Starting /dee2/code/volunteer_pipeline.sh SRR12917519 current disk space = 3093401903104 free memory = 1445189812 SRR12917519 SRAfilesize bc7e03c1b1e763dda61fcf098fe4bdd6 SRR12917519.sra SRR12917519.sra file validated SRR12917519 is paired end SRR12917519 is conventional basespace SRR12917519 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917519_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.70425 37.0 37.0 37.0 37.0 37.0 2 36.649 37.0 37.0 37.0 37.0 37.0 3 36.689 37.0 37.0 37.0 37.0 37.0 4 36.6795 37.0 37.0 37.0 37.0 37.0 5 36.7295 37.0 37.0 37.0 37.0 37.0 6 36.67 37.0 37.0 37.0 37.0 37.0 7 36.605 37.0 37.0 37.0 37.0 37.0 8 36.6585 37.0 37.0 37.0 37.0 37.0 9 36.6715 37.0 37.0 37.0 37.0 37.0 10-14 36.629000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6118 37.0 37.0 37.0 37.0 37.0 20-24 36.5648 37.0 37.0 37.0 37.0 37.0 25-29 36.507 37.0 37.0 37.0 37.0 37.0 30-34 36.4995 37.0 37.0 37.0 37.0 37.0 35-39 36.461400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4043 37.0 37.0 37.0 37.0 37.0 45-49 36.2641 37.0 37.0 37.0 37.0 37.0 50-54 36.307399999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.211 37.0 37.0 37.0 37.0 37.0 60-64 36.1446 37.0 37.0 37.0 37.0 37.0 65-69 35.9412 37.0 37.0 37.0 37.0 37.0 70-74 36.1188 37.0 37.0 37.0 37.0 37.0 75-79 36.2566 37.0 37.0 37.0 37.0 37.0 80-84 36.2606 37.0 37.0 37.0 37.0 37.0 85-89 36.192 37.0 37.0 37.0 37.0 37.0 90-94 36.208299999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.1631 37.0 37.0 37.0 37.0 37.0 100-104 36.084999999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.0603 37.0 37.0 37.0 37.0 37.0 110-114 36.0305 37.0 37.0 37.0 37.0 37.0 115-119 36.0154 37.0 37.0 37.0 37.0 37.0 120-124 36.0077 37.0 37.0 37.0 37.0 37.0 125-129 35.8853 37.0 37.0 37.0 37.0 37.0 130-134 35.8562 37.0 37.0 37.0 37.0 37.0 135-139 35.7538 37.0 37.0 37.0 37.0 37.0 140-144 35.656699999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.555899999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.33325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 2.0 22 3.0 23 6.0 24 3.0 25 8.0 26 5.0 27 8.0 28 7.0 29 22.0 30 29.0 31 39.0 32 45.0 33 71.0 34 122.0 35 318.0 36 2980.0 37 329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.81220305076269 13.103275818954737 7.301825456364091 30.782695673918482 2 21.3 13.825000000000001 35.075 29.799999999999997 3 16.35 18.625 32.225 32.800000000000004 4 21.025 22.15 26.35 30.475 5 23.150000000000002 30.025000000000002 24.099999999999998 22.725 6 21.325 33.825 23.200000000000003 21.65 7 15.299999999999999 31.35 39.425 13.925 8 15.55 29.5 32.550000000000004 22.400000000000002 9 18.3 23.925 35.15 22.625 10-14 19.255 31.319999999999997 27.950000000000003 21.475 15-19 20.24 29.265 26.815 23.68 20-24 19.74 29.74 27.605 22.915 25-29 20.775 29.24 26.779999999999998 23.205000000000002 30-34 20.3 29.360000000000003 26.955000000000002 23.385 35-39 20.085 29.645 26.915 23.355 40-44 19.89 29.82 26.955000000000002 23.335 45-49 20.015 28.970000000000002 27.395000000000003 23.62 50-54 20.74 28.999999999999996 26.775 23.485 55-59 19.62 28.955 27.325 24.099999999999998 60-64 20.175 28.535 27.345000000000002 23.945 65-69 20.435 30.0 25.674999999999997 23.89 70-74 22.48 28.335 25.645 23.54 75-79 21.490000000000002 28.615000000000002 26.875 23.02 80-84 22.435 28.005000000000003 26.205000000000002 23.355 85-89 22.215 27.675 26.625 23.485 90-94 22.285 28.03 25.735000000000003 23.95 