Starting /dee2/code/volunteer_pipeline.sh SRR12917528 current disk space = 3093367943168 free memory = 1403453228 SRR12917528 SRAfilesize bc306f7095961f0236cc4d7193b9b222 SRR12917528.sra SRR12917528.sra file validated SRR12917528 is paired end SRR12917528 is conventional basespace SRR12917528 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.606 37.0 37.0 37.0 37.0 37.0 2 36.538 37.0 37.0 37.0 37.0 37.0 3 36.6045 37.0 37.0 37.0 37.0 37.0 4 36.6455 37.0 37.0 37.0 37.0 37.0 5 36.685 37.0 37.0 37.0 37.0 37.0 6 36.7075 37.0 37.0 37.0 37.0 37.0 7 36.5745 37.0 37.0 37.0 37.0 37.0 8 36.603 37.0 37.0 37.0 37.0 37.0 9 36.671 37.0 37.0 37.0 37.0 37.0 10-14 36.625099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.611399999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5865 37.0 37.0 37.0 37.0 37.0 25-29 36.5633 37.0 37.0 37.0 37.0 37.0 30-34 36.5212 37.0 37.0 37.0 37.0 37.0 35-39 36.4923 37.0 37.0 37.0 37.0 37.0 40-44 36.506299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.441199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.506899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.41479999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.4017 37.0 37.0 37.0 37.0 37.0 65-69 36.3604 37.0 37.0 37.0 37.0 37.0 70-74 36.33539999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.37259999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3547 37.0 37.0 37.0 37.0 37.0 85-89 36.374900000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2972 37.0 37.0 37.0 37.0 37.0 95-99 36.2923 37.0 37.0 37.0 37.0 37.0 100-104 36.2718 37.0 37.0 37.0 37.0 37.0 105-109 36.1881 37.0 37.0 37.0 37.0 37.0 110-114 36.158100000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.1175 37.0 37.0 37.0 37.0 37.0 120-124 36.124199999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0246 37.0 37.0 37.0 37.0 37.0 130-134 35.954699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9688 37.0 37.0 37.0 37.0 37.0 140-144 35.797599999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.796499999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.49550000000001 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 1.0 25 0.0 26 6.0 27 2.0 28 6.0 29 14.0 30 25.0 31 29.0 32 38.0 33 65.0 34 102.0 35 316.0 36 3067.0 37 327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.225 12.925 6.375 41.475 2 18.825 12.475 37.65 31.05 3 17.5 15.299999999999999 27.525 39.675 4 21.575 22.125 23.925 32.375 5 24.4 29.099999999999998 23.45 23.05 6 19.775000000000002 33.050000000000004 23.625 23.549999999999997 7 15.4 28.999999999999996 39.925 15.675 8 17.5 27.325 31.25 23.925 9 17.375 24.975 35.475 22.175 10-14 19.675 30.214999999999996 27.405 22.705000000000002 15-19 19.955000000000002 28.88 27.26 23.905 20-24 20.03 29.330000000000002 26.745 23.895 25-29 20.19 28.71 27.389999999999997 23.71 30-34 20.275000000000002 28.244999999999997 27.99 23.49 35-39 20.24 28.52 27.325 23.915 40-44 20.86 28.505000000000003 27.139999999999997 23.494999999999997 45-49 20.195 28.660000000000004 27.105 24.04 50-54 19.994999999999997 28.205000000000002 27.33 24.47 55-59 20.3 29.14 27.060000000000002 23.5 60-64 20.8 28.27 26.779999999999998 24.15 65-69 20.28 28.285 27.145000000000003 24.29 70-74 20.76 27.805000000000003 27.694999999999997 23.74 75-79 20.19 27.894999999999996 27.900000000000002 24.015 80-84 20.73 28.715000000000003 27.24 23.315 85-89 20.66 28.645 27.034999999999997 23.66 90-94 20.785 28.18 27.200000000000003 23.835 95-99 21.005 27.88 26.8 24.315 100-104 21.63 28.68 26.295 23.395 105-109 20.549999999999997 28.475 27.55 23.425 110-114 20.82 27.839999999999996 27.169999999999998 24.169999999999998 115-119 21.224999999999998 28.055000000000003 27.165 23.555 120-124 20.93 28.485 26.424999999999997 24.16 125-129 20.825 28.33 26.905 23.94 130-134 20.86 28.225 26.634999999999998 24.279999999999998 135-139 20.599999999999998 27.88 26.465 25.055 140-144 21.355 27.615000000000002 26.424999999999997 24.605 145-149 20.82 27.83 26.685 24.665 150-151 19.9875 27.125 27.175 25.