Starting /dee2/code/volunteer_pipeline.sh SRR12917518 current disk space = 3093435944960 free memory = 1424696548 SRR12917518 SRAfilesize 9921d06b1ceb2851a5e2fa618c8f9d6a SRR12917518.sra SRR12917518.sra file validated SRR12917518 is paired end SRR12917518 is conventional basespace SRR12917518 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917518_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6575 37.0 37.0 37.0 37.0 37.0 2 36.4625 37.0 37.0 37.0 37.0 37.0 3 36.6465 37.0 37.0 37.0 37.0 37.0 4 36.651 37.0 37.0 37.0 37.0 37.0 5 36.717 37.0 37.0 37.0 37.0 37.0 6 36.6705 37.0 37.0 37.0 37.0 37.0 7 36.5955 37.0 37.0 37.0 37.0 37.0 8 36.5785 37.0 37.0 37.0 37.0 37.0 9 36.6235 37.0 37.0 37.0 37.0 37.0 10-14 36.5812 37.0 37.0 37.0 37.0 37.0 15-19 36.5772 37.0 37.0 37.0 37.0 37.0 20-24 36.5432 37.0 37.0 37.0 37.0 37.0 25-29 36.48780000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.399800000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4033 37.0 37.0 37.0 37.0 37.0 40-44 36.3727 37.0 37.0 37.0 37.0 37.0 45-49 36.3303 37.0 37.0 37.0 37.0 37.0 50-54 36.3365 37.0 37.0 37.0 37.0 37.0 55-59 36.2792 37.0 37.0 37.0 37.0 37.0 60-64 36.2681 37.0 37.0 37.0 37.0 37.0 65-69 36.2077 37.0 37.0 37.0 37.0 37.0 70-74 36.2235 37.0 37.0 37.0 37.0 37.0 75-79 36.1916 37.0 37.0 37.0 37.0 37.0 80-84 36.1975 37.0 37.0 37.0 37.0 37.0 85-89 36.1595 37.0 37.0 37.0 37.0 37.0 90-94 36.17659999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.124 37.0 37.0 37.0 37.0 37.0 100-104 36.055400000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0154 37.0 37.0 37.0 37.0 37.0 110-114 36.001799999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.89020000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.8765 37.0 37.0 37.0 37.0 37.0 125-129 35.835899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.7698 37.0 37.0 37.0 37.0 37.0 135-139 35.6533 37.0 37.0 37.0 37.0 37.0 140-144 35.5481 37.0 37.0 37.0 37.0 37.0 145-149 35.4664 37.0 37.0 37.0 34.6 37.0 150-151 35.13775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 3.0 21 2.0 22 2.0 23 2.0 24 6.0 25 5.0 26 6.0 27 16.0 28 8.0 29 19.0 30 23.0 31 31.0 32 48.0 33 74.0 34 121.0 35 340.0 36 2993.0 37 298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.800000000000004 10.85 6.075 36.275 2 18.25 10.075000000000001 40.150000000000006 31.525 3 15.575 18.099999999999998 29.75 36.575 4 21.099999999999998 22.45 25.775 30.675 5 22.8 29.525000000000002 26.174999999999997 21.5 6 20.1 32.525 23.625 23.75 7 13.375 30.45 41.8 14.374999999999998 8 15.75 24.45 35.325 24.474999999999998 9 16.525000000000002 21.875 37.475 24.125 10-14 19.82 29.09 28.720000000000002 22.37 15-19 19.405 28.15 28.865000000000002 23.580000000000002 20-24 19.81 27.6 28.615000000000002 23.974999999999998 25-29 19.48 28.110000000000003 28.515 23.895 30-34 19.825 28.205000000000002 28.439999999999998 23.53 35-39 19.725 29.07 27.855 23.35 40-44 19.675 28.605000000000004 27.694999999999997 24.025 45-49 19.57 28.27 28.475 23.685000000000002 50-54 19.75 28.78 28.185 23.285 55-59 19.375 29.080000000000002 27.76 23.785 60-64 19.939999999999998 28.645 27.875 23.54 65-69 19.634999999999998 28.17 28.12 24.075 70-74 19.855 28.765 28.105000000000004 23.275000000000002 75-79 20.26 28.610000000000003 27.605 23.525 80-84 20.175 28.549999999999997 27.83 23.445 85-89 20.1 28.88 27.51 23.51 90-94 20.54 28.4 27.865000000000002 23.195 95-99 19.98 28.205000000000002 27.79 24.025 100-104 20.369999999999997 28.349999999999998 27.465 23.815 105-109 20.28 28.205000000000002 28.105000000000004 23.41 110-114 19.794999999999998 28.7 27.405 24.099999999999998 115-119 20.06 28.09 27.985 23.865 120-124 19.86 29.455 27.125 23.56 125-129 20.555 28.225 27.345000000000002 23.875 130-134 20.115 27.54 27.805000000000003 24.54 135-139 20.075000000000003 28.244999999999997 27.639999999999997 24.04 140-144 20.27 27.560000000000002 27.51 24.66 145-149 20.785 27.77 27.015 24.43 150-151 20.7125 28.812500000000004 26.687499999999996 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.5 22 4.5 23 4.0 24 4.0 25 8.0 26 7.5 27 9.5 28 14.0 29 13.5 30 14.5 31 29.5 32 44.5 33 45.5 34 50.5 35 69.0 36 100.5 37 120.5 38 127.5 39 153.0 40 182.5 41 208.5 42 237.0 43 263.0 44 284.0 45 285.0 46 265.0 47 247.5 48 214.5 49 188.0 50 166.5 51 125.0 52 110.5 53 96.0 54 66.0 55 49.5 56 44.5 57 37.0 58 26.0 59 20.0 60 14.0 61 9.5 62 9.0 63 6.5 64 5.0 65 3.