Starting /dee2/code/volunteer_pipeline.sh SRR12917525 current disk space = 3093189001216 free memory = 1380582784 SRR12917525 SRAfilesize a8aa61180f93e47af68a322fdfaee930 SRR12917525.sra SRR12917525.sra file validated SRR12917525 is paired end SRR12917525 is conventional basespace SRR12917525 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917525_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63125 37.0 37.0 37.0 37.0 37.0 2 36.5025 37.0 37.0 37.0 37.0 37.0 3 36.6275 37.0 37.0 37.0 37.0 37.0 4 36.6105 37.0 37.0 37.0 37.0 37.0 5 36.636 37.0 37.0 37.0 37.0 37.0 6 36.74 37.0 37.0 37.0 37.0 37.0 7 36.5695 37.0 37.0 37.0 37.0 37.0 8 36.643 37.0 37.0 37.0 37.0 37.0 9 36.684 37.0 37.0 37.0 37.0 37.0 10-14 36.6794 37.0 37.0 37.0 37.0 37.0 15-19 36.6285 37.0 37.0 37.0 37.0 37.0 20-24 36.625600000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.583999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5105 37.0 37.0 37.0 37.0 37.0 35-39 36.5457 37.0 37.0 37.0 37.0 37.0 40-44 36.51819999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.50019999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4948 37.0 37.0 37.0 37.0 37.0 55-59 36.4293 37.0 37.0 37.0 37.0 37.0 60-64 36.406000000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3061 37.0 37.0 37.0 37.0 37.0 70-74 36.3478 37.0 37.0 37.0 37.0 37.0 75-79 36.3642 37.0 37.0 37.0 37.0 37.0 80-84 36.3534 37.0 37.0 37.0 37.0 37.0 85-89 36.326100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.3075 37.0 37.0 37.0 37.0 37.0 95-99 36.2034 37.0 37.0 37.0 37.0 37.0 100-104 36.1834 37.0 37.0 37.0 37.0 37.0 105-109 36.1648 37.0 37.0 37.0 37.0 37.0 110-114 36.12910000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0322 37.0 37.0 37.0 37.0 37.0 120-124 36.069500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.982899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.956999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.8582 37.0 37.0 37.0 37.0 37.0 140-144 35.755 37.0 37.0 37.0 37.0 37.0 145-149 35.6037 37.0 37.0 37.0 37.0 37.0 150-151 35.33475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 0.0 24 1.0 25 1.0 26 5.0 27 5.0 28 7.0 29 23.0 30 16.0 31 30.0 32 44.0 33 77.0 34 96.0 35 296.0 36 3054.0 37 342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.353765323992995 14.610958218663997 5.32899674756067 41.706279709782336 2 19.025 12.425 37.6 30.95 3 16.900000000000002 15.725 26.450000000000003 40.925 4 21.65 22.2 23.825 32.324999999999996 5 24.0 29.475 23.9 22.625 6 21.55 33.425 23.05 21.975 7 16.325 29.099999999999998 38.05 16.525000000000002 8 16.575 27.725 33.7 22.0 9 17.474999999999998 24.275 35.05 23.200000000000003 10-14 19.82 30.75 27.935 21.495 15-19 20.105 28.24 27.955000000000002 23.7 20-24 20.44 28.83 27.405 23.325000000000003 25-29 20.265 28.335 27.525 23.875 30-34 20.06 29.025000000000002 27.365000000000002 23.549999999999997 35-39 20.595 27.98 27.595 23.830000000000002 40-44 20.1 29.515 26.974999999999998 23.41 45-49 20.65 28.565 26.919999999999998 23.865 50-54 19.955000000000002 28.765 26.974999999999998 24.305 55-59 20.705000000000002 28.22 27.205000000000002 23.87 60-64 20.669999999999998 28.439999999999998 27.279999999999998 23.61 65-69 20.895 29.195 26.355 23.555 70-74 21.224999999999998 28.970000000000002 26.445 23.36 75-79 20.535 28.54 27.04 23.885 80-84 20.97 27.935 26.99 24.104999999999997 85-89 20.225 28.955 27.105 23.715 90-94 21.25 27.705000000000002 27.38 23.665 95-99 20.76 27.47 27.560000000000002 24.21 100-104 20.735 28.244999999999997 27.425 23.595 105-109 21.224999999999998 28.125 26.985 23.665 110-114 21.349999999999998 28.444999999999997 26.845000000000002 23.36 115-119 21.305 27.67 27.3 23.724999999999998 120-124 20.775 28.54 26.455000000000002 24.23 125-129 21.240000000000002 27.474999999999998 27.310000000000002 23.974999999999998 130-134 21.01 27.950000000000003 26.729999999999997 24.310000000000002 135-139 21.705 27.71 26.825 23.76 140-144 22.245 27.235 26.145000000000003 24.375 145-149 21.64 27.644999999999996 27.045 23.669999999999998 150-151 22.125 28.4375 24.9375 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 0.5 25 2.5 26 6.0 27 7.5 28 9.0 29 13.0 30 23.5 31 33.0 32 36.5 33 49.0 34 65.5 35 86.0 36 92.5 37 97.0 38 112.0 39 139.0 40 175.5 41 194.0 42 202.5 43 215.5 44 230.0 45 257.0 46 267.0 47 245.0 48 226.5 49 210.5 50 186.5 51 153.0 52 126.5 53 118.5 54 107.5 55 81.5 56 58.0 57 39.0 58 31.5 59 27.5 60 19.0 61 13.5 62 12.0 63 6.5 64 1.5 65 3.0 66 4.5 67 3.