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 3.0 25 5.0 26 5.5 27 6.5 28 7.0 29 10.0 30 14.5 31 25.5 32 34.0 33 45.0 34 64.0 35 78.0 36 96.0 37 103.0 38 111.0 39 142.5 40 172.0 41 190.5 42 214.0 43 213.5 44 230.0 45 264.5 46 263.5 47 248.5 48 224.5 49 208.0 50 189.0 51 173.5 52 152.0 53 108.0 54 87.0 55 87.5 56 62.0 57 36.0 58 31.0 59 28.5 60 22.0 61 14.5 62 10.0 63 4.0 64 1.5 65 1.0 66 2.0 67 1.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.73508483853311 83.8 2 7.224958949096879 13.200000000000001 3 0.875752599890531 2.4 4 0.16420361247947454 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.1375000000000002 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.45 0.0 0.0 0.0 0.0 116-117 3.9625 0.0 0.0 0.0 0.0 118-119 4.325 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.387499999999999 0.0 0.0 0.0 0.0 124-125 5.8375 0.0 0.0 0.0 0.0 126-127 6.425 0.0 0.0 0.0 0.0 128-129 6.9 0.0 0.0 0.0 0.0 130-131 7.5 0.0 0.0 0.0 0.0 132-133 8.0125 0.0 0.0 0.0 0.0 134-135 8.6875 0.0 0.0 0.0 0.0 136-137 9.3125 0.0 0.0 0.0 0.0 138-139 10.149999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917528 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917528_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3945 37.0 37.0 37.0 37.0 37.0 2 36.2465 37.0 37.0 37.0 37.0 37.0 3 36.291 37.0 37.0 37.0 37.0 37.0 4 36.3125 37.0 37.0 37.0 37.0 37.0 5 36.428 37.0 37.0 37.0 37.0 37.0 6 36.2705 37.0 37.0 37.0 37.0 37.0 7 36.345 37.0 37.0 37.0 37.0 37.0 8 36.49 37.0 37.0 37.0 37.0 37.0 9 36.3345 37.0 37.0 37.0 37.0 37.0 10-14 36.3946 37.0 37.0 37.0 37.0 37.0 15-19 36.3802 37.0 37.0 37.0 37.0 37.0 20-24 36.3369 37.0 37.0 37.0 37.0 37.0 25-29 36.2624 37.0 37.0 37.0 37.0 37.0 30-34 36.170300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1526 37.0 37.0 37.0 37.0 37.0 40-44 36.1882 37.0 37.0 37.0 37.0 37.0 45-49 36.1171 37.0 37.0 37.0 37.0 37.0 50-54 36.09780000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.075599999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0812 37.0 37.0 37.0 37.0 37.0 65-69 36.0992 37.0 37.0 37.0 37.0 37.0 70-74 36.0262 37.0 37.0 37.0 37.0 37.0 75-79 36.009699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0278 37.0 37.0 37.0 37.0 37.0 85-89 36.0129 37.0 37.0 37.0 37.0 37.0 90-94 35.972500000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.94089999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9178 37.0 37.0 37.0 37.0 37.0 105-109 35.919200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8684 37.0 37.0 37.0 37.0 37.0 115-119 35.8132 37.0 37.0 37.0 37.0 37.0 120-124 35.759299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7289 37.0 37.0 37.0 37.0 37.0 130-134 35.624100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.565099999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.4582 37.0 37.0 37.0 34.6 37.0 145-149 35.35379999999999 37.0 37.0 37.0 32.2 37.0 150-151 34.90575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 7.0 15 1.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 3.0 22 4.0 23 2.0 24 1.0 25 7.0 26 4.0 27 6.0 28 11.0 29 19.0 30 26.0 31 30.0 32 52.0 33 83.0 34 181.0 35 549.0 36 2802.0 37 208.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.875 25.374999999999996 9.65 29.099999999999998 2 28.025 25.3 30.4 16.275000000000002 3 20.3 27.425 33.475 18.8 4 23.925 32.300000000000004 25.0 18.775 5 25.95 36.199999999999996 21.975 15.875 6 21.525 39.975 22.05 16.45 7 22.3 21.8 38.824999999999996 17.075000000000003 8 21.6 26.174999999999997 28.849999999999998 23.375 9 21.9 25.074999999999996 30.55 22.475 10-14 23.474999999999998 29.07 26.11 21.345 15-19 23.465 27.544999999999998 27.87 21.12 20-24 23.225 28.7 26.855 21.22 25-29 23.14 27.685 27.485 21.69 30-34 22.900000000000002 28.605000000000004 27.029999999999998 21.465 35-39 23.385 27.229999999999997 27.515 21.87 40-44 23.200000000000003 27.875 27.875 21.05 45-49 22.925 