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.89336235038084 84.45 2 7.426550598476606 13.65 3 0.6528835690968444 1.7999999999999998 4 0.02720348204570185 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.0750000000000002 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.1 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.0999999999999996 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.65 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.8625 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGAT 10 0.006830828 145.0 1 TCTGATG 10 0.006830828 145.0 2 AAAAAAA 95 0.007278115 10.684211 60-64 >>END_MODULE SRR12917518 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917518_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45375 37.0 37.0 37.0 37.0 37.0 2 36.2675 37.0 37.0 37.0 37.0 37.0 3 36.3625 37.0 37.0 37.0 37.0 37.0 4 36.3695 37.0 37.0 37.0 37.0 37.0 5 36.5305 37.0 37.0 37.0 37.0 37.0 6 36.339 37.0 37.0 37.0 37.0 37.0 7 36.3525 37.0 37.0 37.0 37.0 37.0 8 36.4225 37.0 37.0 37.0 37.0 37.0 9 36.339 37.0 37.0 37.0 37.0 37.0 10-14 36.3564 37.0 37.0 37.0 37.0 37.0 15-19 36.4255 37.0 37.0 37.0 37.0 37.0 20-24 36.3147 37.0 37.0 37.0 37.0 37.0 25-29 36.2518 37.0 37.0 37.0 37.0 37.0 30-34 36.2033 37.0 37.0 37.0 37.0 37.0 35-39 36.14880000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1309 37.0 37.0 37.0 37.0 37.0 45-49 36.1109 37.0 37.0 37.0 37.0 37.0 50-54 36.0581 37.0 37.0 37.0 37.0 37.0 55-59 36.0524 37.0 37.0 37.0 37.0 37.0 60-64 36.0826 37.0 37.0 37.0 37.0 37.0 65-69 36.0493 37.0 37.0 37.0 37.0 37.0 70-74 35.9713 37.0 37.0 37.0 37.0 37.0 75-79 35.9037 37.0 37.0 37.0 37.0 37.0 80-84 35.99849999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9339 37.0 37.0 37.0 37.0 37.0 90-94 35.992399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9336 37.0 37.0 37.0 37.0 37.0 100-104 35.845600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.813300000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7192 37.0 37.0 37.0 37.0 37.0 115-119 35.7375 37.0 37.0 37.0 37.0 37.0 120-124 35.6479 37.0 37.0 37.0 37.0 37.0 125-129 35.5455 37.0 37.0 37.0 37.0 37.0 130-134 35.466499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.479 37.0 37.0 37.0 37.0 37.0 140-144 35.276599999999995 37.0 37.0 37.0 29.8 37.0 145-149 35.170300000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.7295 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 0.0 21 1.0 22 3.0 23 3.0 24 6.0 25 3.0 26 14.0 27 4.0 28 19.0 29 17.0 30 26.0 31 36.0 32 53.0 33 102.0 34 174.0 35 572.0 36 2760.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.31132783195799 19.904976244061015 9.777444361090271 25.006251562890725 2 31.900000000000002 19.85 31.075000000000003 17.175 3 19.275000000000002 25.75 38.175 16.8 4 25.424999999999997 33.675 22.1 18.8 5 26.775 36.175000000000004 20.875 16.175 6 21.075 40.525 22.175 16.225 7 21.675 21.7 38.5 18.125 8 20.1 26.125 29.65 24.125 9 20.375 24.8 31.225 23.599999999999998 10-14 23.45 29.015 27.27 20.265 15-19 23.985 28.005000000000003 27.74 20.27 20-24 23.7 28.52 27.41 20.369999999999997 25-29 23.615 27.725 28.07 20.59 30-34 23.96 28.035 27.54 20.465 35-39 23.44 29.42 27.02 20.119999999999997 40-44 24.035 27.889999999999997 27.85 20.225 45-49 23.745 27.644999999999996 28.82 19.79 50-54 24.05 28.355000000000004 27.48 20.115 55-59 23.755000000000003 28.375 27.52 20.349999999999998 60-64 23.895 27.74 28.194999999999997 20.169999999999998 65-69 23.59 27.900000000000002 27.889999999999997 20.62 70-74 23.965 28.22 27.72 20.095 75-79 23.330000000000002 28.285 28.685 19.7 80-84 24.635 27.99 27.24 20.135 85-89 23.885 