Starting /dee2/code/volunteer_pipeline.sh SRR12917520 current disk space = 3092425007104 free memory = 1577321508 SRR12917520 SRAfilesize bfc8644adfdf5512479558543f1648a5 SRR12917520.sra SRR12917520.sra file validated SRR12917520 is paired end SRR12917520 is conventional basespace SRR12917520 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917520_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.51 37.0 37.0 37.0 37.0 37.0 2 36.3635 37.0 37.0 37.0 37.0 37.0 3 36.5625 37.0 37.0 37.0 37.0 37.0 4 36.5855 37.0 37.0 37.0 37.0 37.0 5 36.6025 37.0 37.0 37.0 37.0 37.0 6 36.594 37.0 37.0 37.0 37.0 37.0 7 36.525 37.0 37.0 37.0 37.0 37.0 8 36.574 37.0 37.0 37.0 37.0 37.0 9 36.597 37.0 37.0 37.0 37.0 37.0 10-14 36.6043 37.0 37.0 37.0 37.0 37.0 15-19 36.5244 37.0 37.0 37.0 37.0 37.0 20-24 36.5461 37.0 37.0 37.0 37.0 37.0 25-29 36.5166 37.0 37.0 37.0 37.0 37.0 30-34 36.4474 37.0 37.0 37.0 37.0 37.0 35-39 36.437200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4399 37.0 37.0 37.0 37.0 37.0 45-49 36.3795 37.0 37.0 37.0 37.0 37.0 50-54 36.3337 37.0 37.0 37.0 37.0 37.0 55-59 36.282 37.0 37.0 37.0 37.0 37.0 60-64 36.2581 37.0 37.0 37.0 37.0 37.0 65-69 36.1977 37.0 37.0 37.0 37.0 37.0 70-74 36.267 37.0 37.0 37.0 37.0 37.0 75-79 36.2836 37.0 37.0 37.0 37.0 37.0 80-84 36.215199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1693 37.0 37.0 37.0 37.0 37.0 90-94 36.1565 37.0 37.0 37.0 37.0 37.0 95-99 36.141 37.0 37.0 37.0 37.0 37.0 100-104 36.0816 37.0 37.0 37.0 37.0 37.0 105-109 35.9788 37.0 37.0 37.0 37.0 37.0 110-114 35.9724 37.0 37.0 37.0 37.0 37.0 115-119 35.8925 37.0 37.0 37.0 37.0 37.0 120-124 35.9394 37.0 37.0 37.0 37.0 37.0 125-129 35.771 37.0 37.0 37.0 37.0 37.0 130-134 35.7088 37.0 37.0 37.0 37.0 37.0 135-139 35.6543 37.0 37.0 37.0 37.0 37.0 140-144 35.5076 37.0 37.0 37.0 37.0 37.0 145-149 35.385799999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.067499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 1.0 24 3.0 25 6.0 26 2.0 27 7.0 28 13.0 29 16.0 30 32.0 31 32.0 32 54.0 33 99.0 34 156.0 35 363.0 36 2924.0 37 288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.625 12.65 5.525 34.2 2 18.325 9.9 39.825 31.95 3 15.675 14.899999999999999 30.049999999999997 39.375 4 20.575 22.15 25.85 31.424999999999997 5 22.675 29.475 25.174999999999997 22.675 6 21.349999999999998 31.974999999999998 23.875 22.8 7 15.675 26.775 41.85 15.7 8 16.05 26.974999999999998 32.925 24.05 9 16.900000000000002 22.55 35.55 25.0 10-14 19.305 29.465000000000003 28.425 22.805 15-19 19.64 28.13 27.755000000000003 24.474999999999998 20-24 19.425 28.525 28.53 23.52 25-29 19.7 28.465 28.389999999999997 23.445 30-34 19.225 29.044999999999998 27.694999999999997 24.035 35-39 19.39 28.994999999999997 28.09 23.525 40-44 19.259999999999998 28.549999999999997 28.235 23.955000000000002 45-49 20.4 28.22 27.48 23.9 50-54 19.400000000000002 27.92 28.725 23.955000000000002 55-59 19.470000000000002 28.349999999999998 28.17 24.01 60-64 19.775000000000002 27.595 28.65 23.98 65-69 19.61 29.020000000000003 28.215 23.155 70-74 20.349999999999998 28.32 27.46 23.87 75-79 19.689999999999998 29.095 27.51 23.705000000000002 80-84 19.535 28.68 27.889999999999997 23.895 85-89 19.939999999999998 28.410000000000004 27.715 23.935000000000002 