Starting /dee2/code/volunteer_pipeline.sh SRR12917522 current disk space = 3093378985984 free memory = 1450145028 SRR12917522 SRAfilesize db47ce28e7a4b948b6082bf5ceb8ea68 SRR12917522.sra SRR12917522.sra file validated SRR12917522 is paired end SRR12917522 is conventional basespace SRR12917522 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917522_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5525 37.0 37.0 37.0 37.0 37.0 2 36.406 37.0 37.0 37.0 37.0 37.0 3 36.428 37.0 37.0 37.0 37.0 37.0 4 36.606 37.0 37.0 37.0 37.0 37.0 5 36.519 37.0 37.0 37.0 37.0 37.0 6 36.6355 37.0 37.0 37.0 37.0 37.0 7 36.493 37.0 37.0 37.0 37.0 37.0 8 36.502 37.0 37.0 37.0 37.0 37.0 9 36.518 37.0 37.0 37.0 37.0 37.0 10-14 36.5401 37.0 37.0 37.0 37.0 37.0 15-19 36.477199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.417199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.395799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2099 37.0 37.0 37.0 37.0 37.0 35-39 36.2085 37.0 37.0 37.0 37.0 37.0 40-44 36.1557 37.0 37.0 37.0 37.0 37.0 45-49 36.01180000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.001 37.0 37.0 37.0 37.0 37.0 55-59 35.889199999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.861900000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.7286 37.0 37.0 37.0 37.0 37.0 70-74 35.8516 37.0 37.0 37.0 37.0 37.0 75-79 35.9264 37.0 37.0 37.0 37.0 37.0 80-84 35.8694 37.0 37.0 37.0 37.0 37.0 85-89 35.823699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.809000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7484 37.0 37.0 37.0 37.0 37.0 100-104 35.691599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.697799999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.6158 37.0 37.0 37.0 37.0 37.0 115-119 35.6103 37.0 37.0 37.0 37.0 37.0 120-124 35.5966 37.0 37.0 37.0 37.0 37.0 125-129 35.4823 37.0 37.0 37.0 37.0 37.0 130-134 35.4903 37.0 37.0 37.0 37.0 37.0 135-139 35.3925 37.0 37.0 37.0 34.6 37.0 140-144 35.2091 37.0 37.0 37.0 29.8 37.0 145-149 35.122699999999995 37.0 37.0 37.0 29.8 37.0 150-151 34.903 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 5.0 20 2.0 21 5.0 22 13.0 23 16.0 24 11.0 25 16.0 26 15.0 27 6.0 28 16.0 29 17.0 30 33.0 31 62.0 32 61.0 33 90.0 34 161.0 35 352.0 36 2834.0 37 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.1 12.15 9.6 24.15 2 21.7 10.0 42.3 26.0 3 17.175 27.525 34.175 21.125 4 19.875 26.150000000000002 29.275000000000002 24.7 5 20.4 35.449999999999996 26.5 17.65 6 20.5 33.825 24.8 20.875 7 15.0 25.8 43.525000000000006 15.675 8 14.799999999999999 22.650000000000002 36.65 25.900000000000002 9 17.575 20.75 33.050000000000004 28.625 10-14 19.935 28.1 28.43 23.535 15-19 20.175 27.544999999999998 28.775000000000002 23.505000000000003 20-24 19.814999999999998 27.889999999999997 28.475 23.82 25-29 20.28 27.47 29.104999999999997 23.145 30-34 19.830000000000002 29.145 27.735 23.29 35-39 19.685 28.305000000000003 28.01 24.0 40-44 19.91 28.16 28.244999999999997 23.685000000000002 45-49 20.57 28.705000000000002 27.384999999999998 23.34 50-54 20.635 28.535 27.189999999999998 23.64 55-59 19.985 28.315 27.855 23.845 60-64 20.349999999999998 28.22 28.255000000000003 23.175 65-69 21.0 29.520000000000003 26.77 22.71 70-74 21.44 27.755000000000003 27.275 23.53 75-79 