27.500000000000004 28.49 20.125 90-94 24.235 27.900000000000002 27.975 19.89 95-99 23.87 28.225 27.700000000000003 20.205000000000002 100-104 24.615000000000002 27.765 27.555000000000003 20.064999999999998 105-109 24.01 28.360000000000003 27.965 19.665 110-114 24.535 27.985 27.435 20.044999999999998 115-119 24.42 28.42 27.029999999999998 20.13 120-124 24.46 27.900000000000002 27.650000000000002 19.99 125-129 24.72 27.845 27.88 19.555 130-134 24.935 28.325 26.779999999999998 19.96 135-139 25.845000000000002 28.244999999999997 26.595000000000002 19.314999999999998 140-144 25.580000000000002 28.02 26.875 19.525000000000002 145-149 26.290000000000003 27.63 26.91 19.17 150-151 26.937499999999996 27.400000000000002 26.375 19.287499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 0.5 23 2.0 24 3.0 25 4.0 26 7.0 27 10.5 28 11.5 29 13.0 30 20.0 31 28.0 32 33.0 33 38.0 34 42.5 35 58.0 36 75.5 37 101.5 38 137.0 39 170.5 40 199.0 41 224.5 42 253.0 43 280.0 44 287.0 45 296.0 46 278.0 47 243.5 48 227.5 49 186.5 50 154.0 51 128.5 52 98.0 53 82.0 54 73.0 55 50.5 56 37.0 57 33.5 58 22.0 59 14.5 60 12.0 61 11.5 62 8.0 63 3.5 64 3.0 65 1.5 66 2.5 67 3.0 68 0.5 69 0.0 70 1.5 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 1.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.5 97 2.0 98 1.0 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 92.07516339869281 84.52499999999999 2 7.24400871459695 13.3 3 0.5991285403050108 1.6500000000000001 4 0.054466230936819175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027233115468409588 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.0750000000000002 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.1 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.1375 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.425000000000001 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.175 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCTGG 10 0.006830828 145.0 9 ACTTCAA 10 0.006830828 145.0 4 >>END_MODULE Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699652 spots for SRR12917518.sra Written 699652 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra Read 699638 spots for SRR12917518.sra Written 699638 spots for SRR12917518.sra SRR ids: ['SRR12917518.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_evce4x90 SRR12917518.sra spots: 13992774 blocks: [[1, 699638], [699639, 1399276], [1399277, 2098914], [2098915, 2798552], [2798553, 3498190], [3498191, 4197828], [4197829, 4897466], [4897467, 5597104], [5597105, 6296742], [6296743, 6996380], [6996381, 7696018], [7696019, 8395656], [8395657, 9095294], [9095295, 9794932], [9794933, 10494570], [10494571, 11194208], [11194209, 11893846], [11893847, 12593484], [12593485, 13293122], [13293123, 13992774]] SRR12917518 file size 4733656 SRR12917518 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917518 SRR12917518_1.fastq SRR12917518_2.fastq Input file: SRR12917518_1.fastq Paired file: SRR12917518_2.fastq trimmed: SRR12917518-trimmed-pair1.fastq, SRR12917518-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:38:17 2025 >> started Thu Feb 13 11:38:32 2025 >> done (14.476s) 13992774 read pairs processed; of these: 220 ( 0.00%) short read pairs filtered out after trimming by size control 4267 ( 0.03%) empty read pairs filtered out after trimming by size control 13988287 (99.97%) read pairs available; of these: 1577846 (11.28%) trimmed read pairs available after processing 12410441 (88.