90-94 19.905 28.615000000000002 27.52 23.96 95-99 19.96 28.305000000000003 27.67 24.065 100-104 19.744999999999997 28.655 27.73 23.87 105-109 20.24 28.475 28.09 23.195 110-114 20.23 28.744999999999997 27.355 23.669999999999998 115-119 20.599999999999998 28.95 26.735 23.715 120-124 19.935 29.360000000000003 26.650000000000002 24.055 125-129 20.055 28.63 27.6 23.715 130-134 19.825 28.565 27.24 24.37 135-139 20.25 28.255000000000003 27.450000000000003 24.044999999999998 140-144 20.775 27.3 27.295 24.63 145-149 20.474999999999998 27.91 27.215 24.4 150-151 20.625 28.0875 27.487499999999997 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 1.5 23 2.5 24 3.5 25 3.5 26 7.0 27 10.5 28 10.5 29 12.5 30 19.5 31 25.5 32 24.5 33 36.0 34 58.0 35 72.0 36 84.0 37 101.5 38 121.5 39 151.5 40 195.0 41 220.5 42 247.0 43 281.5 44 299.5 45 281.0 46 249.0 47 237.5 48 236.0 49 216.0 50 174.5 51 136.0 52 108.5 53 86.0 54 67.0 55 54.5 56 36.5 57 30.0 58 25.0 59 13.5 60 8.5 61 8.0 62 7.0 63 6.5 64 7.0 65 6.0 66 2.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 92.54742547425474 85.375 2 6.612466124661247 12.2 3 0.7588075880758808 2.1 4 0.05420054200542006 0.2 5 0.02710027100271003 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.25 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114-115 4.137499999999999 0.0 0.0 0.0 0.0 116-117 4.4875 0.0 0.0 0.0 0.0 118-119 4.925000000000001 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 5.85 0.0 0.0 0.0 0.0 124-125 6.2625 0.0 0.0 0.0 0.0 126-127 6.8625 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 7.7875 0.0 0.0 0.0 0.0 132-133 8.475 0.0 0.0 0.0 0.0 134-135 9.125 0.0 0.0 0.0 0.0 136-137 9.75 0.0 0.0 0.0 0.0 138-139 10.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACATT 10 0.006830828 145.0 1 >>END_MODULE SRR12917520 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917520_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29475 37.0 37.0 37.0 37.0 37.0 2 36.2375 37.0 37.0 37.0 37.0 37.0 3 36.2245 37.0 37.0 37.0 37.0 37.0 4 36.3685 37.0 37.0 37.0 37.0 37.0 5 36.301 37.0 37.0 37.0 37.0 37.0 6 36.192 37.0 37.0 37.0 37.0 37.0 7 36.3395 37.0 37.0 37.0 37.0 37.0 8 36.4265 37.0 37.0 37.0 37.0 37.0 9 36.3445 37.0 37.0 37.0 37.0 37.0 10-14 36.328700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.300399999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2324 37.0 37.0 37.0 37.0 37.0 25-29 36.1167 37.0 37.0 37.0 37.0 37.0 30-34 36.077 37.0 37.0 37.0 37.0 37.0 35-39 36.012899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.021 37.0 37.0 37.0 37.0 37.0 45-49 35.9265 37.0 37.0 37.0 37.0 37.0 50-54 35.8976 37.0 37.0 37.0 37.0 37.0 55-59 35.9448 37.0 37.0 37.0 37.0 37.0 60-64 35.916399999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.8687 37.0 37.0 37.0 37.0 37.0 70-74 35.861399999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7017 37.0 37.0 37.0 37.0 37.0 80-84 35.796299999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.8241 37.0 37.0 37.0 37.0 37.0 90-94 35.79 37.0 37.0 37.0 37.0 37.0 95-99 35.7628 37.0 37.0 37.0 37.0 37.0 100-104 35.706999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.6312 37.0 37.0 37.0 37.0 37.0 110-114 35.595800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.611900000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.3987 