Starting /dee2/code/volunteer_pipeline.sh SRR12917523 current disk space = 3092391878656 free memory = 1579899724 SRR12917523 SRAfilesize 8af9b2533340cab19a20a9babf41b4ab SRR12917523.sra SRR12917523.sra file validated SRR12917523 is paired end SRR12917523 is conventional basespace SRR12917523 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917523_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56175 37.0 37.0 37.0 37.0 37.0 2 36.3865 37.0 37.0 37.0 37.0 37.0 3 36.5385 37.0 37.0 37.0 37.0 37.0 4 36.6005 37.0 37.0 37.0 37.0 37.0 5 36.6555 37.0 37.0 37.0 37.0 37.0 6 36.6185 37.0 37.0 37.0 37.0 37.0 7 36.5435 37.0 37.0 37.0 37.0 37.0 8 36.5975 37.0 37.0 37.0 37.0 37.0 9 36.6405 37.0 37.0 37.0 37.0 37.0 10-14 36.6505 37.0 37.0 37.0 37.0 37.0 15-19 36.6053 37.0 37.0 37.0 37.0 37.0 20-24 36.5332 37.0 37.0 37.0 37.0 37.0 25-29 36.51559999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.459 37.0 37.0 37.0 37.0 37.0 35-39 36.455 37.0 37.0 37.0 37.0 37.0 40-44 36.4797 37.0 37.0 37.0 37.0 37.0 45-49 36.312599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3192 37.0 37.0 37.0 37.0 37.0 55-59 36.267100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.1938 37.0 37.0 37.0 37.0 37.0 65-69 36.107 37.0 37.0 37.0 37.0 37.0 70-74 36.2255 37.0 37.0 37.0 37.0 37.0 75-79 36.27990000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.230000000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1923 37.0 37.0 37.0 37.0 37.0 90-94 36.17999999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1057 37.0 37.0 37.0 37.0 37.0 100-104 36.116200000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0043 37.0 37.0 37.0 37.0 37.0 110-114 35.9876 37.0 37.0 37.0 37.0 37.0 115-119 35.9455 37.0 37.0 37.0 37.0 37.0 120-124 35.923899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9305 37.0 37.0 37.0 37.0 37.0 130-134 35.83669999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.696600000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.571000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.492000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.22775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 3.0 25 3.0 26 12.0 27 6.0 28 8.0 29 15.0 30 28.0 31 32.0 32 42.0 33 84.0 34 146.0 35 380.0 36 2950.0 37 285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.812953238309575 13.578394598649663 5.52638159539885 29.08227056764191 2 20.45 10.875 35.8 32.875 3 16.1 16.85 30.625000000000004 36.425000000000004 4 21.099999999999998 21.175 26.275 31.45 5 23.724999999999998 28.325 24.625 23.325000000000003 6 21.325 32.2 24.5 21.975 7 15.65 29.599999999999998 39.15 15.6 8 15.45 26.775 34.4 23.375 9 17.349999999999998 22.05 35.35 25.25 10-14 20.080000000000002 29.835 27.61 22.475 15-19 20.02 28.125 27.275 24.58 20-24 19.695 28.53 28.235 23.54 25-29 19.64 28.76 27.605 23.995 30-34 19.605 27.675 28.23 24.490000000000002 35-39 20.04 28.485 27.52 23.955000000000002 40-44 19.71 28.92 27.325 24.044999999999998 45-49 19.935 28.355000000000004 28.084999999999997 23.625 50-54 20.794999999999998 27.955000000000002 27.589999999999996 23.66 55-59 20.3 28.244999999999997 27.595 23.86 60-64 20.105 27.944999999999997 28.1 23.849999999999998 65-69 19.744999999999997 28.08 27.855 24.32 70-74 20.57 27.785 27.48 24.165 75-79 20.285 27.805000000000003 27.395000000000003 24.515 80-84 20.41 27.42 28.32 