575 23.35 18.925 5 26.474999999999998 36.65 20.275000000000002 16.6 6 22.325 40.6 21.05 16.025 7 23.5 22.2 35.625 18.675 8 22.625 26.0 28.799999999999997 22.575 9 23.0 24.05 29.425 23.525 10-14 24.965 29.695 24.995 20.345 15-19 24.625 28.555000000000003 26.6 20.22 20-24 24.215 28.57 26.47 20.745 25-29 24.21 27.495000000000005 27.675 20.62 30-34 23.94 28.455000000000002 26.889999999999997 20.715 35-39 24.38 27.71 27.3 20.61 40-44 24.335 27.994999999999997 27.08 20.59 45-49 24.785 27.255000000000003 27.529999999999998 20.43 50-54 23.73 28.42 26.77 21.08 55-59 24.62 27.224999999999998 27.400000000000002 20.755000000000003 60-64 24.654999999999998 27.935 27.16 20.25 65-69 24.48 27.245 27.155 21.12 70-74 24.68 27.35 27.46 20.51 75-79 24.055 28.255000000000003 26.669999999999998 21.02 80-84 24.55 27.544999999999998 26.99 20.915 85-89 24.02 28.134999999999998 27.465 20.380000000000003 90-94 25.009999999999998 27.325 27.16 20.505000000000003 95-99 24.095 27.415 27.715 20.775 100-104 24.95 27.79 26.655 20.605 105-109 24.25 27.860000000000003 27.389999999999997 20.5 110-114 24.740000000000002 28.235 26.815 20.21 115-119 25.790000000000003 28.025 26.290000000000003 19.895 120-124 25.619999999999997 28.000000000000004 26.255 20.125 125-129 25.88 27.555000000000003 26.455000000000002 20.11 130-134 25.679999999999996 28.03 26.615 19.675 135-139 25.81 27.62 26.889999999999997 19.68 140-144 26.625 26.924999999999997 26.25 20.200000000000003 145-149 26.63 27.685 25.905 19.78 150-151 27.125 27.6375 25.4375 19.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 2.0 18 2.5 19 1.0 20 1.0 21 0.5 22 0.5 23 2.0 24 3.0 25 2.0 26 5.0 27 6.0 28 3.0 29 3.5 30 8.5 31 13.5 32 18.5 33 27.0 34 41.5 35 55.5 36 74.5 37 99.5 38 117.0 39 155.0 40 201.0 41 241.5 42 254.0 43 252.0 44 273.0 45 272.5 46 250.5 47 242.0 48 232.0 49 199.5 50 172.5 51 146.5 52 114.0 53 96.5 54 87.0 55 68.0 56 48.5 57 36.0 58 27.5 59 23.0 60 17.0 61 12.0 62 9.5 63 9.0 64 6.5 65 3.0 66 2.5 67 2.5 68 4.5 69 4.5 70 3.0 71 3.5 72 1.5 73 1.0 74 2.0 75 1.0 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 1.5 96 3.0 97 2.0 98 1.5 99 3.5 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.44820065430753 84.775 2 6.543075245365322 12.0 3 0.8724100327153763 2.4 4 0.10905125408942204 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02726281352235551 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.1500000000000004 0.0 0.0 0.0 0.0 104-105 2.55 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 114-115 4.237500000000001 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.0875 0.0 0.0 0.0 0.0 120-121 5.550000000000001 0.0 0.0 0.0 0.0 122-123 6.05 0.0 0.0 0.0 0.0 124-125 6.6375 0.0 0.0 0.0 0.0 126-127 7.225 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.325 0.0 0.0 0.0 0.0 132-133 8.850000000000001 0.0 0.0 0.0 0.0 134-135 9.5625 0.0 0.0 0.0 0.0 136-137 10.4375 0.0 0.0 0.0 0.0 138-139 11.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATGC 10 0.006830828 145.0 9 GCAAAAC 10 0.006830828 145.0 3 ATCACTG 10 0.006830828 145.0 145 GGTGCAG 10 0.006830828 145.0 145 >>END_MODULE Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra Read 461678 spots for SRR12917516.sra Written 461678 spots for SRR12917516.sra SRR ids: ['SRR12917516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x1i2hkpc SRR12917516.sra spots: 9233560 blocks: [[1, 461678], [461679, 923356], [923357, 1385034], [1385035, 1846712], [1846713, 2308390], [2308391, 2770068], [2770069, 3231746], [3231747, 3693424], [3693425, 4155102], [4155103, 4616780], [4616781, 5078458], [5078459, 5540136], [5540137, 6001814], [6001815, 6463492], [6463493, 6925170], [6925171, 7386848], [7386849, 7848526], [7848527, 8310204], [8310205, 8771882], [8771883, 9233560]] SRR12917516 file size 3117764 SRR12917516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917516 SRR12917516_1.fastq SRR12917516_2.fastq Input file: SRR12917516_1.fastq Paired file: SRR12917516_2.fastq trimmed: SRR12917516-trimmed-pair1.fastq, SRR12917516-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:06:59 2025 >> started Thu Feb 13 11:07:10 2025 >> done (11.047s) 9233560 read pairs processed; of these: 54 ( 0.00%) short read pairs filtered out after trimming by size control 35482 ( 0.38%) empty read pairs filtered out after trimming by size control 9198024 (99.62%) read pairs available; of these: 1461693 (15.89%) trimmed read pairs available after processing 7736331 (84.