37.0 37.0 37.0 37.0 37.0 125-129 35.3275 37.0 37.0 37.0 37.0 37.0 130-134 35.2719 37.0 37.0 37.0 32.2 37.0 135-139 35.2535 37.0 37.0 37.0 32.2 37.0 140-144 35.0792 37.0 37.0 37.0 27.4 37.0 145-149 34.91460000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.4855 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 3.0 16 3.0 17 2.0 18 2.0 19 0.0 20 2.0 21 3.0 22 4.0 23 6.0 24 2.0 25 8.0 26 14.0 27 11.0 28 15.0 29 19.0 30 30.0 31 51.0 32 84.0 33 113.0 34 229.0 35 574.0 36 2634.0 37 188.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.935983995999 25.331332833208304 9.7024256064016 21.030257564391096 2 27.55 24.675 32.35 15.425 3 18.8 28.249999999999996 34.725 18.224999999999998 4 23.849999999999998 33.650000000000006 24.175 18.325 5 26.224999999999998 36.449999999999996 21.65 15.675 6 21.099999999999998 39.550000000000004 22.725 16.625 7 21.075 22.75 38.625 17.549999999999997 8 20.349999999999998 24.325 30.625000000000004 24.7 9 22.85 23.599999999999998 30.625000000000004 22.925 10-14 23.715 29.395 26.47 20.419999999999998 15-19 23.195 28.575 27.905 20.325 20-24 23.62 28.49 28.175 19.715 25-29 24.060000000000002 28.49 27.495000000000005 19.955000000000002 30-34 23.515 28.275 27.925 20.285 35-39 24.01 27.87 27.894999999999996 20.225 40-44 23.535 28.355000000000004 28.199999999999996 19.91 45-49 23.66 27.605 28.285 20.45 50-54 23.365 28.275 28.065 20.294999999999998 55-59 24.085 27.575 28.435 19.905 60-64 23.62 28.23 27.779999999999998 20.369999999999997 65-69 23.565 28.475 27.800000000000004 20.16 70-74 24.09 28.035 27.400000000000002 20.474999999999998 75-79 23.86 28.67 26.805 20.665 80-84 24.255 27.839999999999996 27.939999999999998 19.965 85-89 23.72 27.950000000000003 27.944999999999997 20.385 90-94 24.115000000000002 27.725 27.965 20.195 95-99 24.395 27.985 27.389999999999997 20.23 100-104 24.005000000000003 28.27 27.634999999999998 20.09 105-109 24.415 27.54 27.965 20.080000000000002 110-114 24.635 28.360000000000003 27.615000000000002 19.39 115-119 24.72 28.17 27.21 19.900000000000002 120-124 24.05 28.12 27.275 20.555 125-129 24.39 28.720000000000002 27.334999999999997 19.555 130-134 25.645 28.294999999999998 26.66 19.400000000000002 135-139 25.435000000000002 28.49 27.134999999999998 18.94 140-144 26.009999999999998 27.384999999999998 26.765 19.84 145-149 26.325 27.465 27.205000000000002 19.005 150-151 26.0125 27.3 28.537499999999998 18.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 4.0 22 3.5 23 2.5 24 4.0 25 5.0 26 5.5 27 8.0 28 13.0 29 14.0 30 15.0 31 19.0 32 26.5 33 36.0 34 48.5 35 78.0 36 94.5 37 115.5 38 132.0 39 158.5 40 207.0 41 239.0 42 263.5 43 266.0 44 274.5 45 286.5 46 270.0 47 245.0 48 235.0 49 195.5 50 151.0 51 116.0 52 85.5 53 76.5 54 70.5 55 54.0 56 40.5 57 33.0 58 17.5 59 13.0 60 11.5 61 8.5 62 5.5 63 4.0 64 5.0 65 3.5 66 3.0 67 3.0 68 1.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.5 93 1.0 94 0.5 95 0.5 96 0.5 97 1.0 98 1.0 99 2.