Starting /dee2/code/volunteer_pipeline.sh SRR12917527 current disk space = 3093486460928 free memory = 1384097464 SRR12917527 SRAfilesize 9a228bd4675d54a045d0050053be8247 SRR12917527.sra SRR12917527.sra file validated SRR12917527 is paired end SRR12917527 is conventional basespace SRR12917527 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57075 37.0 37.0 37.0 37.0 37.0 2 36.3405 37.0 37.0 37.0 37.0 37.0 3 36.5965 37.0 37.0 37.0 37.0 37.0 4 36.602 37.0 37.0 37.0 37.0 37.0 5 36.657 37.0 37.0 37.0 37.0 37.0 6 36.6565 37.0 37.0 37.0 37.0 37.0 7 36.5655 37.0 37.0 37.0 37.0 37.0 8 36.5835 37.0 37.0 37.0 37.0 37.0 9 36.632 37.0 37.0 37.0 37.0 37.0 10-14 36.6597 37.0 37.0 37.0 37.0 37.0 15-19 36.61370000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.58710000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.577299999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5563 37.0 37.0 37.0 37.0 37.0 35-39 36.5026 37.0 37.0 37.0 37.0 37.0 40-44 36.486900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4254 37.0 37.0 37.0 37.0 37.0 50-54 36.4427 37.0 37.0 37.0 37.0 37.0 55-59 36.3634 37.0 37.0 37.0 37.0 37.0 60-64 36.342200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2607 37.0 37.0 37.0 37.0 37.0 70-74 36.3412 37.0 37.0 37.0 37.0 37.0 75-79 36.3219 37.0 37.0 37.0 37.0 37.0 80-84 36.35359999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2954 37.0 37.0 37.0 37.0 37.0 90-94 36.307 37.0 37.0 37.0 37.0 37.0 95-99 36.2438 37.0 37.0 37.0 37.0 37.0 100-104 36.2097 37.0 37.0 37.0 37.0 37.0 105-109 36.1611 37.0 37.0 37.0 37.0 37.0 110-114 36.1439 37.0 37.0 37.0 37.0 37.0 115-119 36.061 37.0 37.0 37.0 37.0 37.0 120-124 36.1078 37.0 37.0 37.0 37.0 37.0 125-129 35.963100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9919 37.0 37.0 37.0 37.0 37.0 135-139 35.886799999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.835899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7599 37.0 37.0 37.0 37.0 37.0 150-151 35.553 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 2.0 24 1.0 25 2.0 26 3.0 27 7.0 28 8.0 29 16.0 30 17.0 31 34.0 32 36.0 33 70.0 34 116.0 35 298.0 36 3061.0 37 326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.28482120530133 13.928482120530134 6.451612903225806 40.33508377094274 2 18.8 12.225 37.275000000000006 31.7 3 16.45 15.25 27.825 40.475 4 21.7 20.925 24.775 32.6 5 23.25 28.000000000000004 24.2 24.55 6 21.224999999999998 32.324999999999996 22.25 24.2 7 14.799999999999999 31.374999999999996 38.05 15.775 8 16.475 27.400000000000002 32.65 23.474999999999998 9 17.424999999999997 25.95 34.475 22.15 10-14 19.55 29.15 28.525 22.775000000000002 15-19 19.595000000000002 27.894999999999996 27.625 24.884999999999998 20-24 19.84 28.939999999999998 27.18 24.04 25-29 20.25 28.515 27.339999999999996 23.895 30-34 20.02 27.88 27.595 24.505 35-39 20.59 28.075 27.26 24.075 40-44 19.744999999999997 28.470000000000002 27.775 24.01 45-49 20.255000000000003 28.560000000000002 27.415 23.77 50-54 20.46 28.455000000000002 27.150000000000002 23.935000000000002 55-59 19.485 28.975 26.779999999999998 24.759999999999998 60-64 20.075000000000003 28.775000000000002 27.215 23.935000000000002 65-69 20.34 28.060000000000002 27.875 23.724999999999998 70-74 20.75 28.144999999999996 27.365000000000002 23.74 75-79 20.195 27.83 27.534999999999997 24.44 80-84 20.36 29.17 26.825 23.645 85-89 20.355 28.27 27.725 23.65 90-94 20.544999999999998 28.055000000000003 27.095000000000002 24.305 95-99 20.71 27.66 27.375 24.255 100-104 20.575 28.46 26.979999999999997 23.985 105-109 20.47 27.900000000000002 27.589999999999996 24.04 110-114 21.154999999999998 28.275 26.93 23.64 115-119 21.36 27.02 27.715 23.905 120-124 21.095 27.860000000000003 27.034999999999997 24.01 125-129 20.96 27.55 27.310000000000002 24.18 130-134 21.385 27.74 26.87 24.005000000000003 135-139 20.255000000000003 28.46 26.915 24.37 140-144 21.834999999999997 27.49 26.77 23.905 145-149 21.33 27.665 26.640000000000004 24.365000000000002 150-151 21.462500000000002 26.924999999999997 26.5625 25.