23.849999999999998 85-89 20.44 27.665 27.894999999999996 24.0 90-94 20.735 28.02 27.355 23.89 95-99 21.135 27.925 26.91 24.03 100-104 20.23 28.535 27.555000000000003 23.68 105-109 21.2 27.665 27.67 23.465 110-114 20.93 28.075 26.525 24.47 115-119 21.59 28.075 26.479999999999997 23.855 120-124 21.315 27.955000000000002 26.424999999999997 24.305 125-129 21.475 28.16 25.97 24.395 130-134 21.959999999999997 28.215 26.195 23.630000000000003 135-139 21.645 27.884999999999998 26.009999999999998 24.46 140-144 21.67 27.295 26.75 24.285 145-149 21.495 27.61 26.1 24.795 150-151 20.9875 27.3375 26.575 25.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 2.0 22 1.0 23 0.0 24 1.0 25 7.0 26 9.5 27 7.5 28 7.0 29 7.0 30 18.0 31 31.0 32 37.5 33 49.0 34 60.5 35 65.5 36 79.0 37 97.5 38 122.5 39 157.0 40 170.0 41 201.5 42 234.0 43 236.5 44 264.0 45 270.5 46 249.0 47 241.0 48 222.0 49 206.0 50 175.0 51 144.0 52 119.5 53 92.0 54 81.5 55 62.5 56 43.0 57 34.0 58 36.5 59 35.0 60 22.5 61 14.0 62 14.0 63 10.5 64 6.0 65 14.5 66 16.0 67 4.5 68 1.0 69 2.0 70 1.5 71 1.5 72 1.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 91.33204098587649 82.45 2 7.25560786485738 13.100000000000001 3 1.1631127111603434 3.15 4 0.1938521185267239 0.7000000000000001 5 0.027693159789531983 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027693159789531983 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACTGACAATCTCGTAT 19 0.475 TruSeq Adapter, Index 7 (97% over 35bp) GATCTGAGGAACACCCCTAGGTGCTGGAGGAATGCCAGATAGCTCAAATT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.725 0.0 0.0 0.0 0.0 112-113 3.1 0.0 0.0 0.0 0.0 114-115 3.5374999999999996 0.0 0.0 0.0 0.0 116-117 3.95 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.15 0.0 0.0 0.0 0.0 132-133 7.800000000000001 0.0 0.0 0.0 0.0 134-135 8.412500000000001 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGTAA 10 0.006830828 145.0 7 CCAGTCA 35 0.0033124194 62.14286 145 >>END_MODULE SRR12917523 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917523_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2915 37.0 37.0 37.0 37.0 37.0 2 36.0915 37.0 37.0 37.0 37.0 37.0 3 36.0905 37.0 37.0 37.0 37.0 37.0 4 36.1525 37.0 37.0 37.0 37.0 37.0 5 36.2165 37.0 37.0 37.0 37.0 37.0 6 36.159 37.0 37.0 37.0 37.0 37.0 7 36.202 37.0 37.0 37.0 37.0 37.0 8 36.2025 37.0 37.0 37.0 37.0 37.0 9 36.19 37.0 37.0 37.0 37.0 37.0 10-14 36.2035 37.0 37.0 37.0 37.0 37.0 15-19 36.2022 37.0 37.0 37.0 37.0 37.0 20-24 36.1474 37.0 37.0 37.0 37.0 37.0 25-29 36.025099999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.9014 37.0 37.0 37.0 37.0 37.0 35-39 35.8776 37.0 37.0 37.0 37.0 37.0 40-44 35.9122 37.0 37.0 37.0 37.0 37.0 45-49 35.800200000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8461 37.0 37.0 37.0 37.0 37.0 55-59 35.820299999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8609 37.0 37.0 37.0 37.0 37.0 65-69 35.8022 37.0 37.0 37.0 37.0 37.0 70-74 35.7118 37.0 37.0 37.0 37.0 37.0 75-79 35.7051 37.0 37.0 37.0 37.0 37.0 80-84 35.759 37.0 37.0 37.0 37.0 37.0 85-89 35.721199999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.736599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.736599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.693000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.6783 37.0 37.0 37.0 37.0 37.0 110-114 35.6103 37.0 37.0 37.0 37.0 37.0 115-119 