Starting /dee2/code/volunteer_pipeline.sh SRR12917517 current disk space = 3093325029376 free memory = 1370606908 SRR12917517 SRAfilesize ca81dbe918df80600e3947c95b521989 SRR12917517.sra SRR12917517.sra file validated SRR12917517 is paired end SRR12917517 is conventional basespace SRR12917517 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917517_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57625 37.0 37.0 37.0 37.0 37.0 2 36.4675 37.0 37.0 37.0 37.0 37.0 3 36.562 37.0 37.0 37.0 37.0 37.0 4 36.5795 37.0 37.0 37.0 37.0 37.0 5 36.6485 37.0 37.0 37.0 37.0 37.0 6 36.6335 37.0 37.0 37.0 37.0 37.0 7 36.471 37.0 37.0 37.0 37.0 37.0 8 36.572 37.0 37.0 37.0 37.0 37.0 9 36.658 37.0 37.0 37.0 37.0 37.0 10-14 36.631299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.582800000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.581199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.52910000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.48819999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.479200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.5144 37.0 37.0 37.0 37.0 37.0 45-49 36.4633 37.0 37.0 37.0 37.0 37.0 50-54 36.474599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3918 37.0 37.0 37.0 37.0 37.0 60-64 36.3527 37.0 37.0 37.0 37.0 37.0 65-69 36.36409999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.349900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.349000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.388400000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.305600000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.374199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2919 37.0 37.0 37.0 37.0 37.0 100-104 36.253699999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.209199999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1855 37.0 37.0 37.0 37.0 37.0 115-119 36.1224 37.0 37.0 37.0 37.0 37.0 120-124 36.110699999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0822 37.0 37.0 37.0 37.0 37.0 130-134 36.0081 37.0 37.0 37.0 37.0 37.0 135-139 35.9246 37.0 37.0 37.0 37.0 37.0 140-144 35.8646 37.0 37.0 37.0 37.0 37.0 145-149 35.770599999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.596000000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 5.0 27 6.0 28 13.0 29 19.0 30 23.0 31 23.0 32 38.0 33 60.0 34 79.0 35 311.0 36 3140.0 37 279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.08677169292323 12.578144536134033 4.976244061015254 35.35883970992748 2 19.15 11.25 38.2 31.4 3 15.825 16.775000000000002 29.575000000000003 37.824999999999996 4 21.875 22.95 25.025 30.15 5 24.025 29.4 24.375 22.2 6 20.775 33.25 23.525 22.45 7 16.150000000000002 28.299999999999997 39.275 16.275000000000002 8 15.45 26.0 33.900000000000006 24.65 9 16.675 24.325 36.175000000000004 22.825 10-14 19.095000000000002 30.209999999999997 27.73 22.965 15-19 19.855 27.99 28.285 23.87 20-24 20.275000000000002 27.725 27.529999999999998 24.47 25-29 20.305 28.675 27.27 23.75 30-34 20.21 28.249999999999996 28.084999999999997 23.455000000000002 35-39 20.005 28.055000000000003 27.76 24.18 40-44 20.02 29.044999999999998 27.525 23.41 45-49 19.525000000000002 28.345 27.994999999999997 24.135 50-54 20.275000000000002 28.155 27.705000000000002 23.865 55-59 19.689999999999998 27.925 28.125 24.26 60-64 20.66 28.57 27.265 23.505000000000003 65-69 20.044999999999998 28.395 27.785 23.775 70-74 20.72 27.55 27.99 23.74 75-79 20.07 28.294999999999998 27.655 23.98 80-84 19.735 28.37 27.845 24.05 85-89 20.255000000000003 28.46 26.905 24.38 90-94 19.5 28.725 27.169999999999998 24.605 95-99 20.205000000000002 28.050000000000004 28.144999999999996 23.599999999999998 100-104 20.905 28.549999999999997 27.435 23.11 105-109 20.580000000000002 28.575 27.089999999999996 23.755000000000003 110-114 19.885 27.889999999999997 28.199999999999996 24.025 115-119 20.345 27.705000000000002 27.515 24.435000000000002 120-124 20.044999999999998 28.075 27.12 24.759999999999998 125-129 21.055 27.750000000000004 27.235 23.96 130-134 20.655 27.91 27.785 23.65 135-139 21.145 27.26 27.51 24.085 140-144 21.195 28.33 26.965 23.51 145-149 20.75 28.34 26.634999999999998 24.275 150-151 20.45 28.5875 27.9375 23.