Starting /dee2/code/volunteer_pipeline.sh SRR12917526 current disk space = 3092365758464 free memory = 1580329468 SRR12917526 SRAfilesize 75447193894bb26a847667eb1cb09ff1 SRR12917526.sra SRR12917526.sra file validated SRR12917526 is paired end SRR12917526 is conventional basespace SRR12917526 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917526_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6095 37.0 37.0 37.0 37.0 37.0 2 36.553 37.0 37.0 37.0 37.0 37.0 3 36.6245 37.0 37.0 37.0 37.0 37.0 4 36.7355 37.0 37.0 37.0 37.0 37.0 5 36.738 37.0 37.0 37.0 37.0 37.0 6 36.6205 37.0 37.0 37.0 37.0 37.0 7 36.558 37.0 37.0 37.0 37.0 37.0 8 36.601 37.0 37.0 37.0 37.0 37.0 9 36.6325 37.0 37.0 37.0 37.0 37.0 10-14 36.611200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6332 37.0 37.0 37.0 37.0 37.0 20-24 36.5564 37.0 37.0 37.0 37.0 37.0 25-29 36.5548 37.0 37.0 37.0 37.0 37.0 30-34 36.48909999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4614 37.0 37.0 37.0 37.0 37.0 40-44 36.490500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4032 37.0 37.0 37.0 37.0 37.0 50-54 36.398199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3604 37.0 37.0 37.0 37.0 37.0 60-64 36.3164 37.0 37.0 37.0 37.0 37.0 65-69 36.2253 37.0 37.0 37.0 37.0 37.0 70-74 36.318200000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3399 37.0 37.0 37.0 37.0 37.0 80-84 36.2916 37.0 37.0 37.0 37.0 37.0 85-89 36.334199999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.30929999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.220400000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2195 37.0 37.0 37.0 37.0 37.0 105-109 36.150099999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.13269999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.038399999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0946 37.0 37.0 37.0 37.0 37.0 125-129 35.9397 37.0 37.0 37.0 37.0 37.0 130-134 35.9363 37.0 37.0 37.0 37.0 37.0 135-139 35.8115 37.0 37.0 37.0 37.0 37.0 140-144 35.607899999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.534800000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.3525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 3.0 24 3.0 25 5.0 26 1.0 27 7.0 28 11.0 29 27.0 30 15.0 31 36.0 32 42.0 33 61.0 34 120.0 35 315.0 36 3011.0 37 340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.896448224112056 13.606803401700851 7.678839419709855 35.81790895447724 2 21.125 12.375 33.75 32.75 3 18.75 16.075 29.049999999999997 36.125 4 22.15 21.525 24.975 31.35 5 25.174999999999997 29.599999999999998 23.925 21.3 6 21.8 32.6 23.025000000000002 22.575 7 14.674999999999999 27.700000000000003 40.525 17.1 8 18.025 26.8 32.1 23.075000000000003 9 17.2 26.0 33.775 23.025000000000002 10-14 19.564999999999998 31.2 27.38 21.855 15-19 19.86 29.24 27.295 23.605 20-24 19.68 29.53 27.33 23.46 25-29 20.205000000000002 28.115000000000002 27.605 24.075 30-34 19.42 29.535 27.22 23.825 35-39 20.39 29.044999999999998 26.22 24.345 40-44 20.47 29.880000000000003 26.35 23.3 45-49 20.53 28.955 26.58 23.935000000000002 50-54 20.57 28.63 27.235 23.565 55-59 20.255000000000003 28.76 26.955000000000002 24.03 60-64 19.975 29.225 26.895000000000003 23.905 65-69 20.549999999999997 28.560000000000002 26.825 24.065 70-74 20.805 28.96 26.46 23.775 75-79 20.7 27.91 26.919999999999998 24.47 80-84 20.375 28.555000000000003 27.29 23.78 85-89 20.419999999999998 28.32 27.1 24.16 90-94 20.74 28.175 26.765 24.32 95-99 20.77 