Starting /dee2/code/volunteer_pipeline.sh SRR12917521 current disk space = 3092248408064 free memory = 1570144492 SRR12917521 SRAfilesize af890c46641f44632089017ff7a2d1e4 SRR12917521.sra SRR12917521.sra file validated SRR12917521 is paired end SRR12917521 is conventional basespace SRR12917521 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917521_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.628 37.0 37.0 37.0 37.0 37.0 2 36.4935 37.0 37.0 37.0 37.0 37.0 3 36.5925 37.0 37.0 37.0 37.0 37.0 4 36.708 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.6615 37.0 37.0 37.0 37.0 37.0 7 36.579 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.67 37.0 37.0 37.0 37.0 37.0 10-14 36.639 37.0 37.0 37.0 37.0 37.0 15-19 36.627199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6024 37.0 37.0 37.0 37.0 37.0 25-29 36.5456 37.0 37.0 37.0 37.0 37.0 30-34 36.5092 37.0 37.0 37.0 37.0 37.0 35-39 36.5046 37.0 37.0 37.0 37.0 37.0 40-44 36.4897 37.0 37.0 37.0 37.0 37.0 45-49 36.44539999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.45360000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4246 37.0 37.0 37.0 37.0 37.0 60-64 36.3575 37.0 37.0 37.0 37.0 37.0 65-69 36.31 37.0 37.0 37.0 37.0 37.0 70-74 36.3745 37.0 37.0 37.0 37.0 37.0 75-79 36.3285 37.0 37.0 37.0 37.0 37.0 80-84 36.3223 37.0 37.0 37.0 37.0 37.0 85-89 36.304700000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.313599999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2067 37.0 37.0 37.0 37.0 37.0 100-104 36.1719 37.0 37.0 37.0 37.0 37.0 105-109 36.1058 37.0 37.0 37.0 37.0 37.0 110-114 36.0937 37.0 37.0 37.0 37.0 37.0 115-119 36.0312 37.0 37.0 37.0 37.0 37.0 120-124 36.02720000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9121 37.0 37.0 37.0 37.0 37.0 130-134 35.89450000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7809 37.0 37.0 37.0 37.0 37.0 140-144 35.6373 37.0 37.0 37.0 37.0 37.0 145-149 35.5609 37.0 37.0 37.0 37.0 37.0 150-151 35.31625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 1.0 25 3.0 26 5.0 27 9.0 28 7.0 29 17.0 30 21.0 31 26.0 32 30.0 33 72.0 34 122.0 35 328.0 36 3040.0 37 312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.82391195597799 13.406703351675839 4.277138569284642 34.492246123061534 2 19.25 10.75 39.375 30.625000000000004 3 15.975 17.65 28.425 37.95 4 20.424999999999997 23.474999999999998 26.400000000000002 29.7 5 23.325000000000003 30.099999999999998 25.95 20.625 6 20.25 33.375 23.225 23.150000000000002 7 14.899999999999999 30.349999999999998 39.300000000000004 15.45 8 15.65 25.674999999999997 35.55 23.125 9 15.9 23.525 36.375 24.2 10-14 19.71 30.214999999999996 27.560000000000002 22.515 15-19 19.645000000000003 28.68 27.48 24.195 20-24 18.915000000000003 29.54 28.555000000000003 22.99 25-29 19.27 28.1 27.74 24.89 30-34 19.115 29.604999999999997 27.584999999999997 23.695 35-39 19.23 29.14 27.61 24.02 40-44 19.564999999999998 29.044999999999998 27.79 23.599999999999998 45-49 20.055 28.73 27.305 23.91 50-54 19.994999999999997 28.560000000000002 27.6 23.845 55-59 19.259999999999998 29.475 27.68 23.585 60-64 19.955000000000002 29.12 27.07 23.855 65-69 19.785 28.155 28.04 24.02 70-74 19.835 28.32 28.305000000000003 23.54 75-79 20.244999999999997 28.76 27.339999999999996 23.655 80-84 20.18 28.93 27.425 23.465 85-89 20.275000000000002 28.73 27.655 23.34 90-94 19.445 29.32 27.139999999999997 24.095 95-99 20.19 28.785 27.560000000000002 23.465 100-104 20.105 28.51 26.974999999999998 24.41 105-109 20.03 28.985 27.655 23.330000000000002 110-114 20.325 28.939999999999998 26.8 23.935000000000002 