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 8 0.00% 21 4 0.00% 22 11 0.00% 23 7 0.00% 24 10 0.00% 25 12 0.00% 26 13 0.00% 27 8 0.00% 28 13 0.00% 29 13 0.00% 30 13 0.00% 31 13 0.00% 32 10 0.00% 33 10 0.00% 34 22 0.00% 35 12 0.00% 36 23 0.00% 37 19 0.00% 38 21 0.00% 39 26 0.00% 40 21 0.00% 41 28 0.00% 42 19 0.00% 43 20 0.00% 44 35 0.00% 45 32 0.00% 46 27 0.00% 47 47 0.00% 48 55 0.00% 49 55 0.00% 50 67 0.00% 51 87 0.00% 52 80 0.00% 53 113 0.00% 54 106 0.00% 55 147 0.00% 56 144 0.00% 57 162 0.00% 58 167 0.00% 59 229 0.00% 60 320 0.00% 61 355 0.00% 62 402 0.00% 63 480 0.01% 64 560 0.01% 65 598 0.01% 66 670 0.01% 67 755 0.01% 68 799 0.01% 69 1100 0.01% 70 1145 0.01% 71 1357 0.01% 72 1517 0.02% 73 1804 0.02% 74 1953 0.02% 75 2128 0.02% 76 2377 0.03% 77 2644 0.03% 78 2849 0.03% 79 2927 0.03% 80 3359 0.04% 81 3740 0.04% 82 4147 0.05% 83 4693 0.05% 84 5178 0.06% 85 5528 0.06% 86 5875 0.06% 87 5956 0.06% 88 6378 0.07% 89 6543 0.07% 90 7107 0.08% 91 7465 0.08% 92 7748 0.08% 93 8534 0.09% 94 9172 0.10% 95 9712 0.11% 96 10296 0.11% 97 10744 0.12% 98 11061 0.12% 99 11564 0.13% 100 11775 0.13% 101 11957 0.13% 102 12747 0.14% 103 13400 0.15% 104 14237 0.15% 105 14894 0.16% 106 15849 0.17% 107 16165 0.18% 108 16793 0.18% 109 16849 0.18% 110 17111 0.19% 111 17341 0.19% 112 17978 0.20% 113 18022 0.20% 114 19503 0.21% 115 20327 0.22% 116 21114 0.23% 117 21507 0.23% 118 22760 0.25% 119 22669 0.25% 120 22961 0.25% 121 23152 0.25% 122 23441 0.25% 123 23725 0.26% 124 24893 0.27% 125 25583 0.28% 126 26315 0.29% 127 27508 0.30% 128 27907 0.30% 129 28041 0.30% 130 28870 0.31% 131 28554 0.31% 132 29037 0.32% 133 29509 0.32% 134 29796 0.32% 135 30835 0.34% 136 30878 0.34% 137 31542 0.34% 138 32518 0.35% 139 33200 0.36% 140 33621 0.37% 141 33943 0.37% 142 34536 0.38% 143 34381 0.37% 144 34238 0.37% 145 34920 0.38% 146 35155 0.38% 147 35432 0.39% 148 36377 0.40% 149 36536 0.40% 150 37829 0.41% 151 7736331 84.11% 9198024 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=24 prefix-density=1.37 prefix-fanout=2.1 sequence=TGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=32.93 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=5.1 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAAAAACAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAACCTGTCTAACACTAGCTCTCTGTCTGCAACTACTACTA criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=23 prefix-density=0.97 prefix-fanout=2.1 sequence=TGTCAAATGAAAAGCTCTTCGTGGTGTTCCAAGGTGTTTCAAATGTAGCTGGTGAAACAAGTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=379.36 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.8 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTT SRR12917516 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:07:53 Started mapping on | Feb 13 11:07:53 Finished on | Feb 13 11:09:31 Mapping speed, Million of reads per hour | 337.89 Number of input reads | 9198024 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 8107308 Uniquely mapped reads % | 88.14% Average mapped length | 292.29 Number of splices: Total | 7021351 Number of splices: Annotated (sjdb) | 6853240 Number of splices: GT/AG | 6869540 Number of splices: GC/AG | 96777 Number of splices: AT/AC | 7508 Number of splices: Non-canonical | 47526 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263156 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 210547 % of reads mapped to too many loci | 2.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.32% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 827560 827560 827560 N_multimapping 263156 263156 263156 N_noFeature 199381 7986914 245349 N_ambiguous 141107 519 66446 UnstrandedReadsAssigned:7766820 PositiveStrandReadsAssigned:119875 NegativeStrandReadsAssigned:7795513 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917516 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917516-trimmed-pair1.fastq SRR12917516-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,198,024 reads, 7,931,986 reads pseudoaligned [quant] estimated average fragment length: 235.108 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR12917516.ke.tsv 34699 SRR12917516.se.tsv 87100 total ==> SRR12917516.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.89 216 12.7603 Potri.005G024800.1.v4.1 1035 800.892 119 15.6584 Potri.004G059700.1.v4.1 961 727.004 17 2.46426 Potri.007G009000.2.v4.1 1416 1181.89 0 0 Potri.003G141000.2.v4.1 2943 2708.89 181.242 7.05085 Potri.016G087400.1.v4.1 270 92.9133 794 900.57 Potri.015G069301.1.v4.1 564 339.541 0 0 Potri.010G195200.1.v4.1 1773 1538.89 46 3.1501 Potri.012G127500.1.v4.1 977 742.922 2937 416.616 ==> SRR12917516.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 0 SRR12917516 completed mapping pipeline successfully