Starting /dee2/code/volunteer_pipeline.sh SRR12917524 current disk space = 3092548046848 free memory = 1572621452 SRR12917524 SRAfilesize fe98e579011beebfe560851d538efa81 SRR12917524.sra SRR12917524.sra file validated SRR12917524 is paired end SRR12917524 is conventional basespace SRR12917524 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917524_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.61 37.0 37.0 37.0 37.0 37.0 2 36.4295 37.0 37.0 37.0 37.0 37.0 3 36.5405 37.0 37.0 37.0 37.0 37.0 4 36.6525 37.0 37.0 37.0 37.0 37.0 5 36.5985 37.0 37.0 37.0 37.0 37.0 6 36.646 37.0 37.0 37.0 37.0 37.0 7 36.5925 37.0 37.0 37.0 37.0 37.0 8 36.646 37.0 37.0 37.0 37.0 37.0 9 36.675 37.0 37.0 37.0 37.0 37.0 10-14 36.65089999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.608599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5693 37.0 37.0 37.0 37.0 37.0 25-29 36.5287 37.0 37.0 37.0 37.0 37.0 30-34 36.4669 37.0 37.0 37.0 37.0 37.0 35-39 36.5043 37.0 37.0 37.0 37.0 37.0 40-44 36.475 37.0 37.0 37.0 37.0 37.0 45-49 36.436 37.0 37.0 37.0 37.0 37.0 50-54 36.4504 37.0 37.0 37.0 37.0 37.0 55-59 36.3957 37.0 37.0 37.0 37.0 37.0 60-64 36.3669 37.0 37.0 37.0 37.0 37.0 65-69 36.365300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.4126 37.0 37.0 37.0 37.0 37.0 75-79 36.396699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3211 37.0 37.0 37.0 37.0 37.0 85-89 36.311800000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.3568 37.0 37.0 37.0 37.0 37.0 95-99 36.2564 37.0 37.0 37.0 37.0 37.0 100-104 36.192699999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.150400000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1736 37.0 37.0 37.0 37.0 37.0 115-119 36.0991 37.0 37.0 37.0 37.0 37.0 120-124 36.0659 37.0 37.0 37.0 37.0 37.0 125-129 36.04 37.0 37.0 37.0 37.0 37.0 130-134 35.944100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.87779999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.755399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.702299999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.352999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 7.0 27 4.0 28 9.0 29 14.0 30 20.0 31 30.0 32 43.0 33 62.0 34 113.0 35 332.0 36 3029.0 37 333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.86993496748374 12.756378189094548 5.3526763381690845 42.021010505252626 2 18.675 12.625 36.175000000000004 32.525 3 15.65 16.225 28.349999999999998 39.775 4 23.075000000000003 22.375 23.400000000000002 31.15 5 23.3 29.475 25.025 22.2 6 20.75 31.424999999999997 24.375 23.45 7 15.1 27.875 39.6 17.424999999999997 8 17.25 27.675 32.675 22.400000000000002 9 17.325 23.225 35.475 23.974999999999998 10-14 19.45 29.895 27.744999999999997 22.91 15-19 19.525000000000002 27.705000000000002 28.1 24.67 20-24 19.905 27.800000000000004 27.775 24.52 25-29 20.64 27.905 27.400000000000002 24.055 30-34 19.655 28.185 27.689999999999998 24.47 35-39 20.205000000000002 28.044999999999998 27.384999999999998 24.365000000000002 40-44 20.21 28.43 27.395000000000003 23.965 45-49 20.47 28.01 27.35 24.169999999999998 50-54 20.73 28.12 27.26 23.89 55-59 20.73 28.32 26.979999999999997 23.97 60-64 20.169999999999998 27.975 27.560000000000002 24.295 65-69 20.925 27.26 27.48 24.335 70-74 20.69 28.134999999999998 26.86 24.315 75-79 20.044999999999998 28.83 27.175 23.95 80-84 20.68 27.27 28.000000000000004 24.05 85-89 20.705000000000002 28.24 27.065 23.990000000000002 90-94 20.979999999999997 27.575 27.21 24.235 95-99 20.45 28.050000000000004 27.6 23.9 100-104 20.965 28.444999999999997 26.884999999999998 23.705000000000002 105-109 21.11 27.529999999999998 27.615000000000002 23.745 110-114 20.735 27.405 28.005000000000003 23.855 115-119 21.154999999999998 28.139999999999997 27.115000000000002 23.59 120-124 21.11 27.900000000000002 27.229999999999997 23.76 125-129 20.22 27.99 27.189999999999998 24.6 130-134 20.865000000000002 27.650000000000002 27.389999999999997 