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.85792349726776 84.05 2 7.213114754098362 13.200000000000001 3 0.7377049180327869 2.025 4 0.16393442622950818 0.6 5 0.0273224043715847 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.9124999999999996 0.0 0.0 0.0 0.0 114-115 3.2125 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 4.125 0.0 0.0 0.0 0.0 120-121 4.7125 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.2625 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.775 0.0 0.0 0.0 0.0 134-135 8.3875 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138-139 9.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917525 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917525_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.478 37.0 37.0 37.0 37.0 37.0 2 36.366 37.0 37.0 37.0 37.0 37.0 3 36.2905 37.0 37.0 37.0 37.0 37.0 4 36.368 37.0 37.0 37.0 37.0 37.0 5 36.4325 37.0 37.0 37.0 37.0 37.0 6 36.239 37.0 37.0 37.0 37.0 37.0 7 36.4345 37.0 37.0 37.0 37.0 37.0 8 36.4415 37.0 37.0 37.0 37.0 37.0 9 36.4625 37.0 37.0 37.0 37.0 37.0 10-14 36.3961 37.0 37.0 37.0 37.0 37.0 15-19 36.3463 37.0 37.0 37.0 37.0 37.0 20-24 36.34779999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.2691 37.0 37.0 37.0 37.0 37.0 30-34 36.196600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1254 37.0 37.0 37.0 37.0 37.0 40-44 36.130700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.075700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.087900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1041 37.0 37.0 37.0 37.0 37.0 60-64 36.1178 37.0 37.0 37.0 37.0 37.0 65-69 36.0326 37.0 37.0 37.0 37.0 37.0 70-74 36.026300000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.954899999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9539 37.0 37.0 37.0 37.0 37.0 85-89 36.0037 37.0 37.0 37.0 37.0 37.0 90-94 35.976600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.893299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8962 37.0 37.0 37.0 37.0 37.0 105-109 35.8447 37.0 37.0 37.0 37.0 37.0 110-114 35.795100000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7227 37.0 37.0 37.0 37.0 37.0 120-124 35.5584 37.0 37.0 37.0 37.0 37.0 125-129 35.562599999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5317 37.0 37.0 37.0 37.0 37.0 135-139 35.4339 37.0 37.0 37.0 37.0 37.0 140-144 35.223 37.0 37.0 37.0 29.8 37.0 145-149 35.1703 37.0 37.0 37.0 29.8 37.0 150-151 34.529250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 2.0 16 2.0 17 2.0 18 1.0 19 1.0 20 1.0 21 6.0 22 2.0 23 1.0 24 4.0 25 3.0 26 7.0 27 6.0 28 7.0 29 16.0 30 30.0 31 40.0 32 52.0 33 85.0 34 181.0 35 622.0 36 2751.0 37 172.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.900000000000006 27.075 9.375 29.65 2 25.775 26.650000000000002 31.900000000000002 15.675 3 19.25 29.5 33.575 17.675 4 23.075000000000003 32.7 24.275 19.950000000000003 5 25.4 36.225 21.4 16.975 6 20.775 39.975 21.975 17.275 7 20.825 23.65 36.775000000000006 18.75 8 21.575 26.525 28.225 23.674999999999997 9 22.95 24.474999999999998 29.475 23.1 10-14 23.799999999999997 28.310000000000002 26.25 21.64 15-19 23.385 28.425 27.005000000000003 21.185000000000002 20-24 23.255 28.26 27.07 21.415 25-29 23.575 27.51 26.5 22.415 30-34 23.385 27.605 27.884999999999998 21.125 35-39 23.535 27.815 27.255000000000003 21.395 40-44 23.745 27.67 26.755000000000003 21.83 45-49 23.575 28.060000000000002 26.865 21.5 50-54 23.685000000000002 27.32 27.58 21.415 55-59 23.68 27.985 