35.6197 37.0 37.0 37.0 37.0 37.0 120-124 35.3959 37.0 37.0 37.0 37.0 37.0 125-129 35.4668 37.0 37.0 37.0 37.0 37.0 130-134 35.365300000000005 37.0 37.0 37.0 34.6 37.0 135-139 35.2923 37.0 37.0 37.0 34.6 37.0 140-144 35.1471 37.0 37.0 37.0 27.4 37.0 145-149 35.0202 37.0 37.0 37.0 25.0 37.0 150-151 34.53425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 7.0 14 5.0 15 2.0 16 5.0 17 2.0 18 2.0 19 4.0 20 7.0 21 2.0 22 6.0 23 8.0 24 12.0 25 5.0 26 10.0 27 13.0 28 6.0 29 25.0 30 22.0 31 36.0 32 76.0 33 90.0 34 203.0 35 586.0 36 2682.0 37 184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.65 27.375 7.475 19.5 2 32.975 24.224999999999998 26.950000000000003 15.85 3 20.225 28.425 34.449999999999996 16.900000000000002 4 24.15 32.45 24.65 18.75 5 25.7 36.175000000000004 20.674999999999997 17.45 6 21.95 39.925 21.125 17.0 7 22.125 23.525 35.775 18.575 8 20.875 25.5 28.625 25.0 9 23.7 24.075 28.775000000000002 23.45 10-14 24.41 28.720000000000002 26.424999999999997 20.445 15-19 24.58 27.655 27.36 20.405 20-24 24.325 28.720000000000002 27.025 19.93 25-29 24.385 27.715 27.200000000000003 20.7 30-34 24.495 28.904999999999998 26.33 20.27 35-39 24.255 28.084999999999997 27.05 20.61 40-44 23.855 28.12 27.195000000000004 20.830000000000002 45-49 24.709999999999997 26.945000000000004 27.295 21.05 50-54 24.57 28.005000000000003 26.965 20.46 55-59 24.93 28.000000000000004 26.77 20.3 60-64 24.32 27.065 27.400000000000002 21.215 65-69 24.735 27.365000000000002 27.02 20.880000000000003 70-74 25.174999999999997 27.810000000000002 26.965 20.05 75-79 24.86 27.794999999999998 26.945000000000004 20.4 80-84 24.675 27.22 27.279999999999998 20.825 85-89 24.905 27.675 26.700000000000003 20.72 90-94 24.795 27.029999999999998 27.54 20.635 95-99 24.63 27.61 27.26 20.5 100-104 25.235000000000003 28.33 26.355 20.080000000000002 105-109 25.185000000000002 27.560000000000002 26.26 20.995 110-114 24.705 28.46 25.679999999999996 21.154999999999998 115-119 25.35 27.975 26.384999999999998 20.29 120-124 25.64 27.675 26.314999999999998 20.369999999999997 125-129 25.615 27.985 26.400000000000002 20.0 130-134 25.86 27.98 26.275 19.885 135-139 25.95 27.955000000000002 26.72 19.375 140-144 25.935000000000002 28.845 25.44 19.78 145-149 26.87 27.755000000000003 25.740000000000002 19.634999999999998 150-151 26.5625 28.525 25.7625 19.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 2.0 10 2.5 11 1.0 12 0.5 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 1.0 23 1.5 24 1.0 25 2.0 26 3.0 27 2.5 28 4.5 29 6.5 30 5.0 31 10.0 32 22.5 33 33.5 34 42.5 35 54.0 36 68.0 37 102.0 38 131.0 39 142.0 40 188.5 41 229.5 42 246.0 43 253.0 44 276.0 45 296.5 46 289.0 47 261.5 48 230.0 49 203.0 50 156.0 51 119.0 52 106.5 53 88.5 54 66.5 55 59.0 56 56.0 57 47.5 58 26.5 59 17.0 60 17.0 61 15.0 62 13.0 63 12.5 64 11.0 65 5.0 66 1.5 67 1.5 68 1.5 69 2.5 70 4.0 71 3.0 72 3.0 73 3.0 74 1.5 75 1.0 76 1.0 77 0.5 78 0.0 79 1.0 80 1.5 81 0.5 82 0.5 83 1.5 84 1.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 1.0 97 1.5 98 2.5 99 3.0 100 11.