115-119 20.13 29.215000000000003 27.435 23.22 120-124 20.355 28.93 26.645000000000003 24.07 125-129 20.255000000000003 28.405 27.1 24.240000000000002 130-134 20.69 28.675 26.765 23.87 135-139 20.685000000000002 28.27 27.32 23.724999999999998 140-144 20.19 27.894999999999996 26.86 25.055 145-149 20.77 27.839999999999996 26.615 24.775 150-151 20.549999999999997 27.975 26.787499999999998 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 0.0 22 1.0 23 3.0 24 3.0 25 3.0 26 6.0 27 7.5 28 9.0 29 17.0 30 23.0 31 27.5 32 40.0 33 53.5 34 66.5 35 80.5 36 88.0 37 97.0 38 125.0 39 159.0 40 188.5 41 207.5 42 235.5 43 258.0 44 274.0 45 287.5 46 274.0 47 245.0 48 226.0 49 207.5 50 169.0 51 144.0 52 118.0 53 91.0 54 73.0 55 51.0 56 32.5 57 21.5 58 21.5 59 18.5 60 10.5 61 8.5 62 5.5 63 3.5 64 3.0 65 1.0 66 1.0 67 2.0 68 1.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1360544217687 84.65 2 7.0476190476190474 12.950000000000001 3 0.7074829931972789 1.95 4 0.0816326530612245 0.3 5 0.0 0.0 6 0.027210884353741496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATAGTAAATGAAAATATGATCATTGGGGCCACTATCAACGACTTTTCCAC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2125 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7125 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 90-91 1.4625 0.0 0.0 0.0 0.0 92-93 1.7375 0.0 0.0 0.0 0.0 94-95 2.025 0.0 0.0 0.0 0.0 96-97 2.4375 0.0 0.0 0.0 0.0 98-99 2.8375 0.0 0.0 0.0 0.0 100-101 3.275 0.0 0.0 0.0 0.0 102-103 3.525 0.0 0.0 0.0 0.0 104-105 3.725 0.0 0.0 0.0 0.0 106-107 4.0625 0.0 0.0 0.0 0.0 108-109 4.4375 0.0 0.0 0.0 0.0 110-111 4.9375 0.0 0.0 0.0 0.0 112-113 5.387499999999999 0.0 0.0 0.0 0.0 114-115 5.675000000000001 0.0 0.0 0.0 0.0 116-117 6.2 0.0 0.0 0.0 0.0 118-119 6.8625 0.0 0.0 0.0 0.0 120-121 7.35 0.0 0.0 0.0 0.0 122-123 8.0375 0.0 0.0 0.0 0.0 124-125 8.524999999999999 0.0 0.0 0.0 0.0 126-127 9.1875 0.0 0.0 0.0 0.0 128-129 9.975 0.0 0.0 0.0 0.0 130-131 10.6875 0.0 0.0 0.0 0.0 132-133 11.4 0.0 0.0 0.0 0.0 134-135 12.2 0.0 0.0 0.0 0.0 136-137 12.875 0.0 0.0 0.0 0.0 138-139 13.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 70 3.8434082E-5 16.571428 65-69 >>END_MODULE SRR12917521 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917521_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33525 37.0 37.0 37.0 37.0 37.0 2 36.2365 37.0 37.0 37.0 37.0 37.0 3 36.147 37.0 37.0 37.0 37.0 37.0 4 36.2955 37.0 37.0 37.0 37.0 37.0 5 36.396 37.0 37.0 37.0 37.0 37.0 6 36.163 37.0 37.0 37.0 37.0 37.0 7 36.3035 37.0 37.0 37.0 37.0 37.0 8 36.4335 37.0 37.0 37.0 37.0 37.0 9 36.3595 37.0 37.0 37.0 37.0 37.0 10-14 36.3389 37.0 37.0 37.0 37.0 37.0 15-19 36.352199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.279700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1894 37.0 37.0 37.0 37.0 37.0 30-34 36.12179999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.0667 37.0 37.0 37.0 37.0 37.0 40-44 36.0801 37.0 37.0 37.0 37.0 37.0 45-49 36.001 37.0 37.0 37.0 37.0 37.0 50-54 36.027100000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.988800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.969 37.0 37.0 37.0 37.0 37.0 65-69 35.9053 37.0 37.0 37.0 37.0 37.0 70-74 35.9393 37.0 37.0 37.0 37.0 37.0 75-79 35.8458 37.0 37.0 37.0 37.0 37.0 80-84 35.8665 37.0 37.0 37.0 37.0 37.0 85-89 35.881 37.0 37.0 37.0 37.0 37.0 90-94 35.8934 37.0 37.0 37.0 37.0 37.0 95-99 35.8178 37.0 37.0 37.0 37.0 37.0 100-104 35.8098 37.0 37.0 37.0 37.0 37.0 105-109 35.7031 37.0 37.0 37.0 37.0 37.0 110-114 35.6652 37.0 37.0 37.0 37.0 37.0 115-119 35.545399999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.4835 