26.995 21.34 60-64 24.0 27.115000000000002 27.27 21.615000000000002 65-69 23.785 26.795 27.744999999999997 21.675 70-74 24.404999999999998 27.145000000000003 26.900000000000002 21.55 75-79 23.755000000000003 27.12 27.224999999999998 21.9 80-84 23.805 27.744999999999997 27.275 21.175 85-89 24.085 27.089999999999996 26.91 21.915000000000003 90-94 24.325 27.175 27.275 21.224999999999998 95-99 23.98 27.555000000000003 27.215 21.25 100-104 24.11 27.825 27.26 20.805 105-109 23.94 27.884999999999998 27.405 20.77 110-114 24.495 27.775 27.095000000000002 20.635 115-119 25.330000000000002 27.029999999999998 26.369999999999997 21.27 120-124 24.605 28.09 26.805 20.5 125-129 24.88 27.889999999999997 26.155 21.075 130-134 25.8 27.279999999999998 27.095000000000002 19.825 135-139 25.435000000000002 27.575 26.855 20.135 140-144 26.56 27.375 26.46 19.605 145-149 26.99 27.16 26.455000000000002 19.395 150-151 27.1125 27.975 26.25 18.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 1.0 24 0.0 25 0.5 26 2.5 27 4.5 28 6.0 29 12.5 30 14.0 31 10.0 32 19.0 33 33.0 34 37.0 35 47.5 36 72.5 37 91.0 38 115.0 39 153.5 40 180.5 41 208.0 42 244.5 43 252.0 44 248.5 45 252.5 46 260.0 47 254.0 48 242.5 49 225.0 50 180.5 51 161.5 52 142.5 53 111.0 54 94.5 55 70.5 56 51.5 57 42.5 58 35.5 59 27.5 60 19.5 61 13.5 62 9.0 63 9.5 64 8.0 65 6.0 66 4.0 67 2.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 2.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.15899809420092 84.625 2 6.9697794718214 12.8 3 0.6806425265450585 1.875 4 0.19057990743261638 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.15 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.6625 0.0 0.0 0.0 0.0 118-119 4.175 0.0 0.0 0.0 0.0 120-121 4.75 0.0 0.0 0.0 0.0 122-123 5.325 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.2625 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.1625 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.3625 0.0 0.0 0.0 0.0 136-137 9.025 0.0 0.0 0.0 0.0 138-139 9.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489287 spots for SRR12917525.sra Written 489287 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra Read 489281 spots for SRR12917525.sra Written 489281 spots for SRR12917525.sra SRR ids: ['SRR12917525.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ny8veuwp SRR12917525.sra spots: 9785626 blocks: [[1, 489281], [489282, 978562], [978563, 1467843], [1467844, 1957124], [1957125, 2446405], [2446406, 2935686], [2935687, 3424967], [3424968, 3914248], [3914249, 4403529], [4403530, 4892810], [4892811, 5382091], [5382092, 5871372], [5871373, 6360653], [6360654, 6849934], [6849935, 7339215], [7339216, 7828496], [7828497, 8317777], [8317778, 8807058], [8807059, 9296339], [9296340, 9785626]] SRR12917525 file size 3304302 SRR12917525 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917525 SRR12917525_1.fastq SRR12917525_2.fastq Input file: SRR12917525_1.fastq Paired file: SRR12917525_2.fastq trimmed: SRR12917525-trimmed-pair1.fastq, SRR12917525-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:23:47 2025 >> started Thu Feb 13 11:23:59 2025 >> done (11.745s) 9785626 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 3469 ( 0.04%) empty read pairs filtered out after trimming by size control 9782125 (99.96%) read pairs available; of these: 1406618 (14.38%) trimmed read pairs available after processing 8375507 (85.