95-99 21.78 28.294999999999998 26.009999999999998 23.915 100-104 21.865000000000002 28.139999999999997 26.279999999999998 23.715 105-109 23.07 28.24 25.56 23.13 110-114 22.505 28.199999999999996 25.840000000000003 23.455000000000002 115-119 22.68 27.66 25.64 24.02 120-124 22.53 27.634999999999998 25.650000000000002 24.185000000000002 125-129 22.295 27.384999999999998 26.314999999999998 24.005000000000003 130-134 22.78 27.200000000000003 26.090000000000003 23.93 135-139 23.455000000000002 26.695 25.19 24.66 140-144 23.23 27.275 25.96 23.535 145-149 23.47 26.765 25.650000000000002 24.115000000000002 150-151 24.0375 26.375 25.900000000000002 23.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 2.5 6 2.0 7 0.0 8 0.0 9 2.0 10 2.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 2.0 19 3.5 20 3.0 21 2.0 22 2.5 23 3.0 24 3.5 25 7.5 26 10.5 27 10.5 28 16.0 29 22.0 30 26.0 31 35.0 32 44.0 33 54.0 34 67.5 35 82.5 36 105.0 37 113.5 38 122.5 39 150.0 40 169.0 41 168.5 42 191.5 43 220.5 44 225.5 45 223.5 46 196.0 47 200.0 48 223.0 49 209.0 50 187.0 51 163.5 52 131.0 53 102.5 54 85.5 55 71.5 56 69.0 57 56.5 58 36.5 59 33.0 60 21.5 61 12.0 62 10.0 63 6.0 64 6.0 65 32.0 66 33.0 67 6.5 68 2.5 69 1.0 70 0.5 71 0.0 72 1.0 73 2.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.775 #Duplication Level Percentage of deduplicated Percentage of total 1 90.70684314277668 80.525 2 7.941424950718108 14.099999999999998 3 1.098282174035483 2.9250000000000003 4 0.14080540692762603 0.5 5 0.056322162771050406 0.25 6 0.0 0.0 7 0.0 0.0 8 0.028161081385525203 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.028161081385525203 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCATGTATCTCGTAT 60 1.5 TruSeq Adapter, Index 4 (97% over 37bp) GTTGCAGTTGCTCCCTCGGATCCCCATCTTCTTCATCTATAGATTTCAAT 8 0.2 No Hit GTTGTCGAATCCGATTATACGGATAAAGGCGTTAGGGTAAGCTTTCTTTG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCATGTATCGCGTAT 5 0.125 TruSeq Adapter, Index 4 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7124999999999999 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.075 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 2.9875 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.300000000000001 0.0 0.0 0.0 0.0 112-113 4.675 0.0 0.0 0.0 0.0 114-115 5.112500000000001 0.0 0.0 0.0 0.0 116-117 5.4 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.4875 0.0 0.0 0.0 0.0 122-123 7.1125 0.0 0.0 0.0 0.0 124-125 7.6 0.0 0.0 0.0 0.0 126-127 8.25 0.0 0.0 0.0 0.0 128-129 8.9875 0.0 0.0 0.0 0.0 130-131 9.7625 0.0 0.0 0.0 0.0 132-133 10.4875 0.0 0.0 0.0 0.0 134-135 11.2 0.0 0.0 0.0 0.0 136-137 12.0 0.0 0.0 0.0 0.0 138-139 12.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917519 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917519_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.352 37.0 37.0 37.0 37.0 37.0 2 36.298 37.0 37.0 37.0 37.0 37.0 3 36.31 37.0 37.0 37.0 37.0 37.0 4 36.3635 37.0 37.0 37.0 37.0 37.0 5 36.427 37.0 37.0 37.0 37.0 37.0 6 36.3085 37.0 37.0 37.0 37.0 37.0 7 36.316 37.0 37.0 37.0 37.0 37.0 8 36.4055 37.0 37.0 37.0 37.0 37.0 9 36.334 37.0 37.0 37.0 37.0 37.0 10-14 36.33669999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.25789999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.22109999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0327 37.0 37.0 37.0 37.0 37.0 30-34 35.9131 37.0 37.0 37.0 37.0 37.0 35-39 35.9052 37.0 37.0 37.0 