Starting /dee2/code/volunteer_pipeline.sh SRR12917529 current disk space = 3093137539072 free memory = 1449762344 SRR12917529 SRAfilesize af306e5b2d0832c8656628954d10afa8 SRR12917529.sra SRR12917529.sra file validated SRR12917529 is paired end SRR12917529 is conventional basespace SRR12917529 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917529_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.698 37.0 37.0 37.0 37.0 37.0 2 36.5465 37.0 37.0 37.0 37.0 37.0 3 36.595 37.0 37.0 37.0 37.0 37.0 4 36.7125 37.0 37.0 37.0 37.0 37.0 5 36.691 37.0 37.0 37.0 37.0 37.0 6 36.7705 37.0 37.0 37.0 37.0 37.0 7 36.5875 37.0 37.0 37.0 37.0 37.0 8 36.621 37.0 37.0 37.0 37.0 37.0 9 36.64 37.0 37.0 37.0 37.0 37.0 10-14 36.6454 37.0 37.0 37.0 37.0 37.0 15-19 36.6032 37.0 37.0 37.0 37.0 37.0 20-24 36.5707 37.0 37.0 37.0 37.0 37.0 25-29 36.538 37.0 37.0 37.0 37.0 37.0 30-34 36.431799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.434000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4331 37.0 37.0 37.0 37.0 37.0 45-49 36.2347 37.0 37.0 37.0 37.0 37.0 50-54 36.341 37.0 37.0 37.0 37.0 37.0 55-59 36.144600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.160799999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0519 37.0 37.0 37.0 37.0 37.0 70-74 36.1692 37.0 37.0 37.0 37.0 37.0 75-79 36.26559999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.25449999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.17229999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2298 37.0 37.0 37.0 37.0 37.0 95-99 36.1916 37.0 37.0 37.0 37.0 37.0 100-104 36.1706 37.0 37.0 37.0 37.0 37.0 105-109 36.065200000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.0687 37.0 37.0 37.0 37.0 37.0 115-119 36.05229999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0401 37.0 37.0 37.0 37.0 37.0 125-129 35.8827 37.0 37.0 37.0 37.0 37.0 130-134 35.8154 37.0 37.0 37.0 37.0 37.0 135-139 35.767999999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.6414 37.0 37.0 37.0 37.0 37.0 145-149 35.5145 37.0 37.0 37.0 37.0 37.0 150-151 35.29075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 5.0 23 5.0 24 1.0 25 5.0 26 7.0 27 11.0 28 15.0 29 15.0 30 19.0 31 38.0 32 38.0 33 72.0 34 164.0 35 290.0 36 2980.0 37 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.16816816816817 14.164164164164164 8.308308308308309 34.35935935935936 2 20.150000000000002 13.125 36.7 30.025000000000002 3 16.55 16.45 30.3 36.7 4 20.474999999999998 22.375 26.1 31.05 5 24.65 29.475 25.15 20.724999999999998 6 21.4 33.2 24.25 21.15 7 15.575 30.0 41.025 13.4 8 15.65 26.674999999999997 34.5 23.175 9 16.425 24.45 36.3 22.825 10-14 19.115 31.7 27.389999999999997 21.795 15-19 19.655 29.335 27.950000000000003 23.06 20-24 19.650000000000002 29.439999999999998 27.82 23.09 25-29 19.53 29.665000000000003 27.405 23.400000000000002 30-34 19.96 29.785 26.685 23.57 35-39 19.235 29.225 27.400000000000002 24.14 40-44 20.34 29.965000000000003 27.11 22.585 45-49 20.11 29.755 26.935 23.200000000000003 50-54 19.89 28.999999999999996 26.995 24.115000000000002 55-59 19.915 28.975 27.315 23.794999999999998 60-64 19.535 29.17 27.439999999999998 23.855 65-69 19.68 30.049999999999997 26.865 23.405 70-74 21.62 28.92 26.279999999999998 23.18 75-79 21.435000000000002 27.939999999999998 26.71 23.915 80-84 21.625 28.265 26.825 23.285 85-89 21.745 28.775000000000002 26.16 23.32 90-94 21.46 28.595 26.224999999999998 23.72 95-99 21.275 28.175 27.275 23.275000000000002 100-104 21.759999999999998 27.765 26.52 23.955000000000002 105-109 21.705 28.605000000000004 26.555 23.135 110-114 21.6 28.360000000000003 26.85 23.189999999999998 115-119 21.69 28.27 26.705000000000002 23.335 120-124 22.125 28.125 26.284999999999997 23.465 125-129 22.105 28.335 25.83 23.73 130-134 22.165000000000003 28.005000000000003 25.945 23.885 135-139 22.46 28.255000000000003 26.090000000000003 23.195 140-144 22.36 27.825 25.91 23.905 145-149 22.11 27.785 26.31 23.794999999999998 150-151 22.4625 27.950000000000003 25.775 23.