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.5 26 4.5 27 5.5 28 7.0 29 12.5 30 20.5 31 27.0 32 35.0 33 39.5 34 50.5 35 73.0 36 90.0 37 102.5 38 127.0 39 152.5 40 162.0 41 194.0 42 220.0 43 218.5 44 243.5 45 252.0 46 238.5 47 247.0 48 231.5 49 210.5 50 207.5 51 170.5 52 142.0 53 116.0 54 89.5 55 79.0 56 59.0 57 41.0 58 25.0 59 21.0 60 21.0 61 14.5 62 9.5 63 7.0 64 5.0 65 5.0 66 4.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.78112061827215 82.22500000000001 2 8.170024841291747 14.799999999999999 3 0.9108473640629312 2.475 4 0.1380071763731714 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTTC 10 0.006830828 145.0 3 CCTCCAT 20 3.5877043E-4 108.75 2 >>END_MODULE SRR12917527 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917527_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.404 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.3015 37.0 37.0 37.0 37.0 37.0 4 36.3965 37.0 37.0 37.0 37.0 37.0 5 36.3955 37.0 37.0 37.0 37.0 37.0 6 36.238 37.0 37.0 37.0 37.0 37.0 7 36.4315 37.0 37.0 37.0 37.0 37.0 8 36.3895 37.0 37.0 37.0 37.0 37.0 9 36.457 37.0 37.0 37.0 37.0 37.0 10-14 36.362399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3338 37.0 37.0 37.0 37.0 37.0 20-24 36.3027 37.0 37.0 37.0 37.0 37.0 25-29 36.196600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1428 37.0 37.0 37.0 37.0 37.0 35-39 36.119 37.0 37.0 37.0 37.0 37.0 40-44 36.1476 37.0 37.0 37.0 37.0 37.0 45-49 36.0261 37.0 37.0 37.0 37.0 37.0 50-54 36.0441 37.0 37.0 37.0 37.0 37.0 55-59 36.08819999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.0346 37.0 37.0 37.0 37.0 37.0 65-69 35.999900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0371 37.0 37.0 37.0 37.0 37.0 75-79 35.904900000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.916399999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9207 37.0 37.0 37.0 37.0 37.0 90-94 35.8725 37.0 37.0 37.0 37.0 37.0 95-99 35.8835 37.0 37.0 37.0 37.0 37.0 100-104 35.863699999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.8589 37.0 37.0 37.0 37.0 37.0 110-114 35.749199999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7134 37.0 37.0 37.0 37.0 37.0 120-124 35.6298 37.0 37.0 37.0 37.0 37.0 125-129 35.676700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5139 37.0 37.0 37.0 37.0 37.0 135-139 35.484500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.334 37.0 37.0 37.0 34.6 37.0 145-149 35.2054 37.0 37.0 37.0 29.8 37.0 150-151 34.7425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 2.0 16 6.0 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 3.0 23 3.0 24 3.0 25 5.0 26 11.0 27 8.0 28 14.0 29 15.0 30 25.0 31 43.0 32 67.0 33 82.0 34 179.0 35 600.0 36 2737.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75 25.424999999999997 9.950000000000001 26.875 2 28.95 26.6 28.425 16.025 3 20.575 28.599999999999998 31.724999999999998 19.1 4 23.875 33.85 23.825 18.45 5 26.55 37.175000000000004 20.150000000000002 16.125 6 21.275 39.725 20.674999999999997 18.325 7 20.974999999999998 23.849999999999998 37.425000000000004 17.75 8 20.349999999999998 26.924999999999997 27.775 24.95 9 21.725 23.849999999999998 30.275000000000002 24.15 10-14 23.51 29.455 25.905 21.13 15-19 23.669999999999998 28.199999999999996 26.784999999999997 21.345 20-24 23.91 28.645 26.334999999999997 21.11 25-29 23.29 