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 4 0.00% 25 5 0.00% 26 7 0.00% 27 10 0.00% 28 11 0.00% 29 4 0.00% 30 11 0.00% 31 12 0.00% 32 18 0.00% 33 15 0.00% 34 13 0.00% 35 15 0.00% 36 17 0.00% 37 11 0.00% 38 16 0.00% 39 24 0.00% 40 18 0.00% 41 21 0.00% 42 35 0.00% 43 21 0.00% 44 25 0.00% 45 30 0.00% 46 34 0.00% 47 39 0.00% 48 32 0.00% 49 39 0.00% 50 55 0.00% 51 70 0.00% 52 87 0.00% 53 89 0.00% 54 109 0.00% 55 100 0.00% 56 115 0.00% 57 128 0.00% 58 151 0.00% 59 177 0.00% 60 231 0.00% 61 232 0.00% 62 269 0.00% 63 332 0.00% 64 366 0.00% 65 459 0.00% 66 444 0.00% 67 495 0.01% 68 598 0.01% 69 651 0.01% 70 763 0.01% 71 891 0.01% 72 987 0.01% 73 1151 0.01% 74 1339 0.01% 75 1517 0.02% 76 1644 0.02% 77 1869 0.02% 78 2008 0.02% 79 2141 0.02% 80 2410 0.02% 81 2652 0.03% 82 3057 0.03% 83 3331 0.03% 84 3773 0.04% 85 4195 0.04% 86 4502 0.05% 87 4814 0.05% 88 5060 0.05% 89 5287 0.05% 90 5692 0.06% 91 5944 0.06% 92 6443 0.07% 93 6943 0.07% 94 7677 0.08% 95 8163 0.08% 96 8674 0.09% 97 9412 0.10% 98 9533 0.10% 99 9873 0.10% 100 10265 0.10% 101 10647 0.11% 102 11017 0.11% 103 11611 0.12% 104 12026 0.12% 105 13021 0.13% 106 13867 0.14% 107 14461 0.15% 108 15135 0.15% 109 15406 0.16% 110 15590 0.16% 111 16013 0.16% 112 16872 0.17% 113 16864 0.17% 114 17692 0.18% 115 18421 0.19% 116 19801 0.20% 117 20180 0.21% 118 21134 0.22% 119 21320 0.22% 120 22186 0.23% 121 22551 0.23% 122 22929 0.23% 123 23383 0.24% 124 23941 0.24% 125 24244 0.25% 126 25683 0.26% 127 26400 0.27% 128 27179 0.28% 129 27921 0.29% 130 28844 0.29% 131 29218 0.30% 132 28969 0.30% 133 29984 0.31% 134 30038 0.31% 135 31012 0.32% 136 30929 0.32% 137 31866 0.33% 138 33200 0.34% 139 34127 0.35% 140 34598 0.35% 141 35093 0.36% 142 35328 0.36% 143 35730 0.37% 144 36114 0.37% 145 36021 0.37% 146 36789 0.38% 147 37029 0.38% 148 38579 0.39% 149 38471 0.39% 150 39515 0.40% 151 8375507 85.62% 9782125 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=37 prefix-density=0.43 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=28.85 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.7 sequence=TCAAATATATCGGTGACATCTAAGTTCAATGGGTGGTTTTTGTACATAGCAACAGCACTCTATGAGAAATCATAACGATCAGAGACATTACAAGTTCTAGTGATGATACAAAGGTTGCATCGACAAATACAAATATTTCAAGCTCCTTCCTTGATTAGGCAAGCATGTTCACCAGTGTTCCTCACTTGGGGGTGAAAGCAGAAAAAACGGTGGCATGACCAGGATCTGCAAGGTGAGCAAAGAGGTTGTCGATAGGACCAGTGCCAGTGTAAATGTGTTGGAACCAAGCACCCATGACAGCCAACATAGCCAA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.50 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=72.29 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.5 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12917525 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:24:44 Started mapping on | Feb 13 11:24:44 Finished on | Feb 13 11:26:00 Mapping speed, Million of reads per hour | 463.36 Number of input reads | 9782125 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9196821 Uniquely mapped reads % | 94.02% Average mapped length | 293.74 Number of splices: Total | 8453977 Number of splices: Annotated (sjdb) | 8269653 Number of splices: GT/AG | 8271365 Number of splices: GC/AG | 146454 Number of splices: AT/AC | 7433 Number of splices: Non-canonical | 28725 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244701 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 59974 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 340603 340603 340603 N_multimapping 244701 244701 244701 N_noFeature 256918 9031023 306861 N_ambiguous 180428 715 64227 UnstrandedReadsAssigned:8759475 PositiveStrandReadsAssigned:165083 NegativeStrandReadsAssigned:8825733 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917525 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917525-trimmed-pair1.fastq SRR12917525-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,782,125 reads, 8,836,307 reads pseudoaligned [quant] estimated average fragment length: 237.15 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52401 SRR12917525.ke.tsv 34699 SRR12917525.se.tsv 87100 total ==> SRR12917525.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.85 265 12.6344 Potri.005G024800.1.v4.1 1035 798.85 341 36.2635 Potri.004G059700.1.v4.1 961 724.923 84 9.84392 Potri.007G009000.2.v4.1 1416 1179.85 0 0 Potri.003G141000.2.v4.1 2943 2706.85 326 10.2314 Potri.016G087400.1.v4.1 270 90.1022 721 679.799 Potri.015G069301.1.v4.1 564 337.29 0 0 Potri.010G195200.1.v4.1 1773 1536.85 84 4.64332 Potri.012G127500.1.v4.1 977 740.909 1094 125.439 ==> SRR12917525.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12917525 completed mapping pipeline successfully