24.095 135-139 21.45 26.685 27.0 24.865000000000002 140-144 21.32 27.495000000000005 26.955000000000002 24.23 145-149 20.685000000000002 27.76 27.529999999999998 24.025 150-151 21.9 26.85 27.3 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 3.0 25 4.5 26 5.0 27 7.5 28 10.0 29 9.0 30 14.5 31 25.0 32 32.5 33 32.0 34 44.5 35 53.5 36 62.5 37 89.5 38 125.5 39 139.5 40 158.5 41 198.5 42 234.5 43 243.5 44 237.5 45 257.0 46 275.0 47 285.5 48 250.5 49 219.5 50 202.5 51 156.5 52 121.0 53 106.5 54 93.0 55 73.5 56 61.5 57 48.0 58 31.5 59 22.5 60 15.0 61 10.5 62 10.0 63 9.5 64 6.5 65 3.0 66 2.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.425 #Duplication Level Percentage of deduplicated Percentage of total 1 90.7381808128283 82.05 2 8.211224771910423 14.85 3 0.8847110865358032 2.4 4 0.1105888858169754 0.4 5 0.0 0.0 6 0.0552944429084877 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCATCAGTTTAAAAGAGTCTACTTGGAAATTATTGTAAGCTGGTCCAA 6 0.15 No Hit GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.225 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.2874999999999996 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.175 0.0 0.0 0.0 0.0 134-135 4.449999999999999 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTTG 10 0.006830828 145.0 8 >>END_MODULE SRR12917524 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917524_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3405 37.0 37.0 37.0 37.0 37.0 2 36.1855 37.0 37.0 37.0 37.0 37.0 3 36.194 37.0 37.0 37.0 37.0 37.0 4 36.231 37.0 37.0 37.0 37.0 37.0 5 36.26 37.0 37.0 37.0 37.0 37.0 6 36.259 37.0 37.0 37.0 37.0 37.0 7 36.3525 37.0 37.0 37.0 37.0 37.0 8 36.346 37.0 37.0 37.0 37.0 37.0 9 36.373 37.0 37.0 37.0 37.0 37.0 10-14 36.3705 37.0 37.0 37.0 37.0 37.0 15-19 36.3255 37.0 37.0 37.0 37.0 37.0 20-24 36.291999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2389 37.0 37.0 37.0 37.0 37.0 30-34 36.1905 37.0 37.0 37.0 37.0 37.0 35-39 36.1519 37.0 37.0 37.0 37.0 37.0 40-44 36.1639 37.0 37.0 37.0 37.0 37.0 45-49 36.0483 37.0 37.0 37.0 37.0 37.0 50-54 36.0094 37.0 37.0 37.0 37.0 37.0 55-59 36.0629 37.0 37.0 37.0 37.0 37.0 60-64 36.0361 37.0 37.0 37.0 37.0 37.0 65-69 35.979499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.97410000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.909299999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.930099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.886199999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.963499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8644 37.0 37.0 37.0 37.0 37.0 100-104 35.807100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7709 37.0 37.0 37.0 37.0 37.0 110-114 35.7241 37.0 37.0 37.0 37.0 37.0 115-119 35.6468 37.0 37.0 37.0 37.0 37.0 120-124 35.6006 37.0 37.0 37.0 37.0 37.0 125-129 35.5202 37.0 37.0 37.0 37.0 37.0 130-134 35.51220000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.4821 37.0 37.0 37.0 37.0 37.0 140-144 35.4059 37.0 37.0 37.0 37.0 37.0 145-149 35.2531 37.0 37.0 37.0 29.8 37.0 150-151 34.714 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 4.0 21 0.0 22 1.0 23 3.0 24 7.0 25 5.0 26 7.0 27 12.0 28 16.0 29 15.0 30 23.0 31 54.0 32 57.0 33 95.0 34 198.0 35 564.0 36 2734.0 37 197.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.949999999999996 25.525 8.75 30.775000000000002 2 25.900000000000002 27.500000000000004 30.5 16.1 3 18.025 30.575000000000003 31.025000000000002 20.375 4 21.775 34.1 25.224999999999998 18.9 5 26.3 36.6 20.974999999999998 16.125 6 20.7 39.574999999999996 21.325 18.4 7 20.025000000000002 23.275000000000002 37.225 19.475 8 19.85 26.575 29.049999999999997 24.525 9 21.099999999999998 22.625 32.175 24.099999999999998 10-14 22.61 28.9 26.645000000000003 21.845 15-19 23.235 28.24 27.500000000000004 21.025 20-24 22.71 29.054999999999996 26.77 21.465 25-29 22.71 27.515 27.485 22.29 30-34 22.18 28.165000000000003 27.51 22.145 35-39 22.475 27.985 