27.49 27.544999999999998 21.675 30-34 23.115 27.615000000000002 27.47 21.8 35-39 23.425 27.445000000000004 27.32 21.81 40-44 23.44 27.42 27.265 21.875 45-49 23.275000000000002 27.955000000000002 27.33 21.44 50-54 23.01 27.939999999999998 27.38 21.67 55-59 23.985 26.93 27.215 21.87 60-64 23.025000000000002 28.475 27.139999999999997 21.36 65-69 24.22 27.465 26.99 21.325 70-74 23.87 26.865 27.16 22.105 75-79 24.41 26.745 27.29 21.555 80-84 24.425 27.43 27.155 20.990000000000002 85-89 23.985 27.169999999999998 27.32 21.525 90-94 24.45 27.1 26.865 21.584999999999997 95-99 24.175 27.655 27.115000000000002 21.055 100-104 24.355 27.800000000000004 27.11 20.735 105-109 24.275 27.500000000000004 27.36 20.865000000000002 110-114 24.275 27.46 27.22 21.044999999999998 115-119 24.745 27.860000000000003 26.945000000000004 20.45 120-124 25.2 27.295 27.22 20.285 125-129 24.955 27.794999999999998 26.534999999999997 20.715 130-134 25.525 27.295 27.02 20.16 135-139 25.305 27.975 26.275 20.445 140-144 26.029999999999998 28.025 26.305 19.64 145-149 26.36 27.11 26.790000000000003 19.74 150-151 26.75 26.900000000000002 26.900000000000002 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 1.0 26 3.0 27 4.5 28 4.0 29 7.0 30 7.5 31 8.5 32 13.0 33 28.0 34 55.0 35 64.0 36 67.5 37 91.0 38 107.0 39 127.5 40 168.0 41 209.5 42 240.0 43 260.0 44 264.0 45 256.0 46 261.0 47 272.0 48 249.5 49 219.0 50 193.5 51 157.5 52 142.5 53 128.5 54 95.0 55 64.5 56 47.5 57 41.5 58 31.5 59 23.0 60 24.5 61 14.5 62 4.5 63 3.5 64 3.0 65 2.5 66 2.0 67 1.5 68 2.0 69 2.5 70 1.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 90.80618442849254 82.22500000000001 2 8.144671452236334 14.75 3 0.9387078961899503 2.55 4 0.08282716731087797 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02760905577029266 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCAG 10 0.006830828 145.0 4 >>END_MODULE Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601752 spots for SRR12917527.sra Written 601752 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra Read 601740 spots for SRR12917527.sra Written 601740 spots for SRR12917527.sra SRR ids: ['SRR12917527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7db_9izw SRR12917527.sra spots: 12034812 blocks: [[1, 601740], [601741, 1203480], [1203481, 1805220], [1805221, 2406960], [2406961, 3008700], [3008701, 3610440], [3610441, 4212180], [4212181, 4813920], [4813921, 5415660], [5415661, 6017400], [6017401, 6619140], [6619141, 7220880], [7220881, 7822620], [7822621, 8424360], [8424361, 9026100], [9026101, 9627840], [9627841, 10229580], [10229581, 10831320], [10831321, 11433060], [11433061, 12034812]] SRR12917527 file size 4068255 SRR12917527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917527 SRR12917527_1.fastq SRR12917527_2.fastq Input file: SRR12917527_1.fastq Paired file: SRR12917527_2.fastq trimmed: SRR12917527-trimmed-pair1.fastq, SRR12917527-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:36:14 2025 >> started Thu Feb 13 11:36:28 2025 >> done (13.744s) 12034812 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 6322 ( 0.05%) empty read pairs filtered out after trimming by size control 12028439 (99.95%) read pairs available; of these: 1212587 (10.08%) trimmed read pairs available after processing 10815852 (89.