27.525 27.500000000000004 22.05 50-54 23.175 27.685 27.595 21.545 55-59 22.985 27.875 27.534999999999997 21.605 60-64 23.745 27.38 26.82 22.055 65-69 23.865 27.74 27.084999999999997 21.310000000000002 70-74 23.71 28.01 26.845000000000002 21.435000000000002 75-79 23.685000000000002 27.534999999999997 27.305 21.475 80-84 23.685000000000002 27.3 27.195000000000004 21.82 85-89 23.84 27.495000000000005 26.99 21.675 90-94 23.91 27.655 27.384999999999998 21.05 95-99 23.810000000000002 28.01 26.88 21.3 100-104 24.15 27.310000000000002 27.3 21.240000000000002 105-109 23.51 27.474999999999998 27.685 21.33 110-114 24.385 27.435 27.505000000000003 20.674999999999997 115-119 24.195 27.54 27.05 21.215 120-124 24.404999999999998 28.050000000000004 26.795 20.75 125-129 24.915000000000003 28.050000000000004 26.0 21.035 130-134 25.495 27.67 26.325 20.51 135-139 25.564999999999998 27.24 26.43 20.765 140-144 25.745 27.62 26.840000000000003 19.794999999999998 145-149 25.874999999999996 27.029999999999998 26.83 20.265 150-151 26.125 27.625 25.5375 20.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 4.5 27 5.0 28 8.0 29 10.5 30 8.0 31 10.5 32 18.5 33 28.5 34 40.5 35 60.5 36 81.5 37 118.5 38 135.5 39 133.5 40 167.5 41 204.5 42 234.5 43 272.0 44 272.5 45 240.5 46 254.0 47 263.5 48 228.0 49 211.5 50 194.0 51 145.5 52 123.5 53 107.5 54 94.0 55 83.5 56 58.5 57 48.5 58 36.0 59 26.5 60 20.5 61 11.5 62 6.5 63 3.0 64 2.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 1.0 72 1.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80643387407204 83.475 2 6.928787462194117 12.6 3 0.962331591971405 2.625 4 0.192466318394281 0.7000000000000001 5 0.08248556502612042 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027495188342040146 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCAACCTTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.45 0.0 0.0 0.0 0.0 116-117 3.9875 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.8 0.0 0.0 0.0 0.0 122-123 5.4125 0.0 0.0 0.0 0.0 124-125 5.862500000000001 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 6.9125 0.0 0.0 0.0 0.0 130-131 7.525 0.0 0.0 0.0 0.0 132-133 8.025 0.0 0.0 0.0 0.0 134-135 8.65 0.0 0.0 0.0 0.0 136-137 9.2375 0.0 0.0 0.0 0.0 138-139 10.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTTG 10 0.006830828 145.0 5 ATAGAGG 10 0.006830828 145.0 8 AAAAAAA 55 0.0025160722 15.818182 30-34 >>END_MODULE Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331381 spots for SRR12917528.sra Written 331381 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra Read 331380 spots for SRR12917528.sra Written 331380 spots for SRR12917528.sra SRR ids: ['SRR12917528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lh9rj_3y SRR12917528.sra spots: 6627601 blocks: [[1, 331380], [331381, 662760], [662761, 994140], [994141, 1325520], [1325521, 1656900], [1656901, 1988280], [1988281, 2319660], [2319661, 2651040], [2651041, 2982420], [2982421, 3313800], [3313801, 3645180], [3645181, 3976560], [3976561, 4307940], [4307941, 4639320], [4639321, 4970700], [4970701, 5302080], [5302081, 5633460], [5633461, 5964840], [5964841, 6296220], [6296221, 6627601]] SRR12917528 file size 2237235 SRR12917528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917528 SRR12917528_1.fastq SRR12917528_2.fastq Input file: SRR12917528_1.fastq Paired file: SRR12917528_2.fastq trimmed: SRR12917528-trimmed-pair1.fastq, SRR12917528-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:39:14 2025 >> started Thu Feb 13 11:39:22 2025 >> done (7.778s) 6627601 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 2293 ( 0.03%) empty read pairs filtered out after trimming by size control 6625272 (99.96%) read pairs available; of these: 900680 (13.59%) trimmed read pairs available after processing 5724592 (86.