21.73 28.32 26.919999999999998 23.03 80-84 21.375 28.535 26.419999999999998 23.669999999999998 85-89 21.34 28.4 26.395000000000003 23.865 90-94 21.634999999999998 28.494999999999997 26.200000000000003 23.669999999999998 95-99 21.825 28.095 27.169999999999998 22.91 100-104 22.42 28.71 26.045 22.825 105-109 22.275 28.494999999999997 26.090000000000003 23.14 110-114 21.615000000000002 28.955 26.229999999999997 23.200000000000003 115-119 21.95 28.46 26.155 23.435 120-124 22.195 28.444999999999997 25.324999999999996 24.035 125-129 21.93 28.199999999999996 25.6 24.27 130-134 22.27 27.650000000000002 25.900000000000002 24.18 135-139 22.515 27.839999999999996 25.525 24.12 140-144 23.34 26.76 26.035000000000004 23.865 145-149 22.895 26.85 25.835 24.42 150-151 22.1875 27.075 26.3125 24.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 4.0 2 3.0 3 3.5 4 3.0 5 1.0 6 3.5 7 5.0 8 3.5 9 4.0 10 4.5 11 3.5 12 3.5 13 3.5 14 3.0 15 2.0 16 1.5 17 1.0 18 1.5 19 3.5 20 4.0 21 3.5 22 5.5 23 5.0 24 4.5 25 8.0 26 10.5 27 14.5 28 15.5 29 14.5 30 21.5 31 29.5 32 30.0 33 37.5 34 60.5 35 71.5 36 82.0 37 107.0 38 117.0 39 138.5 40 140.5 41 166.0 42 206.0 43 208.5 44 220.0 45 244.0 46 261.0 47 244.5 48 230.0 49 218.0 50 198.0 51 164.0 52 138.0 53 115.5 54 87.0 55 66.0 56 51.0 57 46.0 58 32.0 59 26.0 60 24.5 61 10.5 62 3.5 63 2.5 64 1.5 65 12.0 66 15.5 67 8.5 68 6.5 69 6.0 70 3.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27874369040943 81.375 2 7.291082445316882 13.0 3 0.9814918676388109 2.625 4 0.2243409983174425 0.8 5 0.056085249579360626 0.25 6 0.0 0.0 7 0.056085249579360626 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.11217049915872125 1.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTAT 26 0.65 TruSeq Adapter, Index 13 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 18 0.44999999999999996 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 10 0.25 No Hit CGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTATGCC 10 0.25 TruSeq Adapter, Index 13 (97% over 34bp) CGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCGCGTATGCC 7 0.17500000000000002 TruSeq Adapter, Index 13 (97% over 34bp) GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 7 0.17500000000000002 No Hit GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG 5 0.125 No Hit GCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.1875 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.3125 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4125 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.675 0.0 0.0 0.0 0.0 80-81 0.7124999999999999 0.0 0.0 0.0 0.0 82-83 0.7875000000000001 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1375 0.0 0.0 0.0 0.0 88-89 1.2375 0.0 0.0 0.0 0.0 90-91 1.425 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 2.025 0.0 0.0 0.0 0.0 96-97 2.3625 0.0 0.0 0.0 0.0 98-99 2.675 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.075 0.0 0.0 0.0 0.0 104-105 3.475 0.0 0.0 0.0 0.0 106-107 4.0375 0.0 0.0 0.0 0.0 108-109 4.55 0.0 0.0 0.0 0.0 110-111 4.9 0.0 0.0 0.0 0.0 112-113 5.2875 0.0 0.0 0.0 0.0 114-115 5.85 0.0 0.0 0.0 0.0 116-117 6.3375 0.0 0.0 0.0 0.0 118-119 6.7875 0.0 0.0 0.0 0.0 120-121 7.475 0.0 0.0 0.0 0.0 122-123 8.0 0.0 0.0 0.0 0.0 124-125 8.4375 0.0 0.0 0.0 0.0 126-127 9.125 0.0 0.0 0.0 0.0 128-129 9.725 0.0 0.0 0.0 0.0 130-131 10.337499999999999 0.0 0.0 0.0 0.0 132-133 10.925 0.0 0.0 0.0 0.0 134-135 11.5125 0.0 0.0 0.0 0.0 136-137 11.975 0.0 0.0 0.0 0.0 138-139 12.