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 0.5 21 1.0 22 2.5 23 3.5 24 5.0 25 3.5 26 1.0 27 6.0 28 9.5 29 10.5 30 17.0 31 23.0 32 33.0 33 42.0 34 54.5 35 73.5 36 80.0 37 99.5 38 134.5 39 155.0 40 164.5 41 197.5 42 234.0 43 243.0 44 256.0 45 267.5 46 271.5 47 262.0 48 232.5 49 221.5 50 190.5 51 147.0 52 113.0 53 87.0 54 85.0 55 73.5 56 62.0 57 43.0 58 26.0 59 23.0 60 16.5 61 10.5 62 5.5 63 2.0 64 1.5 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2551724137931 82.69999999999999 2 7.531034482758621 13.65 3 0.9103448275862069 2.475 4 0.2206896551724138 0.8 5 0.08275862068965517 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGGGGGAGAACCAGGCGTCTTCACGGCATGGTTCATCATCTCTCATGC 5 0.125 No Hit GGGGACGGTTGTCAGAGGATGAGCTAACTGCAGCAACAAGCTCAGAACCA 5 0.125 No Hit GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.9124999999999996 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.65 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGCTT 10 0.006830828 145.0 145 CCTTTTC 10 0.006830828 145.0 3 GTGACTT 10 0.006830828 145.0 1 >>END_MODULE SRR12917517 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917517_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.347 37.0 37.0 37.0 37.0 37.0 2 36.01 37.0 37.0 37.0 37.0 37.0 3 36.138 37.0 37.0 37.0 37.0 37.0 4 36.24 37.0 37.0 37.0 37.0 37.0 5 36.307 37.0 37.0 37.0 37.0 37.0 6 36.155 37.0 37.0 37.0 37.0 37.0 7 36.2785 37.0 37.0 37.0 37.0 37.0 8 36.2705 37.0 37.0 37.0 37.0 37.0 9 36.2725 37.0 37.0 37.0 37.0 37.0 10-14 36.2562 37.0 37.0 37.0 37.0 37.0 15-19 36.2244 37.0 37.0 37.0 37.0 37.0 20-24 36.173100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.0846 37.0 37.0 37.0 37.0 37.0 30-34 36.0181 37.0 37.0 37.0 37.0 37.0 35-39 36.025099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0243 37.0 37.0 37.0 37.0 37.0 45-49 35.935199999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.903800000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.9738 37.0 37.0 37.0 37.0 37.0 60-64 35.9408 37.0 37.0 37.0 37.0 37.0 65-69 35.87670000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.827600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8091 37.0 37.0 37.0 37.0 37.0 80-84 35.8289 37.0 37.0 37.0 37.0 37.0 85-89 35.817899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.83019999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8245 37.0 37.0 37.0 37.0 37.0 100-104 35.8038 37.0 37.0 37.0 37.0 37.0 105-109 35.606700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.690000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.592499999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.5268 37.0 37.0 37.0 37.0 37.0 125-129 35.5048 37.0 37.0 37.0 37.0 37.0 130-134 35.43169999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.3684 37.0 37.0 37.0 37.0 37.0 140-144 35.193599999999996 37.0 37.0 37.0 29.8 37.0 145-149 35.0339 37.0 37.0 37.0 27.4 37.0 150-151 34.620000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 2.0 16 6.0 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 6.0 23 6.0 24 5.0 25 10.0 26 8.0 27 8.0 28 15.0 29 16.0 30 21.0 31 42.0 32 59.0 33 107.0 34 217.0 35 607.0 36 2682.0 37 170.