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 9 0.00% 24 6 0.00% 25 17 0.00% 26 10 0.00% 27 11 0.00% 28 15 0.00% 29 15 0.00% 30 5 0.00% 31 19 0.00% 32 14 0.00% 33 17 0.00% 34 13 0.00% 35 19 0.00% 36 16 0.00% 37 17 0.00% 38 16 0.00% 39 9 0.00% 40 21 0.00% 41 19 0.00% 42 18 0.00% 43 18 0.00% 44 18 0.00% 45 27 0.00% 46 32 0.00% 47 22 0.00% 48 37 0.00% 49 30 0.00% 50 45 0.00% 51 59 0.00% 52 62 0.00% 53 64 0.00% 54 60 0.00% 55 66 0.00% 56 74 0.00% 57 92 0.00% 58 114 0.00% 59 127 0.00% 60 152 0.00% 61 194 0.00% 62 233 0.00% 63 263 0.00% 64 284 0.00% 65 338 0.00% 66 390 0.00% 67 373 0.00% 68 428 0.00% 69 491 0.00% 70 564 0.00% 71 672 0.01% 72 876 0.01% 73 931 0.01% 74 1027 0.01% 75 1107 0.01% 76 1321 0.01% 77 1454 0.01% 78 1485 0.01% 79 1742 0.01% 80 1847 0.02% 81 2192 0.02% 82 2337 0.02% 83 2694 0.02% 84 2858 0.02% 85 3196 0.03% 86 3526 0.03% 87 3814 0.03% 88 3960 0.03% 89 4101 0.03% 90 4419 0.04% 91 4803 0.04% 92 5070 0.04% 93 5468 0.05% 94 6101 0.05% 95 6559 0.05% 96 6998 0.06% 97 7223 0.06% 98 7725 0.06% 99 7815 0.06% 100 7993 0.07% 101 8268 0.07% 102 8794 0.07% 103 9195 0.08% 104 9996 0.08% 105 10562 0.09% 106 11091 0.09% 107 11584 0.10% 108 11862 0.10% 109 12425 0.10% 110 12722 0.11% 111 12882 0.11% 112 13210 0.11% 113 13803 0.11% 114 14825 0.12% 115 15092 0.13% 116 15619 0.13% 117 16620 0.14% 118 17449 0.15% 119 17908 0.15% 120 18309 0.15% 121 18702 0.16% 122 19111 0.16% 123 19649 0.16% 124 20267 0.17% 125 20569 0.17% 126 21693 0.18% 127 22553 0.19% 128 23633 0.20% 129 24022 0.20% 130 24623 0.20% 131 24701 0.21% 132 25555 0.21% 133 26049 0.22% 134 26465 0.22% 135 26971 0.22% 136 28032 0.23% 137 28381 0.24% 138 29686 0.25% 139 31056 0.26% 140 30936 0.26% 141 31735 0.26% 142 32075 0.27% 143 32357 0.27% 144 33243 0.28% 145 33613 0.28% 146 34057 0.28% 147 34632 0.29% 148 36033 0.30% 149 36096 0.30% 150 37597 0.31% 151 10815852 89.92% 12028439 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=45.48 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=84.67 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12917527 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:37:11 Started mapping on | Feb 13 11:37:11 Finished on | Feb 13 11:38:23 Mapping speed, Million of reads per hour | 601.42 Number of input reads | 12028439 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11448474 Uniquely mapped reads % | 95.18% Average mapped length | 296.07 Number of splices: Total | 11027179 Number of splices: Annotated (sjdb) | 10836984 Number of splices: GT/AG | 10786905 Number of splices: GC/AG | 202552 Number of splices: AT/AC | 8521 Number of splices: Non-canonical | 29201 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287425 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 83394 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 292540 292540 292540 N_multimapping 287425 287425 287425 N_noFeature 273860 11272769 319931 N_ambiguous 205028 657 75036 UnstrandedReadsAssigned:10969586 PositiveStrandReadsAssigned:175048 NegativeStrandReadsAssigned:11053507 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917527 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917527-trimmed-pair1.fastq SRR12917527-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,028,439 reads, 11,103,203 reads pseudoaligned [quant] estimated average fragment length: 257.183 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12917527.ke.tsv 34699 SRR12917527.se.tsv 87100 total ==> SRR12917527.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.82 209 8.67789 Potri.005G024800.1.v4.1 1035 778.817 177 16.6252 Potri.004G059700.1.v4.1 961 704.919 180 18.6794 Potri.007G009000.2.v4.1 1416 1159.82 0 0 Potri.003G141000.2.v4.1 2943 2686.82 490 13.3409 Potri.016G087400.1.v4.1 270 83.5539 690 604.103 Potri.015G069301.1.v4.1 564 321.111 0 0 Potri.010G195200.1.v4.1 1773 1516.82 7 0.337593 Potri.012G127500.1.v4.1 977 720.853 649 65.8607 ==> SRR12917527.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 293 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR12917527 completed mapping pipeline successfully