27.800000000000004 27.055 24.375 100-104 20.97 28.33 26.455000000000002 24.245 105-109 21.745 28.82 26.005 23.43 110-114 21.345 28.360000000000003 26.889999999999997 23.405 115-119 21.404999999999998 28.235 26.275 24.085 120-124 21.36 28.634999999999998 25.775 24.23 125-129 21.29 28.15 26.009999999999998 24.55 130-134 21.785 27.915 25.585 24.715 135-139 22.3 27.92 25.755 24.025 140-144 21.959999999999997 28.03 25.385 24.625 145-149 21.4 27.62 25.790000000000003 25.19 150-151 21.762500000000003 28.462500000000002 24.875 24.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 3.0 25 5.5 26 3.0 27 5.5 28 9.5 29 14.0 30 23.0 31 33.0 32 40.0 33 52.5 34 61.5 35 73.0 36 102.5 37 114.5 38 128.5 39 145.0 40 173.5 41 214.5 42 200.5 43 194.5 44 223.0 45 222.0 46 207.0 47 215.5 48 225.5 49 224.5 50 208.5 51 175.0 52 147.5 53 126.0 54 100.5 55 79.5 56 61.5 57 47.0 58 41.5 59 30.0 60 17.5 61 10.5 62 7.0 63 5.0 64 3.0 65 4.0 66 5.0 67 2.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.74437739989028 83.625 2 7.048820625342842 12.85 3 1.0148107515085025 2.775 4 0.16456390565002743 0.6 5 0.0 0.0 6 0.027427317608337907 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACGGTCAATCTCGTAT 6 0.15 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.7875000000000001 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.1124999999999998 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.5125000000000002 0.0 0.0 0.0 0.0 96-97 1.7375 0.0 0.0 0.0 0.0 98-99 1.9874999999999998 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.45 0.0 0.0 0.0 0.0 104-105 2.675 0.0 0.0 0.0 0.0 106-107 3.0125 0.0 0.0 0.0 0.0 108-109 3.3499999999999996 0.0 0.0 0.0 0.0 110-111 3.675 0.0 0.0 0.0 0.0 112-113 4.237500000000001 0.0 0.0 0.0 0.0 114-115 4.825 0.0 0.0 0.0 0.0 116-117 5.3875 0.0 0.0 0.0 0.0 118-119 5.8625 0.0 0.0 0.0 0.0 120-121 6.35 0.0 0.0 0.0 0.0 122-123 6.9375 0.0 0.0 0.0 0.0 124-125 7.55 0.0 0.0 0.0 0.0 126-127 8.350000000000001 0.0 0.0 0.0 0.0 128-129 9.1375 0.0 0.0 0.0 0.0 130-131 9.9875 0.0 0.0 0.0 0.0 132-133 10.6875 0.0 0.0 0.0 0.0 134-135 11.2625 0.0 0.0 0.0 0.0 136-137 12.0375 0.0 0.0 0.0 0.0 138-139 12.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTATCA 10 0.006830828 145.0 145 TCGGAAG 65 0.0076375785 22.307692 145 CGGAAGA 55 0.0025160722 15.818182 140-144 ATCGGAA 75 0.0012377208 13.533334 140-144 >>END_MODULE SRR12917526 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917526_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3795 37.0 37.0 37.0 37.0 37.0 2 36.4565 37.0 37.0 37.0 37.0 37.0 3 36.322 37.0 37.0 37.0 37.0 37.0 4 36.463 37.0 37.0 37.0 37.0 37.0 5 36.4895 37.0 37.0 37.0 37.0 37.0 6 36.3275 37.0 37.0 37.0 37.0 37.0 7 36.4155 37.0 37.0 37.0 37.0 37.0 8 36.4715 37.0 37.0 37.0 37.0 37.0 9 36.4335 37.0 37.0 37.0 37.0 37.0 10-14 36.4593 37.0 37.0 37.0 37.0 37.0 15-19 36.4052 37.0 37.0 37.0 37.0 37.0 20-24 36.416999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.3231 37.0 37.0 37.0 37.0 37.0 30-34 36.2502 37.0 37.0 37.0 37.0 37.0 35-39 36.1922 37.0 37.0 37.0 37.0 37.0 40-44 36.2673 37.0 37.0 37.0 37.0 37.0 45-49 36.1478 37.0 37.0 37.0 37.0 37.0 50-54 36.1345 37.0 37.0 37.0 37.0 37.0 55-59 36.1314 37.0 37.0 37.0 37.0 37.0 60-64 36.166199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1135 37.0 37.0 37.0 37.0 37.0 70-74 36.0856 37.0 37.0 37.0 37.0 37.0 75-79 36.014300000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.0376 37.0 37.0 37.0 37.0 37.0 85-89 36.0736 37.0 37.0 