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCAAA 10 0.006830828 145.0 2 TTGGACT 10 0.006830828 145.0 3 ATATAAA 10 0.006830828 145.0 1 CAGTCTC 20 0.00593511 29.0 140-144 GTCTCAC 20 0.00593511 29.0 140-144 TCTCACA 20 0.00593511 29.0 140-144 CACAGTC 20 0.00593511 29.0 135-139 >>END_MODULE SRR12917522 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917522_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.88 37.0 37.0 37.0 37.0 37.0 2 36.0015 37.0 37.0 37.0 37.0 37.0 3 36.027 37.0 37.0 37.0 37.0 37.0 4 35.9935 37.0 37.0 37.0 37.0 37.0 5 35.9565 37.0 37.0 37.0 37.0 37.0 6 35.886 37.0 37.0 37.0 37.0 37.0 7 35.8535 37.0 37.0 37.0 37.0 37.0 8 35.9895 37.0 37.0 37.0 37.0 37.0 9 35.8315 37.0 37.0 37.0 37.0 37.0 10-14 35.7473 37.0 37.0 37.0 37.0 37.0 15-19 35.5984 37.0 37.0 37.0 37.0 37.0 20-24 35.4482 37.0 37.0 37.0 37.0 37.0 25-29 35.280199999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.16139999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.081100000000006 37.0 37.0 37.0 32.2 37.0 40-44 35.0809 37.0 37.0 37.0 34.6 37.0 45-49 34.968500000000006 37.0 37.0 37.0 27.4 37.0 50-54 34.9404 37.0 37.0 37.0 25.0 37.0 55-59 34.9566 37.0 37.0 37.0 25.0 37.0 60-64 34.9197 37.0 37.0 37.0 27.4 37.0 65-69 34.8785 37.0 37.0 37.0 25.0 37.0 70-74 34.8082 37.0 37.0 37.0 25.0 37.0 75-79 34.756600000000006 37.0 37.0 37.0 25.0 37.0 80-84 34.8022 37.0 37.0 37.0 25.0 37.0 85-89 34.736 37.0 37.0 37.0 25.0 37.0 90-94 34.8173 37.0 37.0 37.0 25.0 37.0 95-99 34.74759999999999 37.0 37.0 37.0 25.0 37.0 100-104 34.77329999999999 37.0 37.0 37.0 25.0 37.0 105-109 34.6663 37.0 37.0 37.0 25.0 37.0 110-114 34.67569999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.5441 37.0 37.0 37.0 25.0 37.0 120-124 34.4221 37.0 37.0 37.0 25.0 37.0 125-129 34.2972 37.0 37.0 37.0 25.0 37.0 130-134 34.0912 37.0 37.0 37.0 25.0 37.0 135-139 33.987700000000004 37.0 37.0 37.0 25.0 37.0 140-144 33.81250000000001 37.0 37.0 37.0 25.0 37.0 145-149 33.596799999999995 37.0 37.0 37.0 22.2 37.0 150-151 33.272999999999996 37.0 37.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 13.0 14 35.0 15 25.0 16 24.0 17 17.0 18 22.0 19 13.0 20 6.0 21 13.0 22 18.0 23 21.0 24 16.0 25 15.0 26 18.0 27 19.0 28 28.0 29 24.0 30 40.0 31 59.0 32 62.0 33 116.0 34 214.0 35 530.0 36 2444.0 37 207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 62.6 12.55 8.1 16.75 2 34.375 12.25 32.35 21.025 3 30.15 17.775 34.75 17.325 4 30.825000000000003 26.700000000000003 21.475 21.0 5 29.075 36.175000000000004 17.825 16.925 6 27.075 34.449999999999996 19.950000000000003 18.525 7 27.025 21.375 32.95 18.65 8 23.45 22.475 29.799999999999997 24.275 9 26.275 23.175 25.95 24.6 10-14 28.465 26.179999999999996 24.93 20.424999999999997 15-19 28.365000000000002 26.195 25.61 19.830000000000002 20-24 27.73 26.505000000000003 25.5 20.265 25-29 27.810000000000002 27.065 25.25 19.875 30-34 27.900000000000002 26.240000000000002 25.814999999999998 20.044999999999998 35-39 28.060000000000002 26.650000000000002 25.35 19.939999999999998 40-44 27.650000000000002 26.99 25.669999999999998 19.689999999999998 45-49 27.715 