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.79718386135933 85.675 2 6.390468453831573 11.799999999999999 3 0.7040346601678852 1.95 4 0.08123476848090982 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027078256160303276 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.775 0.0 0.0 0.0 0.0 114-115 4.237500000000001 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 5.987500000000001 0.0 0.0 0.0 0.0 124-125 6.4125 0.0 0.0 0.0 0.0 126-127 7.0125 0.0 0.0 0.0 0.0 128-129 7.4375 0.0 0.0 0.0 0.0 130-131 7.975 0.0 0.0 0.0 0.0 132-133 8.65 0.0 0.0 0.0 0.0 134-135 9.3125 0.0 0.0 0.0 0.0 136-137 9.95 0.0 0.0 0.0 0.0 138-139 10.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGA 10 0.006830828 145.0 145 ATTGCTG 10 0.006830828 145.0 8 GTACCGT 20 0.00593511 29.0 140-144 AGAGTGT 20 0.00593511 29.0 130-134 >>END_MODULE Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427844 spots for SRR12917520.sra Written 427844 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra Read 427827 spots for SRR12917520.sra Written 427827 spots for SRR12917520.sra SRR ids: ['SRR12917520.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h431p91l SRR12917520.sra spots: 8556557 blocks: [[1, 427827], [427828, 855654], [855655, 1283481], [1283482, 1711308], [1711309, 2139135], [2139136, 2566962], [2566963, 2994789], [2994790, 3422616], [3422617, 3850443], [3850444, 4278270], [4278271, 4706097], [4706098, 5133924], [5133925, 5561751], [5561752, 5989578], [5989579, 6417405], [6417406, 6845232], [6845233, 7273059], [7273060, 7700886], [7700887, 8128713], [8128714, 8556557]] SRR12917520 file size 2889011 SRR12917520 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917520 SRR12917520_1.fastq SRR12917520_2.fastq Input file: SRR12917520_1.fastq Paired file: SRR12917520_2.fastq trimmed: SRR12917520-trimmed-pair1.fastq, SRR12917520-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:18:41 2025 >> started Thu Feb 13 12:18:50 2025 >> done (9.103s) 8556557 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 10419 ( 0.12%) empty read pairs filtered out after trimming by size control 8546034 (99.88%) read pairs available; of these: 1318833 (15.43%) trimmed read pairs available after processing 7227201 (84.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 4 0.00% 21 15 0.00% 22 11 0.00% 23 12 0.00% 24 8 0.00% 25 21 0.00% 26 27 0.00% 27 7 0.00% 28 22 0.00% 29 16 0.00% 30 18 0.00% 31 19 0.00% 32 18 0.00% 33 25 0.00% 34 22 0.00% 35 24 0.00% 36 18 0.00% 37 21 0.00% 38 25 0.00% 39 22 0.00% 40 17 0.00% 41 21 0.00% 42 27 0.00% 43 27 0.00% 44 37 0.00% 45 35 0.00% 46 43 0.00% 47 48 0.00% 48 45 0.00% 49 60 0.00% 50 86 0.00% 51 96 0.00% 52 95 0.00% 53 92 0.00% 54 99 0.00% 55 116 0.00% 56 156 0.00% 57 157 0.00% 58 171 0.00% 59 220 0.00% 60 265 0.00% 61 282 0.00% 62 362 0.00% 63 399 0.00% 64 457 0.01% 65 558 0.01% 66 587 0.01% 67 662 0.01% 68 731 0.01% 69 859 0.01% 70 967 0.01% 71 1216 0.01% 72 1355 0.02% 73 1620 0.02% 74 1652 0.02% 75 1965 0.02% 76 2156 0.03% 77 2287 0.03% 78 2473 0.03% 79 2695 0.03% 80 2960 0.03% 81 3263 0.04% 82 3777 0.04% 83 4070 0.05% 84 4516 0.05% 85 5075 0.06% 86 5401 0.06% 87 5712 0.07% 88 6212 0.07% 89 6178 0.07% 90 6698 0.08% 91 7130 0.08% 92 7758 0.09% 93 8146 0.10% 94 8814 0.10% 95 9467 0.11% 96 10109 0.12% 97 10269 0.12% 98 10819 0.13% 99 11174 0.13% 100 11421 0.13% 101 11919 0.14% 102 12259 0.14% 103 13125 0.15% 104 13766 0.16% 105 14612 0.17% 106 14821 0.17% 107 15453 0.18% 108 15892 0.19% 109 16163 0.19% 110 16158 0.19% 111 17015 0.20% 