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.95370625516671 83.42500000000001 2 6.944061724993111 12.6 3 0.8542298153761366 2.325 4 0.11022320198401765 0.4 5 0.055111600992008826 0.25 6 0.027555800496004413 0.15 7 0.0 0.0 8 0.027555800496004413 0.2 9 0.0 0.0 >10 0.027555800496004413 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit GTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTGCATA 8 0.2 No Hit AGCAGTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTG 6 0.15 No Hit GCATCAACCCTGATGAGGCTGTTGCATATGGTGCTGCAGTCCAGGCTGCT 5 0.125 No Hit AGAAAGGTAAACTGGTATTTGGAGATTTCAATTATCCAGAGAATGGAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.4500000000000002 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.475 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.05 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.825 0.0 0.0 0.0 0.0 122-123 5.1875 0.0 0.0 0.0 0.0 124-125 5.6875 0.0 0.0 0.0 0.0 126-127 6.225 0.0 0.0 0.0 0.0 128-129 6.7125 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.925 0.0 0.0 0.0 0.0 134-135 8.537500000000001 0.0 0.0 0.0 0.0 136-137 9.1375 0.0 0.0 0.0 0.0 138-139 9.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTGT 25 8.7132835E-4 87.0 145 >>END_MODULE Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551264 spots for SRR12917523.sra Written 551264 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra Read 551249 spots for SRR12917523.sra Written 551249 spots for SRR12917523.sra SRR ids: ['SRR12917523.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k1cymay9 SRR12917523.sra spots: 11024995 blocks: [[1, 551249], [551250, 1102498], [1102499, 1653747], [1653748, 2204996], [2204997, 2756245], [2756246, 3307494], [3307495, 3858743], [3858744, 4409992], [4409993, 4961241], [4961242, 5512490], [5512491, 6063739], [6063740, 6614988], [6614989, 7166237], [7166238, 7717486], [7717487, 8268735], [8268736, 8819984], [8819985, 9371233], [9371234, 9922482], [9922483, 10473731], [10473732, 11024995]] SRR12917523 file size 3725075 SRR12917523 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917523 SRR12917523_1.fastq SRR12917523_2.fastq Input file: SRR12917523_1.fastq Paired file: SRR12917523_2.fastq trimmed: SRR12917523-trimmed-pair1.fastq, SRR12917523-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:19:57 2025 >> started Thu Feb 13 12:20:11 2025 >> done (13.528s) 11024995 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 67610 ( 0.61%) empty read pairs filtered out after trimming by size control 10957288 (99.39%) read pairs available; of these: 1470479 (13.42%) trimmed read pairs available after processing 9486809 (86.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 12 0.00% 20 8 0.00% 21 19 0.00% 22 21 0.00% 23 24 0.00% 24 25 0.00% 25 18 0.00% 26 31 0.00% 27 30 0.00% 28 34 0.00% 29 26 0.00% 30 19 0.00% 31 32 0.00% 32 25 0.00% 33 43 0.00% 34 27 0.00% 35 31 0.00% 36 33 0.00% 37 25 0.00% 38 18 0.00% 39 30 0.00% 40 46 0.00% 41 47 0.00% 42 52 0.00% 43 43 0.00% 44 52 0.00% 45 49 0.00% 46 58 0.00% 47 54 0.00% 48 72 0.00% 49 80 0.00% 50 81 0.00% 51 67 0.00% 52 119 0.00% 53 102 0.00% 54 121 0.00% 55 145 0.00% 56 136 0.00% 57 188 0.00% 58 193 0.00% 59 252 0.00% 60 273 0.00% 61 364 0.00% 62 413 0.00% 63 457 0.00% 64 469 0.00% 65 540 0.00% 66 661 0.01% 67 701 0.01% 68 778 0.01% 69 890 0.01% 70 1029 0.01% 71 1181 0.01% 72 1454 0.01% 73 1592 0.01% 74 1844 0.02% 75 1937 0.02% 76 2129 0.02% 77 2348 0.02% 78 2535 0.02% 79 2746 0.03% 80 3001 0.03% 81 3440 0.03% 82 3854 0.04% 83 4343 0.04% 84 4778 0.04% 85 5111 0.05% 86 5334 0.05% 87 5700 0.05% 88 5971 0.05% 89 6336 0.06% 90 6487 0.06% 91 6958 0.06% 92 7753 0.07% 93 8328 0.08% 94 8733 