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 1.5 3 2.0 4 1.5 5 1.0 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 3.0 20 4.0 21 2.0 22 2.0 23 2.5 24 7.0 25 9.0 26 7.5 27 10.0 28 10.5 29 15.5 30 25.5 31 35.0 32 53.5 33 64.0 34 75.5 35 99.0 36 107.0 37 110.0 38 134.5 39 158.0 40 175.0 41 206.0 42 215.5 43 208.0 44 214.5 45 219.0 46 211.5 47 213.0 48 217.5 49 208.0 50 176.5 51 142.5 52 127.5 53 95.5 54 70.5 55 67.5 56 51.0 57 39.5 58 38.0 59 29.0 60 16.5 61 11.0 62 10.0 63 9.5 64 6.0 65 17.5 66 25.5 67 14.5 68 6.0 69 0.5 70 1.0 71 1.5 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.28989586265128 80.2 2 8.302842668167745 14.75 3 1.0413734871939206 2.775 4 0.28145229383619474 1.0 5 0.0 0.0 6 0.0 0.0 7 0.056290458767238954 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.028145229383619477 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCGTAGTATCTCGTAT 37 0.9249999999999999 TruSeq Adapter, Index 5 (97% over 38bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCGTAGTATCGCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 5 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0750000000000002 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.8499999999999996 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.8375000000000004 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 4.9875 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 6.05 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.574999999999999 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917529 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917529_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42475 37.0 37.0 37.0 37.0 37.0 2 36.3625 37.0 37.0 37.0 37.0 37.0 3 36.264 37.0 37.0 37.0 37.0 37.0 4 36.2815 37.0 37.0 37.0 37.0 37.0 5 36.356 37.0 37.0 37.0 37.0 37.0 6 36.3525 37.0 37.0 37.0 37.0 37.0 7 36.2905 37.0 37.0 37.0 37.0 37.0 8 36.297 37.0 37.0 37.0 37.0 37.0 9 36.431 37.0 37.0 37.0 37.0 37.0 10-14 36.316199999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3116 37.0 37.0 37.0 37.0 37.0 20-24 36.238800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1115 37.0 37.0 37.0 37.0 37.0 30-34 36.053 37.0 37.0 37.0 37.0 37.0 35-39 35.922700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.0077 37.0 37.0 37.0 37.0 37.0 45-49 35.9218 37.0 37.0 37.0 37.0 37.0 50-54 35.931 37.0 37.0 37.0 37.0 37.0 55-59 35.9765 37.0 37.0 37.0 37.0 37.0 60-64 35.993399999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.927 37.0 37.0 37.0 37.0 37.0 70-74 35.8202 37.0 37.0 37.0 37.0 37.0 75-79 35.76090000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.752 37.0 37.0 37.0 37.0 37.0 85-89 35.8359 37.0 37.0 37.0 37.0 37.0 90-94 35.9039 37.0 37.0 37.0 37.0 37.0 95-99 35.8897 37.0 37.0 37.0 37.0 37.0 100-104 35.7859 37.0 37.0 37.0 37.0 37.0 105-109 35.7818 37.0 37.0 37.0 37.0 37.0 110-114 35.788 37.0 37.0 37.0 37.0 37.0 115-119 35.746500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6409 37.0 37.0 37.0 37.0 37.0 125-129 35.5407 37.0 37.0 37.0 37.0 37.0 130-134 35.456900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.4589 37.0 37.0 37.0 37.0 37.0 140-144 35.2241 37.0 37.0 37.0 32.2 37.0 145-149 35.1255 37.0 37.0 37.0 29.8 37.0 150-151 34.5085 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 2.0 16 2.0 17 2.0 18 5.0 19 1.0 20 2.0 21 8.0 22 6.0 23 4.0 24 6.0 25 6.0 26 9.0 27 9.0 28 11.0 29 21.0 30 22.0 31 45.0 32 53.0 33 105.0 34 198.0 35 555.0 36 2760.0 37 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.26081520380095 25.756439109777446 8.527131782945736 22.455613903475868 2 30.725 25.474999999999998 27.400000000000002 16.400000000000002 3 22.625 27.55 32.275 17.549999999999997 4 25.025 33.475 22.400000000000002 19.1 5 27.900000000000002 36.275 19.475 16.35 6 22.45 38.875 20.375 18.3 7 22.95 23.75 35.575 17.724999999999998 8 22.625 25.674999999999997 27.950000000000003 23.75 9 23.625 22.525000000000002 29.299999999999997 24.55 10-14 24.88 28.87 25.295 20.955 15-19 25.09 27.884999999999998 26.165 20.86 20-24 24.955 28.015 26.3 20.73 25-29 24.310000000000002 26.715 27.339999999999996 21.634999999999998 30-34 25.045 27.755000000000003 26.265 20.935000000000002 35-39 25.52 26.965 26.695 20.82 