37.0 37.0 37.0 34.6 37.0 125-129 35.3053 37.0 37.0 37.0 32.2 37.0 130-134 35.21 37.0 37.0 37.0 29.8 37.0 135-139 35.1113 37.0 37.0 37.0 25.0 37.0 140-144 34.814099999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.6654 37.0 37.0 37.0 25.0 37.0 150-151 34.23025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 3.0 16 3.0 17 3.0 18 1.0 19 4.0 20 0.0 21 2.0 22 4.0 23 4.0 24 3.0 25 6.0 26 9.0 27 8.0 28 7.0 29 16.0 30 28.0 31 39.0 32 59.0 33 137.0 34 244.0 35 667.0 36 2579.0 37 168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.685671417854465 28.132033008252062 6.176544136034009 23.005751437859466 2 27.700000000000003 24.425 33.0 14.875 3 19.825 27.900000000000002 35.099999999999994 17.175 4 23.075000000000003 33.074999999999996 25.974999999999998 17.875 5 26.625 37.425000000000004 20.075000000000003 15.875 6 20.349999999999998 41.325 21.05 17.275 7 20.599999999999998 23.525 37.275000000000006 18.6 8 20.150000000000002 25.775 30.599999999999998 23.474999999999998 9 21.224999999999998 23.674999999999997 30.675 24.425 10-14 23.674999999999997 29.099999999999998 26.865 20.36 15-19 23.925 27.744999999999997 28.139999999999997 20.19 20-24 23.815 29.18 27.155 19.85 25-29 23.49 28.294999999999998 27.915 20.3 30-34 23.599999999999998 28.439999999999998 27.794999999999998 20.165 35-39 23.830000000000002 28.08 27.865000000000002 20.225 40-44 23.96 27.295 28.444999999999997 20.3 45-49 23.82 28.075 27.575 20.53 50-54 23.07 28.355000000000004 28.52 20.055 55-59 23.07 27.705000000000002 28.565 20.66 60-64 23.935000000000002 28.084999999999997 27.755000000000003 20.225 65-69 23.985 28.22 28.12 19.675 70-74 24.555 27.61 27.584999999999997 20.25 75-79 23.805 27.765 28.1 20.330000000000002 80-84 23.74 27.58 28.02 20.66 85-89 24.19 28.689999999999998 27.07 20.05 90-94 23.669999999999998 28.32 27.755000000000003 20.255000000000003 95-99 24.57 28.235 27.450000000000003 19.744999999999997 100-104 24.82 27.965 27.315 19.900000000000002 105-109 24.73 28.549999999999997 27.534999999999997 19.185 110-114 24.44 28.415000000000003 27.665 19.48 115-119 25.019999999999996 27.339999999999996 27.939999999999998 19.7 120-124 24.695 28.449999999999996 27.675 19.18 125-129 25.41 28.18 26.91 19.5 130-134 26.085 27.71 26.779999999999998 19.425 135-139 25.865 28.015 27.57 18.55 140-144 27.37 27.139999999999997 26.674999999999997 18.815 145-149 27.925 26.955000000000002 26.72 18.4 150-151 28.499999999999996 26.325 27.224999999999998 17.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 2.5 25 2.5 26 6.5 27 9.5 28 9.0 29 13.5 30 18.0 31 28.5 32 39.5 33 40.0 34 47.0 35 69.5 36 83.5 37 114.5 38 144.5 39 167.0 40 197.0 41 222.5 42 263.0 43 274.5 44 275.5 45 292.5 46 274.5 47 237.0 48 212.5 49 192.5 50 175.0 51 137.0 52 97.5 53 74.5 54 66.0 55 55.0 56 32.0 57 25.5 58 18.5 59 11.0 60 10.5 61 7.5 62 5.5 63 4.5 64 4.0 65 4.0 66 1.5 67 0.5 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.5 81 1.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 1.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.5 93 0.5 94 1.0 95 0.5 96 1.0 97 1.