37.0 37.0 37.0 90-94 36.0418 37.0 37.0 37.0 37.0 37.0 95-99 35.9936 37.0 37.0 37.0 37.0 37.0 100-104 35.994299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9576 37.0 37.0 37.0 37.0 37.0 110-114 35.888999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.8251 37.0 37.0 37.0 37.0 37.0 120-124 35.6881 37.0 37.0 37.0 37.0 37.0 125-129 35.6078 37.0 37.0 37.0 37.0 37.0 130-134 35.5806 37.0 37.0 37.0 37.0 37.0 135-139 35.4611 37.0 37.0 37.0 37.0 37.0 140-144 35.31079999999999 37.0 37.0 37.0 32.2 37.0 145-149 35.186 37.0 37.0 37.0 29.8 37.0 150-151 34.616 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 2.0 16 5.0 17 2.0 18 0.0 19 1.0 20 2.0 21 1.0 22 5.0 23 3.0 24 4.0 25 6.0 26 6.0 27 7.0 28 4.0 29 15.0 30 26.0 31 34.0 32 57.0 33 74.0 34 141.0 35 529.0 36 2832.0 37 238.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.5 24.125 10.85 25.525 2 29.025000000000002 25.324999999999996 28.65 17.0 3 21.975 28.575 31.275 18.175 4 25.1 32.175 22.525000000000002 20.200000000000003 5 26.85 35.199999999999996 21.55 16.400000000000002 6 21.725 38.15 21.425 18.7 7 22.925 22.0 35.975 19.1 8 23.150000000000002 26.275 26.5 24.075 9 24.7 22.55 29.925 22.825 10-14 24.685000000000002 28.455000000000002 25.645 21.215 15-19 24.705 27.229999999999997 27.229999999999997 20.835 20-24 23.955000000000002 27.529999999999998 26.900000000000002 21.615000000000002 25-29 24.455 27.505000000000003 26.655 21.385 30-34 24.385 27.525 26.63 21.46 35-39 23.915 27.485 26.905 21.695 40-44 24.495 27.134999999999998 27.389999999999997 20.979999999999997 45-49 24.64 27.24 27.284999999999997 20.835 50-54 24.990000000000002 26.58 27.265 21.165 55-59 24.425 26.495 27.38 21.7 60-64 24.455 26.595000000000002 27.565 21.385 65-69 24.4 26.44 27.73 21.43 70-74 24.995 26.69 27.455000000000002 20.86 75-79 24.610000000000003 26.515 27.485 21.39 80-84 24.16 27.860000000000003 26.71 21.27 85-89 24.85 27.36 26.590000000000003 21.2 90-94 24.64 27.815 26.555 20.990000000000002 95-99 24.445 27.615000000000002 26.965 20.974999999999998 100-104 24.745 27.150000000000002 27.27 20.835 105-109 24.47 27.3 27.24 20.990000000000002 110-114 24.57 28.17 27.11 20.150000000000002 115-119 25.535000000000004 27.315 26.745 20.405 120-124 25.22 27.595 26.740000000000002 20.445 125-129 26.36 27.584999999999997 26.115 19.939999999999998 130-134 26.534999999999997 27.36 26.669999999999998 19.435 135-139 26.43 28.225 25.624999999999996 19.72 140-144 27.529999999999998 27.450000000000003 26.035000000000004 18.985 145-149 27.925 27.265 25.759999999999998 19.05 150-151 27.750000000000004 27.4125 25.0375 19.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.5 28 3.0 29 5.5 30 7.5 31 8.5 32 15.0 33 25.0 34 44.0 35 64.5 36 65.0 37 76.5 38 106.5 39 128.0 40 161.5 41 182.5 42 198.5 43 226.5 44 242.5 45 252.0 46 268.0 47 270.5 48 252.5 49 247.5 50 218.0 51 185.0 52 162.5 53 126.0 54 97.5 55 84.0 56 73.0 57 47.0 58 31.5 59 30.0 60 20.5 61 13.0 62 8.0 63 4.0 64 3.0 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 1.5 71 1.0 72 0.5 73 1.5 74 1.0 75 0.5 76 0.5 77 1.0 78 1.0 79 0.0 80 1.0 81 1.5 82 1.0 83 0.5 84 0.0 85 0.5 86 1.0 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.5 99 2.