37.0 37.0 40-44 35.8996 37.0 37.0 37.0 37.0 37.0 45-49 35.802 37.0 37.0 37.0 37.0 37.0 50-54 35.7607 37.0 37.0 37.0 37.0 37.0 55-59 35.8193 37.0 37.0 37.0 37.0 37.0 60-64 35.8894 37.0 37.0 37.0 37.0 37.0 65-69 35.8337 37.0 37.0 37.0 37.0 37.0 70-74 35.7202 37.0 37.0 37.0 37.0 37.0 75-79 35.6351 37.0 37.0 37.0 37.0 37.0 80-84 35.7178 37.0 37.0 37.0 37.0 37.0 85-89 35.8138 37.0 37.0 37.0 37.0 37.0 90-94 35.7973 37.0 37.0 37.0 37.0 37.0 95-99 35.7293 37.0 37.0 37.0 37.0 37.0 100-104 35.7882 37.0 37.0 37.0 37.0 37.0 105-109 35.754000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.686299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.587300000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.4299 37.0 37.0 37.0 37.0 37.0 125-129 35.4113 37.0 37.0 37.0 37.0 37.0 130-134 35.255399999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.1981 37.0 37.0 37.0 32.2 37.0 140-144 34.896 37.0 37.0 37.0 25.0 37.0 145-149 34.697900000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.18625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 8.0 15 9.0 16 8.0 17 3.0 18 5.0 19 2.0 20 2.0 21 2.0 22 5.0 23 7.0 24 4.0 25 1.0 26 12.0 27 7.0 28 17.0 29 17.0 30 28.0 31 31.0 32 74.0 33 116.0 34 210.0 35 527.0 36 2722.0 37 180.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.325 26.275 7.2749999999999995 20.125 2 33.800000000000004 22.85 27.025 16.325 3 24.05 25.35 32.475 18.125 4 26.924999999999997 32.625 21.6 18.85 5 28.675 36.95 18.525 15.85 6 24.45 38.4 19.2 17.95 7 24.525 23.075000000000003 33.650000000000006 18.75 8 22.45 24.8 26.700000000000003 26.05 9 25.35 23.549999999999997 27.875 23.225 10-14 26.83 28.08 24.685000000000002 20.405 15-19 26.384999999999998 27.245 25.264999999999997 21.105 20-24 26.615 27.445000000000004 25.380000000000003 20.560000000000002 25-29 25.66 26.875 26.5 20.965 30-34 25.979999999999997 27.075 26.465 20.48 35-39 26.06 26.924999999999997 26.255 20.76 40-44 25.785000000000004 26.484999999999996 27.075 20.655 45-49 26.13 26.290000000000003 26.245 21.335 50-54 26.115 26.625 26.290000000000003 20.97 55-59 25.905 27.245 26.05 20.8 60-64 26.424999999999997 25.615 27.36 20.599999999999998 65-69 26.505000000000003 26.26 26.405 20.830000000000002 70-74 25.924999999999997 27.305 25.94 20.830000000000002 75-79 25.285000000000004 27.1 26.51 21.105 80-84 25.535000000000004 26.625 26.445 21.395 85-89 26.419999999999998 27.150000000000002 25.865 20.565 90-94 25.929999999999996 27.145000000000003 26.1 20.825 95-99 25.735000000000003 26.224999999999998 27.055 20.985 100-104 25.645 27.405 26.575 20.375 105-109 26.255 27.075 26.645000000000003 20.025000000000002 110-114 25.885 26.91 27.48 19.725 115-119 26.08 27.36 26.56 20.0 120-124 27.38 26.615 26.625 19.38 125-129 27.595 26.68 26.325 19.400000000000002 130-134 27.77 26.52 26.47 19.24 135-139 27.935 27.245 25.919999999999998 18.9 140-144 29.13 26.36 26.08 18.43 145-149 29.830000000000002 26.314999999999998 25.619999999999997 18.235 150-151 29.7875 26.575 25.387500000000003 18.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 0.5 24 2.5 25 3.5 26 3.0 27 2.5 28 2.0 29 3.5 30 5.5 31 12.5 32 18.5 33 22.5 34 30.5 35 42.5 36 57.0 37 85.5 38 109.5 39 114.5 40 144.0 41 187.0 42 210.5 43 228.5 44 256.0 45 258.0 46 250.0 47 247.5 48 246.0 49 229.5 50 197.5 51 169.5 52 150.5 53 137.0 54 103.5 55 84.5 56 71.0 57 47.5 58 34.0 59 27.5 60 19.0 61 16.0 62 16.0 63 10.5 64 5.0 65 2.0 66 2.5 67 2.5 68 2.0 69 3.0 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 3.5 85 3.0 86 1.0 87 2.0 88 2.0 89 2.5 90 3.5 91 3.0 92 2.0 93 0.5 94 1.0 95 2.5 96 2.0 97 3.0 98 6.5 99 11.5 100 32.