40-44 24.93 27.325 27.27 20.474999999999998 45-49 25.590000000000003 26.445 27.189999999999998 20.775 50-54 25.52 27.12 26.655 20.705000000000002 55-59 24.855 27.365000000000002 26.655 21.125 60-64 25.025 27.084999999999997 26.87 21.02 65-69 25.195 27.67 25.86 21.275 70-74 24.355 26.979999999999997 27.275 21.39 75-79 25.4 27.12 26.645000000000003 20.835 80-84 25.335 27.02 26.784999999999997 20.86 85-89 25.580000000000002 26.565 27.12 20.735 90-94 25.345000000000002 27.025 26.8 20.830000000000002 95-99 25.46 27.339999999999996 26.61 20.59 100-104 25.665 26.935 27.01 20.39 105-109 25.080000000000002 27.62 26.755000000000003 20.544999999999998 110-114 25.395 27.29 26.845000000000002 20.47 115-119 26.215 27.384999999999998 26.229999999999997 20.169999999999998 120-124 26.029999999999998 27.134999999999998 26.815 20.02 125-129 25.95 27.534999999999997 26.465 20.05 130-134 26.634999999999998 26.795 26.6 19.97 135-139 26.39 27.224999999999998 26.275 20.11 140-144 26.72 27.765 26.145000000000003 19.37 145-149 27.97 26.765 26.39 18.875 150-151 27.9375 25.937500000000004 27.950000000000003 18.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.5 20 4.0 21 2.5 22 1.5 23 1.0 24 1.0 25 0.5 26 0.5 27 1.0 28 2.0 29 3.0 30 3.0 31 6.5 32 16.5 33 23.5 34 37.5 35 54.5 36 63.0 37 82.5 38 118.5 39 164.0 40 194.0 41 200.5 42 211.5 43 235.0 44 244.0 45 250.0 46 264.5 47 269.5 48 245.5 49 225.5 50 201.0 51 154.5 52 133.5 53 114.5 54 93.0 55 74.0 56 56.0 57 43.0 58 30.5 59 19.5 60 17.0 61 14.5 62 13.0 63 12.5 64 6.5 65 3.5 66 4.5 67 5.0 68 1.5 69 0.5 70 0.0 71 1.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 1.5 93 3.0 94 2.0 95 2.5 96 3.5 97 2.5 98 2.0 99 5.5 100 22.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.70288434612154 80.975 2 8.00896107532904 14.299999999999999 3 1.0361243349201905 2.775 4 0.16802016241949033 0.6 5 0.05600672080649678 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02800336040324839 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 44 1.0999999999999999 No Hit GGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGG 5 0.125 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.15 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.574999999999999 0.0 0.0 0.0 0.0 124-125 4.949999999999999 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.487500000000001 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATCC 10 0.006830828 145.0 3 >>END_MODULE Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra Read 487250 spots for SRR12917529.sra Written 487250 spots for SRR12917529.sra Read 487246 spots for SRR12917529.sra Written 487246 spots for SRR12917529.sra SRR ids: ['SRR12917529.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9lv3b8n5 SRR12917529.sra spots: 9744924 blocks: [[1, 487246], [487247, 974492], [974493, 1461738], [1461739, 1948984], [1948985, 2436230], [2436231, 2923476], [2923477, 3410722], [3410723, 3897968], [3897969, 4385214], [4385215, 4872460], [4872461, 5359706], [5359707, 5846952], [5846953, 6334198], [6334199, 6821444], [6821445, 7308690], [7308691, 7795936], [7795937, 8283182], [8283183, 8770428], [8770429, 9257674], [9257675, 9744924]] SRR12917529 file size 3290549 SRR12917529 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917529 SRR12917529_1.fastq SRR12917529_2.fastq Input file: SRR12917529_1.fastq Paired file: SRR12917529_2.fastq trimmed: SRR12917529-trimmed-pair1.fastq, SRR12917529-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:48:37 2025 >> started Thu Feb 13 11:48:47 2025 >> done (10.669s) 9744924 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 117495 ( 1.21%) empty read pairs filtered out after trimming by size control 9627365 (98.79%) read pairs available; of these: 1358999 (14.12%) trimmed read pairs available after processing 8268366 (85.