26.345000000000002 25.885 20.055 50-54 27.195000000000004 27.01 25.545 20.25 55-59 27.51 27.200000000000003 25.575 19.715 60-64 27.245 26.13 26.384999999999998 20.24 65-69 26.875 27.325 25.835 19.965 70-74 27.55 26.479999999999997 25.165 20.805 75-79 27.405 27.389999999999997 25.19 20.015 80-84 27.279999999999998 28.07 24.715 19.935 85-89 26.985 26.915 25.874999999999996 20.225 90-94 26.240000000000002 27.845 26.085 19.830000000000002 95-99 26.534999999999997 27.634999999999998 25.724999999999998 20.105 100-104 26.974999999999998 28.754999999999995 25.124999999999996 19.145 105-109 27.16 28.084999999999997 25.66 19.095000000000002 110-114 26.919999999999998 28.715000000000003 25.319999999999997 19.045 115-119 27.3 28.499999999999996 25.28 18.92 120-124 27.73 27.905 25.77 18.595 125-129 27.725 28.360000000000003 25.035 18.88 130-134 28.485 27.700000000000003 24.995 18.82 135-139 28.95 28.13 24.545 18.375 140-144 28.994999999999997 27.639999999999997 24.965 18.4 145-149 30.520000000000003 28.060000000000002 23.815 17.605 150-151 31.387500000000003 27.675 23.8125 17.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 2.5 7 3.0 8 2.5 9 3.0 10 2.5 11 1.5 12 1.5 13 0.5 14 0.5 15 1.0 16 1.5 17 3.0 18 2.0 19 2.0 20 3.5 21 2.5 22 2.0 23 4.0 24 6.5 25 6.5 26 5.0 27 6.0 28 8.5 29 9.0 30 9.5 31 14.0 32 15.0 33 22.5 34 41.5 35 55.5 36 57.5 37 67.5 38 98.5 39 125.5 40 149.0 41 171.5 42 194.0 43 213.5 44 227.0 45 238.5 46 243.0 47 239.0 48 230.0 49 216.5 50 179.5 51 148.5 52 142.5 53 117.0 54 94.0 55 84.0 56 70.5 57 54.5 58 40.5 59 36.5 60 25.0 61 17.5 62 14.0 63 8.0 64 7.0 65 5.0 66 3.0 67 4.0 68 3.0 69 2.5 70 4.0 71 3.5 72 3.5 73 3.5 74 2.5 75 3.0 76 4.0 77 4.5 78 4.0 79 3.5 80 5.5 81 5.0 82 2.5 83 4.0 84 4.5 85 2.0 86 3.5 87 4.0 88 3.5 89 3.0 90 2.5 91 3.5 92 3.5 93 4.5 94 5.0 95 4.0 96 5.0 97 6.0 98 7.5 99 11.5 100 56.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.06847360912982 80.675 2 6.704707560627675 11.75 3 0.7703281027104136 2.025 4 0.19971469329529246 0.7000000000000001 5 0.14265335235378032 0.625 6 0.028530670470756064 0.15 7 0.028530670470756064 0.17500000000000002 8 0.0 0.0 9 0.028530670470756064 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.028530670470756064 3.675 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 147 3.675 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 9 0.22499999999999998 No Hit GCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCATC 7 0.17500000000000002 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 6 0.15 No Hit GTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGAC 5 0.125 No Hit GTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGG 5 0.125 No Hit GCCGTTGCCACAGTTAACCGCACCCCGGCACAGGCCAACATGGTTGCACC 5 0.125 No Hit GCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATC 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.1875 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.65 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.9125 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.2625 0.0 0.0 0.0 0.0 90-91 1.45 0.0 0.0 0.0 0.0 92-93 1.6875 0.0 0.0 0.0 0.0 94-95 2.0125 0.0 0.0 0.0 0.0 96-97 2.3625 0.0 0.0 0.0 0.0 98-99 2.675 0.0 0.0 0.0 0.0 100-101 2.8625 0.0 0.0 0.0 0.0 102-103 3.05 0.0 0.0 0.0 0.0 104-105 3.45 0.0 0.0 0.0 0.0 106-107 4.0125 