27.365000000000002 22.175 40-44 22.57 27.85 27.46 22.12 45-49 22.21 27.88 27.689999999999998 22.220000000000002 50-54 23.200000000000003 27.395000000000003 27.83 21.575 55-59 22.91 27.589999999999996 27.055 22.445 60-64 22.355 28.01 27.68 21.955 65-69 23.265 26.840000000000003 28.28 21.615000000000002 70-74 23.52 27.845 26.224999999999998 22.41 75-79 23.51 27.950000000000003 26.415 22.125 80-84 23.385 27.77 26.565 22.28 85-89 24.104999999999997 26.745 27.150000000000002 22.0 90-94 23.605 27.66 27.029999999999998 21.705 95-99 23.305 27.810000000000002 26.905 21.98 100-104 23.665 27.375 27.334999999999997 21.625 105-109 23.69 27.525 27.075 21.709999999999997 110-114 23.955000000000002 27.68 27.694999999999997 20.669999999999998 115-119 24.490000000000002 27.52 26.055 21.935 120-124 23.845 27.87 27.295 20.990000000000002 125-129 24.595 28.194999999999997 26.61 20.599999999999998 130-134 24.43 27.575 26.590000000000003 21.404999999999998 135-139 24.955 28.015 26.525 20.505000000000003 140-144 24.445 27.400000000000002 27.169999999999998 20.985 145-149 24.85 27.134999999999998 26.974999999999998 21.04 150-151 25.8125 27.712500000000002 26.424999999999997 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 2.5 25 4.5 26 6.0 27 5.5 28 7.0 29 9.0 30 12.5 31 13.0 32 15.5 33 26.0 34 37.5 35 52.5 36 77.5 37 101.5 38 115.5 39 134.0 40 168.0 41 190.5 42 239.5 43 280.5 44 271.5 45 258.5 46 262.0 47 269.5 48 252.0 49 241.0 50 205.5 51 159.0 52 123.5 53 90.0 54 80.0 55 65.0 56 53.0 57 46.5 58 30.5 59 18.0 60 17.0 61 18.0 62 9.5 63 6.0 64 4.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.07270693512305 80.525 2 8.612975391498882 15.4 3 1.034675615212528 2.775 4 0.13982102908277405 0.5 5 0.02796420581655481 0.125 6 0.05592841163310962 0.3 7 0.02796420581655481 0.17500000000000002 8 0.02796420581655481 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CTGATAACAAAATCCAAATCCAAAAAACACATAAATTAATCAGAAAATTT 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.0875000000000004 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.574999999999999 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGTC 10 0.006830828 145.0 2 TTGGTCT 10 0.006830828 145.0 3 >>END_MODULE Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589571 spots for SRR12917524.sra Written 589571 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra Read 589553 spots for SRR12917524.sra Written 589553 spots for SRR12917524.sra SRR ids: ['SRR12917524.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ghwnyiv5 SRR12917524.sra spots: 11791078 blocks: [[1, 589553], [589554, 1179106], [1179107, 1768659], [1768660, 2358212], [2358213, 2947765], [2947766, 3537318], [3537319, 4126871], [4126872, 4716424], [4716425, 5305977], [5305978, 5895530], [5895531, 6485083], [6485084, 7074636], [7074637, 7664189], [7664190, 8253742], [8253743, 8843295], [8843296, 9432848], [9432849, 10022401], [10022402, 10611954], [10611955, 11201507], [11201508, 11791078]] SRR12917524 file size 3985423 SRR12917524 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917524 SRR12917524_1.fastq SRR12917524_2.fastq Input file: SRR12917524_1.fastq Paired file: SRR12917524_2.fastq trimmed: SRR12917524-trimmed-pair1.fastq, SRR12917524-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:14:30 2025 >> started Thu Feb 13 12:14:43 2025 >> done (13.237s) 11791078 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 2091 ( 0.02%) empty read pairs filtered out after trimming by size control 11788941 (99.98%) read pairs available; of these: 784318 ( 6.65%) trimmed read pairs available after processing 11004623 (93.