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 5 0.00% 21 10 0.00% 22 16 0.00% 23 23 0.00% 24 21 0.00% 25 19 0.00% 26 27 0.00% 27 31 0.00% 28 32 0.00% 29 43 0.00% 30 38 0.00% 31 31 0.00% 32 39 0.00% 33 30 0.00% 34 32 0.00% 35 51 0.00% 36 51 0.00% 37 46 0.00% 38 67 0.00% 39 46 0.00% 40 47 0.00% 41 50 0.00% 42 58 0.00% 43 54 0.00% 44 46 0.00% 45 82 0.00% 46 54 0.00% 47 56 0.00% 48 82 0.00% 49 80 0.00% 50 88 0.00% 51 91 0.00% 52 102 0.00% 53 99 0.00% 54 122 0.00% 55 118 0.00% 56 161 0.00% 57 154 0.00% 58 199 0.00% 59 197 0.00% 60 262 0.00% 61 271 0.00% 62 314 0.00% 63 367 0.00% 64 424 0.00% 65 454 0.00% 66 532 0.01% 67 582 0.01% 68 603 0.01% 69 727 0.01% 70 794 0.01% 71 894 0.01% 72 1097 0.01% 73 1210 0.01% 74 1385 0.01% 75 1570 0.02% 76 1703 0.02% 77 1854 0.02% 78 1996 0.02% 79 2284 0.02% 80 2357 0.02% 81 2712 0.03% 82 3024 0.03% 83 3391 0.04% 84 3738 0.04% 85 4092 0.04% 86 4471 0.05% 87 4733 0.05% 88 4978 0.05% 89 5177 0.05% 90 5694 0.06% 91 5697 0.06% 92 6354 0.07% 93 7185 0.07% 94 7630 0.08% 95 8055 0.08% 96 8505 0.09% 97 9151 0.10% 98 9283 0.10% 99 9275 0.10% 100 9932 0.10% 101 10392 0.11% 102 10596 0.11% 103 11130 0.12% 104 12282 0.13% 105 12648 0.13% 106 13112 0.14% 107 13778 0.14% 108 13977 0.15% 109 14391 0.15% 110 14928 0.16% 111 15390 0.16% 112 15923 0.17% 113 16106 0.17% 114 17114 0.18% 115 18027 0.19% 116 18772 0.19% 117 19641 0.20% 118 20062 0.21% 119 20388 0.21% 120 20879 0.22% 121 21361 0.22% 122 21802 0.23% 123 22075 0.23% 124 23285 0.24% 125 23501 0.24% 126 24886 0.26% 127 25261 0.26% 128 26346 0.27% 129 26708 0.28% 130 27344 0.28% 131 27255 0.28% 132 28297 0.29% 133 28219 0.29% 134 28730 0.30% 135 29772 0.31% 136 30321 0.31% 137 30998 0.32% 138 31694 0.33% 139 32396 0.34% 140 32582 0.34% 141 33100 0.34% 142 33922 0.35% 143 34306 0.36% 144 35118 0.36% 145 35786 0.37% 146 35642 0.37% 147 36143 0.38% 148 37742 0.39% 149 37965 0.39% 150 39535 0.41% 151 8268366 85.88% 9627365 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=37 prefix-density=0.66 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=77.79 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.7 sequence=CTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=28 prefix-density=0.66 prefix-fanout=2.4 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=23.74 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12917529 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:49:30 Started mapping on | Feb 13 11:49:30 Finished on | Feb 13 11:50:38 Mapping speed, Million of reads per hour | 509.68 Number of input reads | 9627365 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8912872 Uniquely mapped reads % | 92.58% Average mapped length | 293.48 Number of splices: Total | 7502532 Number of splices: Annotated (sjdb) | 7347113 Number of splices: GT/AG | 7344875 Number of splices: GC/AG | 122848 Number of splices: AT/AC | 6449 Number of splices: Non-canonical | 28360 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.17 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239138 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 132197 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475355 475355 475355 N_multimapping 239138 239138 239138 N_noFeature 281770 8702862 342294 N_ambiguous 223590 923 73623 UnstrandedReadsAssigned:8407512 PositiveStrandReadsAssigned:209087 NegativeStrandReadsAssigned:8496955 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917529 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917529-trimmed-pair1.fastq SRR12917529-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,627,365 reads, 8,633,541 reads pseudoaligned [quant] estimated average fragment length: 231.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR12917529.ke.tsv 34699 SRR12917529.se.tsv 87100 total ==> SRR12917529.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.52 135 6.01255 Potri.005G024800.1.v4.1 1035 804.525 242 23.9471 Potri.004G059700.1.v4.1 961 730.538 27 2.94237 Potri.007G009000.2.v4.1 1416 1185.52 0 0 Potri.003G141000.2.v4.1 2943 2712.52 334 9.80279 Potri.016G087400.1.v4.1 270 87.7785 432 391.807 Potri.015G069301.1.v4.1 564 339.057 0 0 Potri.010G195200.1.v4.1 1773 1542.52 27 1.3935 Potri.012G127500.1.v4.1 977 746.533 567 60.4659 ==> SRR12917529.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 181 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12917529 completed mapping pipeline successfully