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.51293220800436 84.95 2 6.4524911516471555 11.85 3 0.9256738361012796 2.55 4 0.054451402123604685 0.2 5 0.027225701061802342 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027225701061802342 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.4874999999999998 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 1.95 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.475 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.0375 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 114-115 4.875 0.0 0.0 0.0 0.0 116-117 5.4375 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.475 0.0 0.0 0.0 0.0 122-123 7.074999999999999 0.0 0.0 0.0 0.0 124-125 7.7 0.0 0.0 0.0 0.0 126-127 8.524999999999999 0.0 0.0 0.0 0.0 128-129 9.3125 0.0 0.0 0.0 0.0 130-131 10.1625 0.0 0.0 0.0 0.0 132-133 10.85 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.1875 0.0 0.0 0.0 0.0 138-139 13.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 65 0.0076375785 22.307692 145 CGGAAGA 55 0.0025160722 15.818182 140-144 ATCGGAA 65 4.1823133E-4 15.615384 140-144 >>END_MODULE Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra Read 509723 spots for SRR12917526.sra Written 509723 spots for SRR12917526.sra Read 509717 spots for SRR12917526.sra Written 509717 spots for SRR12917526.sra SRR ids: ['SRR12917526.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1_dpg8y1 SRR12917526.sra spots: 10194346 blocks: [[1, 509717], [509718, 1019434], [1019435, 1529151], [1529152, 2038868], [2038869, 2548585], [2548586, 3058302], [3058303, 3568019], [3568020, 4077736], [4077737, 4587453], [4587454, 5097170], [5097171, 5606887], [5606888, 6116604], [6116605, 6626321], [6626322, 7136038], [7136039, 7645755], [7645756, 8155472], [8155473, 8665189], [8665190, 9174906], [9174907, 9684623], [9684624, 10194346]] SRR12917526 file size 3442784 SRR12917526 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917526 SRR12917526_1.fastq SRR12917526_2.fastq Input file: SRR12917526_1.fastq Paired file: SRR12917526_2.fastq trimmed: SRR12917526-trimmed-pair1.fastq, SRR12917526-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:20:28 2025 >> started Thu Feb 13 12:20:39 2025 >> done (10.744s) 10194346 read pairs processed; of these: 41 ( 0.00%) short read pairs filtered out after trimming by size control 22826 ( 0.22%) empty read pairs filtered out after trimming by size control 10171479 (99.78%) read pairs available; of these: 1852094 (18.21%) trimmed read pairs available after processing 8319385 (81.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 10 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 12 0.00% 25 8 0.00% 26 19 0.00% 27 14 0.00% 28 15 0.00% 29 17 0.00% 30 17 0.00% 31 18 0.00% 32 18 0.00% 33 18 0.00% 34 13 0.00% 35 18 0.00% 36 12 0.00% 37 22 0.00% 38 29 0.00% 39 18 0.00% 40 29 0.00% 41 22 0.00% 42 36 0.00% 43 40 0.00% 44 42 0.00% 45 52 0.00% 46 52 0.00% 47 57 0.00% 48 60 0.00% 49 79 0.00% 50 89 0.00% 51 110 0.00% 52 125 0.00% 53 162 0.00% 54 144 0.00% 55 193 0.00% 56 204 0.00% 57 244 0.00% 58 281 0.00% 59 351 0.00% 60 436 0.00% 61 515 0.01% 62 530 0.01% 63 613 0.01% 64 777 0.01% 65 796 0.01% 66 945 0.01% 67 1028 0.01% 68 1134 0.01% 69 1327 0.01% 70 1587 0.02% 71 1735 0.02% 72 1969 0.02% 73 2319 0.02% 74 2642 0.03% 75 2909 0.03% 76 3249 0.03% 77 3388 0.03% 78 3639 0.04% 79 3946 0.04% 80 4239 0.04% 81 4727 0.05% 82 5425 0.05% 83 6002 0.06% 84 6488 0.06% 85 7193 0.07% 86 7563 0.07% 87 8071 0.08% 88 8504 0.08% 89 8601 0.08% 90 9128 0.09% 91 9599 0.09% 92 10311 0.10% 93 11117 0.11% 94 12207 0.12% 95 12731 0.13% 96 13249 0.13% 97 13937 0.14% 98 14390 0.14% 99 14665 0.14% 100 15424 0.15% 101 15646 0.15% 102 16318 0.16% 103 16846 0.17% 104 