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 3 0.00% 22 10 0.00% 23 10 0.00% 24 10 0.00% 25 3 0.00% 26 10 0.00% 27 8 0.00% 28 8 0.00% 29 8 0.00% 30 11 0.00% 31 17 0.00% 32 12 0.00% 33 14 0.00% 34 7 0.00% 35 9 0.00% 36 13 0.00% 37 10 0.00% 38 18 0.00% 39 19 0.00% 40 14 0.00% 41 15 0.00% 42 25 0.00% 43 16 0.00% 44 12 0.00% 45 24 0.00% 46 29 0.00% 47 25 0.00% 48 34 0.00% 49 42 0.00% 50 53 0.00% 51 57 0.00% 52 69 0.00% 53 79 0.00% 54 82 0.00% 55 75 0.00% 56 121 0.00% 57 121 0.00% 58 133 0.00% 59 174 0.00% 60 173 0.00% 61 182 0.00% 62 293 0.00% 63 306 0.00% 64 328 0.00% 65 399 0.00% 66 382 0.00% 67 456 0.00% 68 456 0.00% 69 546 0.00% 70 682 0.01% 71 743 0.01% 72 829 0.01% 73 962 0.01% 74 1105 0.01% 75 1182 0.01% 76 1268 0.01% 77 1432 0.01% 78 1415 0.01% 79 1681 0.01% 80 1637 0.01% 81 1928 0.02% 82 2052 0.02% 83 2262 0.02% 84 2446 0.02% 85 2644 0.02% 86 2776 0.02% 87 2976 0.03% 88 2992 0.03% 89 3236 0.03% 90 3433 0.03% 91 3632 0.03% 92 3830 0.03% 93 3971 0.03% 94 4237 0.04% 95 4694 0.04% 96 4931 0.04% 97 5138 0.04% 98 5149 0.04% 99 5507 0.05% 100 5495 0.05% 101 5613 0.05% 102 5924 0.05% 103 6021 0.05% 104 6445 0.05% 105 6744 0.06% 106 7002 0.06% 107 7457 0.06% 108 7465 0.06% 109 7912 0.07% 110 7794 0.07% 111 8027 0.07% 112 8554 0.07% 113 8727 0.07% 114 8971 0.08% 115 9541 0.08% 116 9887 0.08% 117 10217 0.09% 118 10824 0.09% 119 10939 0.09% 120 11245 0.10% 121 11534 0.10% 122 11616 0.10% 123 11973 0.10% 124 12566 0.11% 125 12800 0.11% 126 13320 0.11% 127 13900 0.12% 128 14577 0.12% 129 14756 0.13% 130 15465 0.13% 131 15344 0.13% 132 15956 0.14% 133 16177 0.14% 134 16178 0.14% 135 16764 0.14% 136 17471 0.15% 137 18029 0.15% 138 18494 0.16% 139 19541 0.17% 140 19605 0.17% 141 20195 0.17% 142 20181 0.17% 143 20652 0.18% 144 21328 0.18% 145 21781 0.18% 146 22006 0.19% 147 22669 0.19% 148 23960 0.20% 149 23700 0.20% 150 25273 0.21% 151 11004623 93.35% 11788941 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.84 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=13.37 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=AAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=27 prefix-density=0.58 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=49.04 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.3 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12917524 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:15:25 Started mapping on | Feb 13 12:15:25 Finished on | Feb 13 12:16:35 Mapping speed, Million of reads per hour | 606.29 Number of input reads | 11788941 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11263911 Uniquely mapped reads % | 95.55% Average mapped length | 297.49 Number of splices: Total | 11401198 Number of splices: Annotated (sjdb) | 11169622 Number of splices: GT/AG | 11167418 Number of splices: GC/AG | 184082 Number of splices: AT/AC | 8569 Number of splices: Non-canonical | 41129 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271140 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 19225 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253890 253890 253890 N_multimapping 271140 271140 271140 N_noFeature 308010 11078374 357839 N_ambiguous 221068 720 84860 UnstrandedReadsAssigned:10734833 PositiveStrandReadsAssigned:184817 NegativeStrandReadsAssigned:10821212 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917524 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917524-trimmed-pair1.fastq SRR12917524-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,788,941 reads, 10,757,430 reads pseudoaligned [quant] estimated average fragment length: 281.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR12917524.ke.tsv 34699 SRR12917524.se.tsv 87100 total ==> SRR12917524.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.79 329 12.6876 Potri.005G024800.1.v4.1 1035 754.79 123 10.9209 Potri.004G059700.1.v4.1 961 680.961 46 4.52705 Potri.007G009000.2.v4.1 1416 1135.79 0 0 Potri.003G141000.2.v4.1 2943 2662.79 504 12.6845 Potri.016G087400.1.v4.1 270 75.5404 883 783.358 Potri.015G069301.1.v4.1 564 301.594 0 0 Potri.010G195200.1.v4.1 1773 1492.79 17 0.763184 Potri.012G127500.1.v4.1 977 696.889 128 12.3091 ==> SRR12917524.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12917524 completed mapping pipeline successfully