0.0 0.0 0.0 0.0 108-109 4.5 0.0 0.0 0.0 0.0 110-111 4.85 0.0 0.0 0.0 0.0 112-113 5.2375 0.0 0.0 0.0 0.0 114-115 5.800000000000001 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.7625 0.0 0.0 0.0 0.0 120-121 7.4375 0.0 0.0 0.0 0.0 122-123 7.949999999999999 0.0 0.0 0.0 0.0 124-125 8.375 0.0 0.0 0.0 0.0 126-127 9.0375 0.0 0.0 0.0 0.0 128-129 9.625 0.0 0.0 0.0 0.0 130-131 10.2 0.0 0.0 0.0 0.0 132-133 10.775 0.0 0.0 0.0 0.0 134-135 11.3375 0.0 0.0 0.0 0.0 136-137 11.825 0.0 0.0 0.0 0.0 138-139 12.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAGC 10 0.006830828 145.0 9 ATAGCTT 10 0.006830828 145.0 3 CATAGCT 10 0.006830828 145.0 2 GCATAGC 10 0.006830828 145.0 1 >>END_MODULE Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248021 spots for SRR12917522.sra Written 248021 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra Read 248016 spots for SRR12917522.sra Written 248016 spots for SRR12917522.sra SRR ids: ['SRR12917522.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4k862sz2 SRR12917522.sra spots: 4960325 blocks: [[1, 248016], [248017, 496032], [496033, 744048], [744049, 992064], [992065, 1240080], [1240081, 1488096], [1488097, 1736112], [1736113, 1984128], [1984129, 2232144], [2232145, 2480160], [2480161, 2728176], [2728177, 2976192], [2976193, 3224208], [3224209, 3472224], [3472225, 3720240], [3720241, 3968256], [3968257, 4216272], [4216273, 4464288], [4464289, 4712304], [4712305, 4960325]] SRR12917522 file size 1673878 SRR12917522 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917522 SRR12917522_1.fastq SRR12917522_2.fastq Input file: SRR12917522_1.fastq Paired file: SRR12917522_2.fastq trimmed: SRR12917522-trimmed-pair1.fastq, SRR12917522-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:31:31 2025 >> started Thu Feb 13 11:31:36 2025 >> done (5.309s) 4960325 read pairs processed; of these: 392 ( 0.01%) short read pairs filtered out after trimming by size control 38961 ( 0.79%) empty read pairs filtered out after trimming by size control 4920972 (99.21%) read pairs available; of these: 881461 (17.91%) trimmed read pairs available after processing 4039511 (82.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 43 0.00% 19 57 0.00% 20 51 0.00% 21 84 0.00% 22 80 0.00% 23 97 0.00% 24 109 0.00% 25 118 0.00% 26 153 0.00% 27 145 0.00% 28 215 0.00% 29 160 0.00% 30 167 0.00% 31 135 0.00% 32 116 0.00% 33 115 0.00% 34 118 0.00% 35 126 0.00% 36 121 0.00% 37 143 0.00% 38 96 0.00% 39 121 0.00% 40 118 0.00% 41 119 0.00% 42 111 0.00% 43 131 0.00% 44 140 0.00% 45 163 0.00% 46 152 0.00% 47 140 0.00% 48 154 0.00% 49 182 0.00% 50 173 0.00% 51 233 0.00% 52 266 0.01% 53 274 0.01% 54 286 0.01% 55 269 0.01% 56 274 0.01% 57 324 0.01% 58 334 0.01% 59 389 0.01% 60 478 0.01% 61 575 0.01% 62 702 0.01% 63 808 0.02% 64 834 0.02% 65 917 0.02% 66 835 0.02% 67 833 0.02% 68 937 0.02% 69 1038 0.02% 70 1266 0.03% 71 1467 0.03% 72 1962 0.04% 73 2286 0.05% 74 2351 0.05% 75 2408 0.05% 76 2286 0.05% 77 2348 0.05% 78 2365 0.05% 79 2444 0.05% 80 2770 0.06% 81 3519 0.07% 82 3960 0.08% 83 4692 0.10% 84 5094 0.10% 85 4942 0.10% 86 4966 0.10% 87 4850 0.10% 88 4444 0.09% 89 4804 0.10% 90 5060 0.10% 91 5629 0.11% 92 6703 0.14% 93 7480 0.15% 94 8078 0.16% 95 8554 0.17% 96 8120 0.17% 97 7860 0.16% 98 7223 0.15% 99 7292 0.15% 100 