18313 0.18% 105 18634 0.18% 106 19996 0.20% 107 20572 0.20% 108 20882 0.21% 109 21797 0.21% 110 21881 0.22% 111 22491 0.22% 112 23230 0.23% 113 23608 0.23% 114 24479 0.24% 115 25644 0.25% 116 26687 0.26% 117 27434 0.27% 118 28601 0.28% 119 28584 0.28% 120 29522 0.29% 121 29740 0.29% 122 30064 0.30% 123 30924 0.30% 124 31331 0.31% 125 32596 0.32% 126 33185 0.33% 127 34345 0.34% 128 34976 0.34% 129 35747 0.35% 130 36527 0.36% 131 36279 0.36% 132 37120 0.36% 133 37678 0.37% 134 37836 0.37% 135 38416 0.38% 136 38941 0.38% 137 39808 0.39% 138 40885 0.40% 139 41648 0.41% 140 41631 0.41% 141 42340 0.42% 142 41898 0.41% 143 43009 0.42% 144 43346 0.43% 145 43391 0.43% 146 43683 0.43% 147 44073 0.43% 148 45222 0.44% 149 46175 0.45% 150 46386 0.46% 151 8319385 81.79% 10171479 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=0.74 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=44.01 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=3.1 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=27 prefix-density=0.61 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=56.60 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.7 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTATGGCGATGGTTGTTAGTGCACCTCTAGCAGAAGCTGCCATCTCATGCGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAGGCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAA SRR12917526 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:21:18 Started mapping on | Feb 13 12:21:18 Finished on | Feb 13 12:22:22 Mapping speed, Million of reads per hour | 572.15 Number of input reads | 10171479 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 9532736 Uniquely mapped reads % | 93.72% Average mapped length | 291.05 Number of splices: Total | 8135658 Number of splices: Annotated (sjdb) | 7993816 Number of splices: GT/AG | 7934542 Number of splices: GC/AG | 169860 Number of splices: AT/AC | 4377 Number of splices: Non-canonical | 26879 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.03% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312099 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 99655 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 326644 326644 326644 N_multimapping 312099 312099 312099 N_noFeature 213456 9356259 259232 N_ambiguous 210684 478 79760 UnstrandedReadsAssigned:9108596 PositiveStrandReadsAssigned:175999 NegativeStrandReadsAssigned:9193744 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917526 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917526-trimmed-pair1.fastq SRR12917526-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,171,479 reads, 9,305,778 reads pseudoaligned [quant] estimated average fragment length: 222.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR12917526.ke.tsv 34699 SRR12917526.se.tsv 87100 total ==> SRR12917526.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.25 141 6.60431 Potri.005G024800.1.v4.1 1035 813.248 293 30.3123 Potri.004G059700.1.v4.1 961 739.277 24 2.73136 Potri.007G009000.2.v4.1 1416 1194.25 0 0 Potri.003G141000.2.v4.1 2943 2721.25 302 9.33713 Potri.016G087400.1.v4.1 270 95.3435 484 427.099 Potri.015G069301.1.v4.1 564 348.294 0 0 Potri.010G195200.1.v4.1 1773 1551.25 18 0.976261 Potri.012G127500.1.v4.1 977 755.271 401 44.67 ==> SRR12917526.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 95 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 10 Potri.001G452600.v4.1 5 SRR12917526 completed mapping pipeline successfully