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24475524475525 81.55 2 7.58041958041958 13.55 3 0.9790209790209791 2.625 4 0.13986013986013987 0.5 5 0.027972027972027972 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.027972027972027972 1.6500000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 66 1.6500000000000001 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.075 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 2.9875 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.300000000000001 0.0 0.0 0.0 0.0 112-113 4.675 0.0 0.0 0.0 0.0 114-115 5.1 0.0 0.0 0.0 0.0 116-117 5.375 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.5 0.0 0.0 0.0 0.0 122-123 7.1375 0.0 0.0 0.0 0.0 124-125 7.625 0.0 0.0 0.0 0.0 126-127 8.275 0.0 0.0 0.0 0.0 128-129 9.025 0.0 0.0 0.0 0.0 130-131 9.8375 0.0 0.0 0.0 0.0 132-133 10.5625 0.0 0.0 0.0 0.0 134-135 11.275 0.0 0.0 0.0 0.0 136-137 12.0625 0.0 0.0 0.0 0.0 138-139 12.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505046 spots for SRR12917519.sra Written 505046 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra Read 505030 spots for SRR12917519.sra Written 505030 spots for SRR12917519.sra SRR ids: ['SRR12917519.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1sjhlqs SRR12917519.sra spots: 10100616 blocks: [[1, 505030], [505031, 1010060], [1010061, 1515090], [1515091, 2020120], [2020121, 2525150], [2525151, 3030180], [3030181, 3535210], [3535211, 4040240], [4040241, 4545270], [4545271, 5050300], [5050301, 5555330], [5555331, 6060360], [6060361, 6565390], [6565391, 7070420], [7070421, 7575450], [7575451, 8080480], [8080481, 8585510], [8585511, 9090540], [9090541, 9595570], [9595571, 10100616]] SRR12917519 file size 3410930 SRR12917519 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917519 SRR12917519_1.fastq SRR12917519_2.fastq Input file: SRR12917519_1.fastq Paired file: SRR12917519_2.fastq trimmed: SRR12917519-trimmed-pair1.fastq, SRR12917519-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:38:40 2025 >> started Thu Feb 13 11:38:51 2025 >> done (10.808s) 10100616 read pairs processed; of these: 59 ( 0.00%) short read pairs filtered out after trimming by size control 159778 ( 1.58%) empty read pairs filtered out after trimming by size control 9940779 (98.42%) read pairs available; of these: 1707593 (17.18%) trimmed read pairs available after processing 8233186 (82.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 10 0.00% 21 19 0.00% 22 18 0.00% 23 24 0.00% 24 27 0.00% 25 33 0.00% 26 32 0.00% 27 34 0.00% 28 33 0.00% 29 29 0.00% 30 38 0.00% 31 36 0.00% 32 31 0.00% 33 28 0.00% 34 33 0.00% 35 32 0.00% 36 49 0.00% 37 36 0.00% 38 54 0.00% 39 40 0.00% 40 62 0.00% 41 50 0.00% 42 58 0.00% 43 51 0.00% 44 48 0.00% 45 64 0.00% 46 75 0.00% 47 86 0.00% 48 91 0.00% 49 119 0.00% 50 114 0.00% 51 118 0.00% 52 147 0.00% 53 140 0.00% 54 172 0.00% 55 207 0.00% 56 194 0.00% 57 243 0.00% 58 282 0.00% 59 338 0.00% 60 354 0.00% 61 441 0.00% 62 500 0.01% 63 593 0.01% 64 633 0.01% 65 700 0.01% 66 716 0.01% 67 865 0.01% 68 912 0.01% 69 1080 0.01% 70 1238 0.01% 71 1443 0.01% 72 1602 0.02% 73 1918 0.02% 74 2133 0.02% 75 2194 0.02% 76 2606 0.03% 77 2616 0.03% 78 2913 0.03% 79 3315 0.03% 80 3765 0.04% 81 3999 0.04% 82 4763 