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 7 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 10 0.00% 27 10 0.00% 28 12 0.00% 29 2 0.00% 30 4 0.00% 31 9 0.00% 32 12 0.00% 33 6 0.00% 34 13 0.00% 35 3 0.00% 36 10 0.00% 37 14 0.00% 38 8 0.00% 39 11 0.00% 40 11 0.00% 41 13 0.00% 42 19 0.00% 43 23 0.00% 44 14 0.00% 45 20 0.00% 46 17 0.00% 47 17 0.00% 48 19 0.00% 49 24 0.00% 50 39 0.00% 51 41 0.00% 52 49 0.00% 53 49 0.00% 54 51 0.00% 55 70 0.00% 56 64 0.00% 57 90 0.00% 58 75 0.00% 59 101 0.00% 60 129 0.00% 61 182 0.00% 62 210 0.00% 63 215 0.00% 64 212 0.00% 65 240 0.00% 66 319 0.00% 67 324 0.00% 68 380 0.01% 69 365 0.01% 70 525 0.01% 71 529 0.01% 72 665 0.01% 73 782 0.01% 74 855 0.01% 75 962 0.01% 76 1078 0.02% 77 1202 0.02% 78 1267 0.02% 79 1323 0.02% 80 1467 0.02% 81 1709 0.03% 82 1925 0.03% 83 2135 0.03% 84 2437 0.04% 85 2744 0.04% 86 2936 0.04% 87 3076 0.05% 88 3289 0.05% 89 3517 0.05% 90 3696 0.06% 91 3774 0.06% 92 4118 0.06% 93 4506 0.07% 94 4852 0.07% 95 5397 0.08% 96 5751 0.09% 97 6049 0.09% 98 6314 0.10% 99 6414 0.10% 100 6644 0.10% 101 6863 0.10% 102 7318 0.11% 103 7375 0.11% 104 8037 0.12% 105 8398 0.13% 106 9057 0.14% 107 9493 0.14% 108 9503 0.14% 109 9861 0.15% 110 9951 0.15% 111 10233 0.15% 112 10577 0.16% 113 10999 0.17% 114 11631 0.18% 115 11943 0.18% 116 12675 0.19% 117 13164 0.20% 118 13680 0.21% 119 13769 0.21% 120 14138 0.21% 121 14551 0.22% 122 14571 0.22% 123 14930 0.23% 124 15426 0.23% 125 15828 0.24% 126 16605 0.25% 127 16880 0.25% 128 17239 0.26% 129 17878 0.27% 130 18124 0.27% 131 18431 0.28% 132 18441 0.28% 133 18724 0.28% 134 19222 0.29% 135 19268 0.29% 136 19933 0.30% 137 20656 0.31% 138 20855 0.31% 139 21589 0.33% 140 21957 0.33% 141 22364 0.34% 142 22398 0.34% 143 22369 0.34% 144 22784 0.34% 145 23088 0.35% 146 23371 0.35% 147 23822 0.36% 148 24622 0.37% 149 25013 0.38% 150 25606 0.39% 151 5724592 86.41% 6625272 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=140.18 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.92 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=112.50 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12917528 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:40:12 Started mapping on | Feb 13 11:40:12 Finished on | Feb 13 11:41:06 Mapping speed, Million of reads per hour | 441.68 Number of input reads | 6625272 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 6275634 Uniquely mapped reads % | 94.72% Average mapped length | 294.17 Number of splices: Total | 6131439 Number of splices: Annotated (sjdb) | 6025764 Number of splices: GT/AG | 5999215 Number of splices: GC/AG | 104692 Number of splices: AT/AC | 4012 Number of splices: Non-canonical | 23520 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 157392 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 27943 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 192246 192246 192246 N_multimapping 157392 157392 157392 N_noFeature 150697 6161237 183328 N_ambiguous 122258 403 40232 UnstrandedReadsAssigned:6002679 PositiveStrandReadsAssigned:113994 NegativeStrandReadsAssigned:6052074 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917528 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917528-trimmed-pair1.fastq SRR12917528-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,625,272 reads, 6,060,157 reads pseudoaligned [quant] estimated average fragment length: 245.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR12917528.ke.tsv 34699 SRR12917528.se.tsv 87100 total ==> SRR12917528.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.95 139 9.98422 Potri.005G024800.1.v4.1 1035 790.95 209 33.6696 Potri.004G059700.1.v4.1 961 717.023 18 3.19875 Potri.007G009000.2.v4.1 1416 1171.95 0 0 Potri.003G141000.2.v4.1 2943 2698.95 276 13.0303 Potri.016G087400.1.v4.1 270 89.342 430 613.273 Potri.015G069301.1.v4.1 564 331.495 0 0 Potri.010G195200.1.v4.1 1773 1528.95 21 1.75012 Potri.012G127500.1.v4.1 977 732.987 174 30.2478 ==> SRR12917528.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 73 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12917528 completed mapping pipeline successfully