0.08% 95 9399 0.09% 96 10234 0.09% 97 10336 0.09% 98 10674 0.10% 99 11022 0.10% 100 11752 0.11% 101 11981 0.11% 102 12509 0.11% 103 13355 0.12% 104 13765 0.13% 105 14721 0.13% 106 15497 0.14% 107 15776 0.14% 108 16201 0.15% 109 16398 0.15% 110 16755 0.15% 111 17457 0.16% 112 18063 0.16% 113 18269 0.17% 114 19347 0.18% 115 20058 0.18% 116 20754 0.19% 117 21782 0.20% 118 22071 0.20% 119 22143 0.20% 120 23138 0.21% 121 23229 0.21% 122 23596 0.22% 123 24280 0.22% 124 25499 0.23% 125 26034 0.24% 126 26627 0.24% 127 27365 0.25% 128 27518 0.25% 129 28302 0.26% 130 29024 0.26% 131 28991 0.26% 132 29718 0.27% 133 29896 0.27% 134 30426 0.28% 135 31770 0.29% 136 31830 0.29% 137 32491 0.30% 138 32947 0.30% 139 34111 0.31% 140 34251 0.31% 141 34518 0.32% 142 35585 0.32% 143 35316 0.32% 144 36323 0.33% 145 36374 0.33% 146 37392 0.34% 147 37817 0.35% 148 37398 0.34% 149 37422 0.34% 150 38008 0.35% 151 9486809 86.58% 10957288 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=25 prefix-density=0.90 prefix-fanout=2.1 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=14.54 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.86 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=41.84 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.0 sequence=CACAAAGCAGTTGCATTTATCTAAAGTATT SRR12917523 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:20:53 Started mapping on | Feb 13 12:20:53 Finished on | Feb 13 12:22:19 Mapping speed, Million of reads per hour | 458.68 Number of input reads | 10957288 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9794597 Uniquely mapped reads % | 89.39% Average mapped length | 293.63 Number of splices: Total | 8971304 Number of splices: Annotated (sjdb) | 8808329 Number of splices: GT/AG | 8806743 Number of splices: GC/AG | 126795 Number of splices: AT/AC | 8894 Number of splices: Non-canonical | 28872 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.03% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299183 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 340296 % of reads mapped to too many loci | 3.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 863508 863508 863508 N_multimapping 299183 299183 299183 N_noFeature 215955 9675685 263709 N_ambiguous 127709 569 56258 UnstrandedReadsAssigned:9450933 PositiveStrandReadsAssigned:118343 NegativeStrandReadsAssigned:9474630 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917523 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917523-trimmed-pair1.fastq SRR12917523-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,957,288 reads, 9,718,900 reads pseudoaligned [quant] estimated average fragment length: 250.121 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12917523.ke.tsv 34699 SRR12917523.se.tsv 87100 total ==> SRR12917523.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.88 289 15.0876 Potri.005G024800.1.v4.1 1035 785.879 142 16.686 Potri.004G059700.1.v4.1 961 712.047 38 4.92828 Potri.007G009000.2.v4.1 1416 1166.88 3 0.237419 Potri.003G141000.2.v4.1 2943 2693.88 339 11.621 Potri.016G087400.1.v4.1 270 90.5811 792.749 808.199 Potri.015G069301.1.v4.1 564 329.595 0 0 Potri.010G195200.1.v4.1 1773 1523.88 24 1.45439 Potri.012G127500.1.v4.1 977 727.958 5551 704.183 ==> SRR12917523.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12917523 completed mapping pipeline successfully