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 20 0.00% 20 23 0.00% 21 18 0.00% 22 23 0.00% 23 21 0.00% 24 37 0.00% 25 31 0.00% 26 37 0.00% 27 40 0.00% 28 35 0.00% 29 61 0.00% 30 39 0.00% 31 40 0.00% 32 27 0.00% 33 35 0.00% 34 42 0.00% 35 47 0.00% 36 55 0.00% 37 61 0.00% 38 49 0.00% 39 76 0.00% 40 57 0.00% 41 40 0.00% 42 53 0.00% 43 58 0.00% 44 64 0.00% 45 77 0.00% 46 79 0.00% 47 88 0.00% 48 100 0.00% 49 107 0.00% 50 145 0.00% 51 160 0.00% 52 197 0.00% 53 193 0.00% 54 213 0.00% 55 225 0.00% 56 277 0.00% 57 312 0.00% 58 387 0.00% 59 445 0.00% 60 493 0.00% 61 600 0.00% 62 705 0.01% 63 761 0.01% 64 894 0.01% 65 883 0.01% 66 990 0.01% 67 970 0.01% 68 1265 0.01% 69 1437 0.01% 70 1769 0.01% 71 1967 0.01% 72 2237 0.02% 73 2546 0.02% 74 2793 0.02% 75 2874 0.02% 76 3123 0.02% 77 3324 0.02% 78 3514 0.03% 79 3856 0.03% 80 4201 0.03% 81 4728 0.03% 82 5222 0.04% 83 5712 0.04% 84 6258 0.04% 85 6871 0.05% 86 6659 0.05% 87 6913 0.05% 88 7070 0.05% 89 7557 0.05% 90 7797 0.06% 91 8370 0.06% 92 9115 0.07% 93 9724 0.07% 94 10744 0.08% 95 11273 0.08% 96 11559 0.08% 97 11327 0.08% 98 11399 0.08% 99 11835 0.08% 100 12231 0.09% 101 12608 0.09% 102 13705 0.10% 103 14623 0.10% 104 15590 0.11% 105 15978 0.11% 106 16859 0.12% 107 16497 0.12% 108 16993 0.12% 109 16975 0.12% 110 17128 0.12% 111 17682 0.13% 112 18589 0.13% 113 19514 0.14% 114 20682 0.15% 115 21446 0.15% 116 22117 0.16% 117 22788 0.16% 118 22809 0.16% 119 22887 0.16% 120 22934 0.16% 121 23567 0.17% 122 23821 0.17% 123 24925 0.18% 124 26278 0.19% 125 27541 0.20% 126 28502 0.20% 127 29293 0.21% 128 28780 0.21% 129 29474 0.21% 130 29202 0.21% 131 29548 0.21% 132 30075 0.22% 133 30906 0.22% 134 31793 0.23% 135 33270 0.24% 136 33988 0.24% 137 34248 0.24% 138 35879 0.26% 139 35467 0.25% 140 35476 0.25% 141 36035 0.26% 142 36012 0.26% 143 36502 0.26% 144 37984 0.27% 145 38929 0.28% 146 39336 0.28% 147 40455 0.29% 148 41189 0.29% 149 41420 0.30% 150 41867 0.30% 151 12410441 88.72% 13988287 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.65 fanout-score-rank=19 prefix-density=0.35 prefix-fanout=4.5 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=438.03 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=34.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=13.22 fanout-score-rank=17 prefix-density=0.31 prefix-fanout=6.9 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=386.59 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=33.8 sequence=AAGAAGAAGAAA SRR12917518 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:39:17 Started mapping on | Feb 13 11:39:18 Finished on | Feb 13 11:41:01 Mapping speed, Million of reads per hour | 488.91 Number of input reads | 13988287 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12959061 Uniquely mapped reads % | 92.64% Average mapped length | 294.35 Number of splices: Total | 12300000 Number of splices: Annotated (sjdb) | 12012706 Number of splices: GT/AG | 12074259 Number of splices: GC/AG | 173910 Number of splices: AT/AC | 13605 Number of splices: Non-canonical | 38226 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314851 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 46658 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.58% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714375 714375 714375 N_multimapping 314851 314851 314851 N_noFeature 505723 12788653 583378 N_ambiguous 166673 937 73416 UnstrandedReadsAssigned:12286665 PositiveStrandReadsAssigned:169471 NegativeStrandReadsAssigned:12302267 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917518 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917518-trimmed-pair1.fastq SRR12917518-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,988,287 reads, 12,347,902 reads pseudoaligned [quant] estimated average fragment length: 251.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR12917518.ke.tsv 34699 SRR12917518.se.tsv 87100 total ==> SRR12917518.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.92 416 19.0269 Potri.005G024800.1.v4.1 1035 784.923 156 16.0707 Potri.004G059700.1.v4.1 961 711.001 33 3.75303 Potri.007G009000.2.v4.1 1416 1165.92 0 0 Potri.003G141000.2.v4.1 2943 2692.92 630.18 18.9225 Potri.016G087400.1.v4.1 270 86.1825 884.647 830.022 Potri.015G069301.1.v4.1 564 324.963 0 0 Potri.010G195200.1.v4.1 1773 1522.92 53 2.81408 Potri.012G127500.1.v4.1 977 726.965 7807 868.378 ==> SRR12917518.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 152 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 75 SRR12917518 completed mapping pipeline successfully