0.05% 83 4841 0.05% 84 5734 0.06% 85 6148 0.06% 86 6699 0.07% 87 6773 0.07% 88 7188 0.07% 89 7543 0.08% 90 8039 0.08% 91 8434 0.08% 92 9333 0.09% 93 10112 0.10% 94 10769 0.11% 95 11291 0.11% 96 12206 0.12% 97 12343 0.12% 98 12891 0.13% 99 13461 0.14% 100 13730 0.14% 101 14162 0.14% 102 14773 0.15% 103 15929 0.16% 104 16607 0.17% 105 17177 0.17% 106 17967 0.18% 107 18590 0.19% 108 18830 0.19% 109 19324 0.19% 110 20053 0.20% 111 20022 0.20% 112 20995 0.21% 113 20995 0.21% 114 22477 0.23% 115 23374 0.24% 116 24365 0.25% 117 25478 0.26% 118 25739 0.26% 119 25783 0.26% 120 27190 0.27% 121 27180 0.27% 122 27752 0.28% 123 28197 0.28% 124 29553 0.30% 125 29587 0.30% 126 31120 0.31% 127 31321 0.32% 128 32459 0.33% 129 33557 0.34% 130 33127 0.33% 131 33317 0.34% 132 33498 0.34% 133 34277 0.34% 134 35661 0.36% 135 36051 0.36% 136 37165 0.37% 137 37432 0.38% 138 38162 0.38% 139 39026 0.39% 140 38584 0.39% 141 39500 0.40% 142 39386 0.40% 143 40127 0.40% 144 41129 0.41% 145 41995 0.42% 146 41741 0.42% 147 42098 0.42% 148 43646 0.44% 149 43927 0.44% 150 45049 0.45% 151 8233186 82.82% 9940779 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=38 prefix-density=0.89 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=53.67 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=26 prefix-density=0.77 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.10 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12917519 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:39:29 Started mapping on | Feb 13 11:39:29 Finished on | Feb 13 11:40:31 Mapping speed, Million of reads per hour | 577.21 Number of input reads | 9940779 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 9327349 Uniquely mapped reads % | 93.83% Average mapped length | 291.50 Number of splices: Total | 8027784 Number of splices: Annotated (sjdb) | 7891701 Number of splices: GT/AG | 7813787 Number of splices: GC/AG | 177871 Number of splices: AT/AC | 4293 Number of splices: Non-canonical | 31833 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217883 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 90532 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395547 395547 395547 N_multimapping 217883 217883 217883 N_noFeature 196539 9111036 254161 N_ambiguous 239348 655 80381 UnstrandedReadsAssigned:8891462 PositiveStrandReadsAssigned:215658 NegativeStrandReadsAssigned:8992807 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917519 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917519-trimmed-pair1.fastq SRR12917519-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,940,779 reads, 9,100,723 reads pseudoaligned [quant] estimated average fragment length: 222.859 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12917519.ke.tsv 34699 SRR12917519.se.tsv 87100 total ==> SRR12917519.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.14 125 5.36294 Potri.005G024800.1.v4.1 1035 813.141 263 24.9243 Potri.004G059700.1.v4.1 961 739.181 17 1.77228 Potri.007G009000.2.v4.1 1416 1194.14 0 0 Potri.003G141000.2.v4.1 2943 2721.14 335 9.48695 Potri.016G087400.1.v4.1 270 93.3396 508 419.402 Potri.015G069301.1.v4.1 564 347.879 0 0 Potri.010G195200.1.v4.1 1773 1551.14 3 0.14904 Potri.012G127500.1.v4.1 977 755.156 105 10.7148 ==> SRR12917519.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 143 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR12917519 completed mapping pipeline successfully