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.47895737170785 85.15 2 6.787944610371979 12.5 3 0.6244909041542221 1.725 4 0.054303556882975834 0.2 5 0.0 0.0 6 0.027151778441487917 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027151778441487917 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CCAAGGCGTGGAGTCATCATTAACAGTCCTCAAGGAGAAGATGTTTATAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.325 0.0 0.0 0.0 0.0 90-91 1.5375 0.0 0.0 0.0 0.0 92-93 1.8125 0.0 0.0 0.0 0.0 94-95 2.1 0.0 0.0 0.0 0.0 96-97 2.4875 0.0 0.0 0.0 0.0 98-99 2.8625 0.0 0.0 0.0 0.0 100-101 3.3 0.0 0.0 0.0 0.0 102-103 3.55 0.0 0.0 0.0 0.0 104-105 3.75 0.0 0.0 0.0 0.0 106-107 4.1125 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 5.0625 0.0 0.0 0.0 0.0 112-113 5.512499999999999 0.0 0.0 0.0 0.0 114-115 5.800000000000001 0.0 0.0 0.0 0.0 116-117 6.325 0.0 0.0 0.0 0.0 118-119 6.9875 0.0 0.0 0.0 0.0 120-121 7.475 0.0 0.0 0.0 0.0 122-123 8.1875 0.0 0.0 0.0 0.0 124-125 8.7 0.0 0.0 0.0 0.0 126-127 9.3625 0.0 0.0 0.0 0.0 128-129 10.175 0.0 0.0 0.0 0.0 130-131 10.899999999999999 0.0 0.0 0.0 0.0 132-133 11.625 0.0 0.0 0.0 0.0 134-135 12.399999999999999 0.0 0.0 0.0 0.0 136-137 13.100000000000001 0.0 0.0 0.0 0.0 138-139 13.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCTC 10 0.006830828 145.0 5 GGGGGGG 80 1.4060788E-8 27.1875 145 >>END_MODULE Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579415 spots for SRR12917521.sra Written 579415 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra Read 579413 spots for SRR12917521.sra Written 579413 spots for SRR12917521.sra SRR ids: ['SRR12917521.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0_7t0f7d SRR12917521.sra spots: 11588262 blocks: [[1, 579413], [579414, 1158826], [1158827, 1738239], [1738240, 2317652], [2317653, 2897065], [2897066, 3476478], [3476479, 4055891], [4055892, 4635304], [4635305, 5214717], [5214718, 5794130], [5794131, 6373543], [6373544, 6952956], [6952957, 7532369], [7532370, 8111782], [8111783, 8691195], [8691196, 9270608], [9270609, 9850021], [9850022, 10429434], [10429435, 11008847], [11008848, 11588262]] SRR12917521 file size 3916498 SRR12917521 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917521 SRR12917521_1.fastq SRR12917521_2.fastq Input file: SRR12917521_1.fastq Paired file: SRR12917521_2.fastq trimmed: SRR12917521-trimmed-pair1.fastq, SRR12917521-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:24:41 2025 >> started Thu Feb 13 12:24:53 2025 >> done (11.988s) 11588262 read pairs processed; of these: 166 ( 0.00%) short read pairs filtered out after trimming by size control 1927 ( 0.02%) empty read pairs filtered out after trimming by size control 11586169 (99.98%) read pairs available; of these: 2139891 (18.47%) trimmed read pairs available after processing 9446278 (81.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 16 0.00% 20 18 0.00% 21 15 0.00% 22 17 0.00% 23 24 0.00% 24 32 0.00% 25 31 0.00% 26 39 0.00% 27 37 0.00% 28 44 0.00% 29 35 0.00% 30 34 0.00% 31 33 0.00% 32 57 0.00% 33 44 0.00% 34 51 0.00% 35 43 0.00% 36 50 0.00% 37 54 0.00% 38 57 0.00% 39 49 0.00% 40 65 0.00% 41 29 0.00% 42 64 0.00% 43 47 0.00% 44 84 0.00% 45 81 0.00% 46 80 0.00% 47 76 0.00% 48 98 0.00% 49 120 0.00% 50 145 0.00% 51 148 0.00% 52 207 0.00% 53 213 0.00% 54 205 0.00% 55 240 0.00% 56 244 0.00% 57 330 0.00% 58 392 0.00% 59 457 0.00% 60 534 0.00% 61 628 0.01% 62 705 0.01% 63 859 0.01% 64 985 0.01% 65 1120 0.01% 66 1199 0.01% 67 1352 0.01% 68 1448 0.01% 69 1713 0.01% 70 1993 0.02% 71 2246 0.02% 72 2551 0.02% 73 3018 0.03% 74 3311 0.03% 75 3580 0.03% 76 3983 0.03% 77 4358 0.04% 78 4724 0.04% 79 5179 0.04% 80 5702 0.05% 81 6308 0.05% 82 6924 0.06% 83 7735 0.07% 84 8637 0.07% 85 9390 0.08% 86 9951 0.09% 87 10538 0.09% 88 11038 0.10% 89 11636 0.10% 90 11782 0.10% 91 12931 0.11% 92 13663 0.12% 93 14675 0.13% 94 15500 0.13% 95 16956 0.15% 96 17352 0.15% 97 18433 0.16% 98 17941 0.15% 99 19338 0.17% 100 19501 0.17% 101 20324 0.18% 102 21238 0.18% 103 22278 0.19% 104 23542 0.20% 105 24509 0.21% 106 25455 0.22% 107 26090 0.23% 108 26773 0.23% 109 27055 0.23% 