7439 0.15% 101 7797 0.16% 102 9148 0.19% 103 10119 0.21% 104 10974 0.22% 105 11542 0.23% 106 11143 0.23% 107 10945 0.22% 108 10449 0.21% 109 10148 0.21% 110 9787 0.20% 111 10094 0.21% 112 10854 0.22% 113 11903 0.24% 114 13358 0.27% 115 14281 0.29% 116 14546 0.30% 117 14089 0.29% 118 13248 0.27% 119 12934 0.26% 120 12405 0.25% 121 12571 0.26% 122 12417 0.25% 123 14058 0.29% 124 15182 0.31% 125 16577 0.34% 126 17667 0.36% 127 16436 0.33% 128 16170 0.33% 129 15582 0.32% 130 14282 0.29% 131 14306 0.29% 132 14502 0.29% 133 14937 0.30% 134 16213 0.33% 135 17763 0.36% 136 18170 0.37% 137 18287 0.37% 138 18168 0.37% 139 17355 0.35% 140 16202 0.33% 141 15974 0.32% 142 15170 0.31% 143 15501 0.31% 144 16573 0.34% 145 18028 0.37% 146 19316 0.39% 147 18905 0.38% 148 19132 0.39% 149 18849 0.38% 150 17983 0.37% 151 4039511 82.09% 4920972 reads passed initial QC criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=1.20 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=194.99 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=10 prefix-density=1.01 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=30.64 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCAGACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR12917522 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:32:21 Started mapping on | Feb 13 11:32:21 Finished on | Feb 13 11:33:12 Mapping speed, Million of reads per hour | 347.36 Number of input reads | 4920972 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 4165065 Uniquely mapped reads % | 84.64% Average mapped length | 287.95 Number of splices: Total | 4076255 Number of splices: Annotated (sjdb) | 4001264 Number of splices: GT/AG | 3982586 Number of splices: GC/AG | 77669 Number of splices: AT/AC | 2332 Number of splices: Non-canonical | 13668 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 105296 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 18193 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.52% % of reads unmapped: other | 2.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 650611 650611 650611 N_multimapping 105296 105296 105296 N_noFeature 113659 4089042 140337 N_ambiguous 74617 275 25078 UnstrandedReadsAssigned:3976789 PositiveStrandReadsAssigned:75748 NegativeStrandReadsAssigned:3999650 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917522 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917522-trimmed-pair1.fastq SRR12917522-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,920,972 reads, 4,117,429 reads pseudoaligned [quant] estimated average fragment length: 231.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 993 rounds 52401 SRR12917522.ke.tsv 34699 SRR12917522.se.tsv 87100 total ==> SRR12917522.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.06 86 11.0291 Potri.005G024800.1.v4.1 1035 804.062 81 23.0876 Potri.004G059700.1.v4.1 961 730.233 5 1.56925 Potri.007G009000.2.v4.1 1416 1185.06 0 0 Potri.003G141000.2.v4.1 2943 2712.06 175 14.7884 Potri.016G087400.1.v4.1 270 101.612 173 390.196 Potri.015G069301.1.v4.1 564 346.484 0 0 Potri.010G195200.1.v4.1 1773 1542.06 2 0.297242 Potri.012G127500.1.v4.1 977 746.159 34 10.4431 ==> SRR12917522.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12917522 completed mapping pipeline successfully