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 27.3 9.1 22.975 2 27.175 25.45 30.8 16.575 3 19.75 27.075 34.525 18.65 4 23.474999999999998 33.85 23.225 19.45 5 25.0 37.375 21.25 16.375 6 20.599999999999998 38.65 21.975 18.775 7 19.925 23.974999999999998 38.05 18.05 8 21.25 25.7 28.349999999999998 24.7 9 21.15 24.875 30.15 23.825 10-14 22.905 28.7 27.435 20.96 15-19 23.39 28.535 27.27 20.805 20-24 23.335 28.455000000000002 27.955000000000002 20.255000000000003 25-29 23.705000000000002 27.905 27.894999999999996 20.495 30-34 23.535 28.185 27.515 20.765 35-39 22.735 28.189999999999998 27.905 21.17 40-44 23.09 27.99 28.22 20.7 45-49 23.1 27.950000000000003 28.035 20.915 50-54 23.62 28.325 27.400000000000002 20.655 55-59 23.385 27.49 27.79 21.335 60-64 23.035 27.165 28.28 21.52 65-69 22.994999999999997 27.205000000000002 27.88 21.92 70-74 23.5 27.625 27.889999999999997 20.985 75-79 23.825 27.66 27.52 20.995 80-84 23.93 27.839999999999996 27.74 20.49 85-89 23.64 27.529999999999998 27.534999999999997 21.295 90-94 24.075 27.565 27.455000000000002 20.905 95-99 23.945 28.095 27.089999999999996 20.87 100-104 24.02 27.87 27.465 20.645 105-109 23.705000000000002 27.93 27.735 20.630000000000003 110-114 23.735 28.43 27.950000000000003 19.885 115-119 23.64 27.72 27.785 20.855 120-124 24.765 27.685 26.945000000000004 20.605 125-129 24.64 28.215 27.015 20.13 130-134 24.95 27.565 27.22 20.265 135-139 24.515 27.71 27.26 20.515 140-144 24.635 27.455000000000002 27.779999999999998 20.13 145-149 26.169999999999998 27.029999999999998 26.314999999999998 20.485 150-151 25.2875 28.425 26.5 19.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.0 18 2.0 19 1.5 20 0.5 21 0.5 22 2.5 23 4.0 24 3.0 25 5.0 26 6.5 27 7.0 28 10.5 29 12.0 30 10.0 31 16.5 32 31.5 33 45.0 34 50.5 35 55.5 36 77.0 37 97.5 38 117.0 39 157.0 40 195.5 41 214.5 42 258.0 43 279.5 44 265.0 45 261.0 46 256.5 47 260.0 48 239.5 49 204.0 50 172.5 51 131.0 52 119.5 53 105.5 54 79.0 55 68.5 56 50.5 57 35.0 58 22.5 59 16.0 60 12.0 61 8.5 62 6.0 63 2.5 64 1.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.5 92 1.5 93 1.0 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.56293222683264 82.75 2 7.247579529737207 13.100000000000001 3 0.8022130013831258 2.175 4 0.13831258644536654 0.5 5 0.11065006915629322 0.5 6 0.027662517289073305 0.15 7 0.027662517289073305 0.17500000000000002 8 0.027662517289073305 0.2 9 0.05532503457814661 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit ATCCTCAATTGAGATGGCCAAGAAGCTTCCTCAGGAGAAACAATTATGCC 5 0.125 No Hit GATCAAACCCAGCTAGAGAAGCTTTTGTGGAGATGTGCGCAGATGAGTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 5.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTACTG 10 0.006830828 145.0 7 AGTTTAC 10 0.006830828 145.0 145 >>END_MODULE Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411287 spots for SRR12917517.sra Written 411287 spots for SRR12917517.sra Read 411295 spots for SRR12917517.sra Written 411295 spots for SRR12917517.sra SRR ids: ['SRR12917517.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j3d0lfib SRR12917517.sra spots: 8225748 blocks: [[1, 411287], [411288, 822574], [822575, 1233861], [1233862, 1645148], [1645149, 2056435], [2056436, 2467722], [2467723, 2879009], [2879010, 3290296], [3290297, 3701583], [3701584, 4112870], [4112871, 4524157], [4524158, 4935444], [4935445, 5346731], [5346732, 5758018], [5758019, 6169305], [6169306, 6580592], [6580593, 6991879], [6991880, 7403166], [7403167, 7814453], [7814454, 8225748]] SRR12917517 file size 2777234 SRR12917517 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917517 SRR12917517_1.fastq SRR12917517_2.fastq Input file: SRR12917517_1.fastq Paired file: SRR12917517_2.fastq trimmed: SRR12917517-trimmed-pair1.fastq, SRR12917517-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:09:05 2025 >> started Thu Feb 13 11:09:15 2025 >> done (9.771s) 8225748 read pairs processed; of these: 52 ( 0.00%) short read pairs filtered out after trimming by size control 1270 ( 0.02%) empty read pairs filtered out after trimming by size control 8224426 (99.98%) read pairs available; of these: 653807 ( 7.95%) trimmed read pairs available after processing 7570619 (92.