112 17165 0.20% 113 17553 0.21% 114 18174 0.21% 115 18876 0.22% 116 19590 0.23% 117 20017 0.23% 118 20714 0.24% 119 20906 0.24% 120 21131 0.25% 121 21451 0.25% 122 21359 0.25% 123 22532 0.26% 124 22465 0.26% 125 23449 0.27% 126 23925 0.28% 127 24550 0.29% 128 24665 0.29% 129 25237 0.30% 130 25543 0.30% 131 25741 0.30% 132 25990 0.30% 133 25947 0.30% 134 26722 0.31% 135 27004 0.32% 136 27633 0.32% 137 27896 0.33% 138 28390 0.33% 139 28192 0.33% 140 28402 0.33% 141 28877 0.34% 142 29160 0.34% 143 29712 0.35% 144 29921 0.35% 145 30428 0.36% 146 30052 0.35% 147 30388 0.36% 148 30923 0.36% 149 30927 0.36% 150 31499 0.37% 151 7227201 84.57% 8546034 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=8.58 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=4.4 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=458.63 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=35.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.7 sequence=TTAGCAGAAAATGAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=438.30 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.2 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTTATCTGCAATATGTCTCTTGTTGTTATGGTTCCACGGTTCTACCGTGCCTGGAA SRR12917520 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:19:38 Started mapping on | Feb 13 12:19:38 Finished on | Feb 13 12:20:46 Mapping speed, Million of reads per hour | 452.44 Number of input reads | 8546034 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 7915667 Uniquely mapped reads % | 92.62% Average mapped length | 292.12 Number of splices: Total | 7400395 Number of splices: Annotated (sjdb) | 7212555 Number of splices: GT/AG | 7262705 Number of splices: GC/AG | 106792 Number of splices: AT/AC | 8352 Number of splices: Non-canonical | 22546 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.19 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193880 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 23434 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.64% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436487 436487 436487 N_multimapping 193880 193880 193880 N_noFeature 333078 7826576 377448 N_ambiguous 91449 471 46482 UnstrandedReadsAssigned:7491140 PositiveStrandReadsAssigned:88620 NegativeStrandReadsAssigned:7491737 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917520 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917520-trimmed-pair1.fastq SRR12917520-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,546,034 reads, 7,539,377 reads pseudoaligned [quant] estimated average fragment length: 247.33 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12917520.ke.tsv 34699 SRR12917520.se.tsv 87100 total ==> SRR12917520.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.67 350 29.1089 Potri.005G024800.1.v4.1 1035 788.67 55 10.2756 Potri.004G059700.1.v4.1 961 714.811 36 7.42081 Potri.007G009000.2.v4.1 1416 1169.67 0 0 Potri.003G141000.2.v4.1 2943 2696.67 401 21.9107 Potri.016G087400.1.v4.1 270 95.146 615.526 953.226 Potri.015G069301.1.v4.1 564 333.68 0 0 Potri.010G195200.1.v4.1 1773 1526.67 27 2.60591 Potri.012G127500.1.v4.1 977 730.734 4684 944.492 ==> SRR12917520.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12917520 completed mapping pipeline successfully