110 27147 0.23% 111 27757 0.24% 112 28338 0.24% 113 28924 0.25% 114 30213 0.26% 115 31173 0.27% 116 32307 0.28% 117 32933 0.28% 118 33735 0.29% 119 33673 0.29% 120 34597 0.30% 121 34886 0.30% 122 34772 0.30% 123 35311 0.30% 124 36845 0.32% 125 37269 0.32% 126 38201 0.33% 127 39154 0.34% 128 39795 0.34% 129 40355 0.35% 130 40172 0.35% 131 40321 0.35% 132 41364 0.36% 133 41215 0.36% 134 41828 0.36% 135 42449 0.37% 136 42935 0.37% 137 43931 0.38% 138 44403 0.38% 139 44377 0.38% 140 44803 0.39% 141 45059 0.39% 142 45225 0.39% 143 45282 0.39% 144 46603 0.40% 145 46234 0.40% 146 46034 0.40% 147 46301 0.40% 148 46701 0.40% 149 46572 0.40% 150 47897 0.41% 151 9446278 81.53% 11586169 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=34 prefix-density=0.44 prefix-fanout=2.2 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=306.29 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=32.4 sequence=TTCTTCTTCGGT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=2.2 sequence=AATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGCATACGGAGACTTCCTTAACGATAATTTTGATGCAAAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=80.13 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=14.7 sequence=AGAGAGAAAGAAACAACATGTCGTCGACGACAAAACCAAAGGCAGTGAAGCACACTCTATTCGTGAAGTTCAAAGATGACGTTACCAGAGAGCAAATTGAGAAAATCATAAACGACTTCACTCATCTGGTCAATCAAGTTGAACCCTTGAAGAGCTTACACTGGGGCACTAATCTGGGTATTCACGACCTCAATTTCGGATATACTCATGCTTTTGAAACTACCTTTGATGATCTGGAGGGCTTGCAGGAGTATCTTGATTCTTCGGTTGTTGCTAAATTCGCAGAAGGATTCTTGCCAAC SRR12917521 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:25:36 Started mapping on | Feb 13 12:25:36 Finished on | Feb 13 12:26:56 Mapping speed, Million of reads per hour | 521.38 Number of input reads | 11586169 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10844656 Uniquely mapped reads % | 93.60% Average mapped length | 290.16 Number of splices: Total | 9845755 Number of splices: Annotated (sjdb) | 9620366 Number of splices: GT/AG | 9660043 Number of splices: GC/AG | 143990 Number of splices: AT/AC | 9878 Number of splices: Non-canonical | 31844 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.03% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295181 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 49699 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446332 446332 446332 N_multimapping 295181 295181 295181 N_noFeature 420975 10693543 492642 N_ambiguous 138094 646 58378 UnstrandedReadsAssigned:10285587 PositiveStrandReadsAssigned:150467 NegativeStrandReadsAssigned:10293636 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917521 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917521-trimmed-pair1.fastq SRR12917521-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,586,169 reads, 10,347,826 reads pseudoaligned [quant] estimated average fragment length: 233.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12917521.ke.tsv 34699 SRR12917521.se.tsv 87100 total ==> SRR12917521.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.9 376 21.2478 Potri.005G024800.1.v4.1 1035 802.901 91 11.4384 Potri.004G059700.1.v4.1 961 728.97 49 6.78377 Potri.007G009000.2.v4.1 1416 1183.9 0 0 Potri.003G141000.2.v4.1 2943 2710.9 534.521 19.8992 Potri.016G087400.1.v4.1 270 98.2129 782.698 804.285 Potri.015G069301.1.v4.1 564 343.616 0 0 Potri.010G195200.1.v4.1 1773 1540.9 64 4.19169 Potri.012G127500.1.v4.1 977 744.931 3871 524.435 ==> SRR12917521.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 159 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 31 SRR12917521 completed mapping pipeline successfully