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 5 0.00% 21 4 0.00% 22 10 0.00% 23 8 0.00% 24 6 0.00% 25 13 0.00% 26 12 0.00% 27 7 0.00% 28 5 0.00% 29 16 0.00% 30 18 0.00% 31 12 0.00% 32 6 0.00% 33 18 0.00% 34 11 0.00% 35 10 0.00% 36 12 0.00% 37 12 0.00% 38 18 0.00% 39 18 0.00% 40 13 0.00% 41 22 0.00% 42 15 0.00% 43 19 0.00% 44 21 0.00% 45 20 0.00% 46 25 0.00% 47 14 0.00% 48 19 0.00% 49 30 0.00% 50 40 0.00% 51 38 0.00% 52 52 0.00% 53 57 0.00% 54 52 0.00% 55 56 0.00% 56 60 0.00% 57 77 0.00% 58 91 0.00% 59 119 0.00% 60 133 0.00% 61 139 0.00% 62 170 0.00% 63 179 0.00% 64 228 0.00% 65 229 0.00% 66 285 0.00% 67 249 0.00% 68 301 0.00% 69 342 0.00% 70 425 0.01% 71 477 0.01% 72 588 0.01% 73 686 0.01% 74 760 0.01% 75 805 0.01% 76 821 0.01% 77 954 0.01% 78 1011 0.01% 79 1117 0.01% 80 1302 0.02% 81 1388 0.02% 82 1565 0.02% 83 1760 0.02% 84 1873 0.02% 85 2145 0.03% 86 2295 0.03% 87 2368 0.03% 88 2480 0.03% 89 2479 0.03% 90 2722 0.03% 91 2820 0.03% 92 3088 0.04% 93 3340 0.04% 94 3445 0.04% 95 3671 0.04% 96 3963 0.05% 97 4261 0.05% 98 4321 0.05% 99 4613 0.06% 100 4665 0.06% 101 4725 0.06% 102 4996 0.06% 103 5204 0.06% 104 5563 0.07% 105 5719 0.07% 106 6043 0.07% 107 6298 0.08% 108 6545 0.08% 109 6685 0.08% 110 6782 0.08% 111 6962 0.08% 112 7240 0.09% 113 7181 0.09% 114 7812 0.09% 115 8135 0.10% 116 8484 0.10% 117 9003 0.11% 118 9067 0.11% 119 9414 0.11% 120 9772 0.12% 121 9655 0.12% 122 10261 0.12% 123 10430 0.13% 124 10515 0.13% 125 11106 0.14% 126 11636 0.14% 127 11752 0.14% 128 12183 0.15% 129 12462 0.15% 130 12852 0.16% 131 12637 0.15% 132 13022 0.16% 133 13601 0.17% 134 13669 0.17% 135 14133 0.17% 136 14529 0.18% 137 15138 0.18% 138 15414 0.19% 139 16361 0.20% 140 16358 0.20% 141 16796 0.20% 142 16668 0.20% 143 17107 0.21% 144 17521 0.21% 145 17720 0.22% 146 18166 0.22% 147 18741 0.23% 148 19879 0.24% 149 19605 0.24% 150 20723 0.25% 151 7570619 92.05% 8224426 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=261.04 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=1.11 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.27 sequence-density-rank=16 fanout-score=13.62 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=5.9 sequence=AGCAATGGCAGCA SRR12917517 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:09:56 Started mapping on | Feb 13 11:09:56 Finished on | Feb 13 11:22:17 Mapping speed, Million of reads per hour | 39.96 Number of input reads | 8224426 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 7731045 Uniquely mapped reads % | 94.00% Average mapped length | 296.63 Number of splices: Total | 7939292 Number of splices: Annotated (sjdb) | 7777854 Number of splices: GT/AG | 7768751 Number of splices: GC/AG | 134185 Number of splices: AT/AC | 4587 Number of splices: Non-canonical | 31769 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177425 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 37700 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 315956 315956 315956 N_multimapping 177425 177425 177425 N_noFeature 263906 7577117 306427 N_ambiguous 165244 382 53793 UnstrandedReadsAssigned:7301895 PositiveStrandReadsAssigned:153546 NegativeStrandReadsAssigned:7370825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917517 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917517-trimmed-pair1.fastq SRR12917517-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,224,426 reads, 7,356,814 reads pseudoaligned [quant] estimated average fragment length: 270.555 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR12917517.ke.tsv 34699 SRR12917517.se.tsv 87100 total ==> SRR12917517.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.44 221 13.1178 Potri.005G024800.1.v4.1 1035 765.445 238 32.2688 Potri.004G059700.1.v4.1 961 691.602 23 3.45137 Potri.007G009000.2.v4.1 1416 1146.44 0 0 Potri.003G141000.2.v4.1 2943 2673.44 356 13.8197 Potri.016G087400.1.v4.1 270 78.9364 353 464.105 Potri.015G069301.1.v4.1 564 310.06 0 0 Potri.010G195200.1.v4.1 1773 1503.44 18 1.24252 Potri.012G127500.1.v4.1 977 707.503 179 26.2569 ==> SRR12917517.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12917517 completed mapping pipeline successfully