Starting /dee2/code/volunteer_pipeline.sh SRR12917530 current disk space = 3093008646144 free memory = 1391175200 SRR12917530 SRAfilesize c3401d70c81092355abac5f3d6bf2fb7 SRR12917530.sra SRR12917530.sra file validated SRR12917530 is paired end SRR12917530 is conventional basespace SRR12917530 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917530_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5795 37.0 37.0 37.0 37.0 37.0 2 36.468 37.0 37.0 37.0 37.0 37.0 3 36.563 37.0 37.0 37.0 37.0 37.0 4 36.6265 37.0 37.0 37.0 37.0 37.0 5 36.7175 37.0 37.0 37.0 37.0 37.0 6 36.6855 37.0 37.0 37.0 37.0 37.0 7 36.521 37.0 37.0 37.0 37.0 37.0 8 36.587 37.0 37.0 37.0 37.0 37.0 9 36.6665 37.0 37.0 37.0 37.0 37.0 10-14 36.6476 37.0 37.0 37.0 37.0 37.0 15-19 36.6301 37.0 37.0 37.0 37.0 37.0 20-24 36.5545 37.0 37.0 37.0 37.0 37.0 25-29 36.5551 37.0 37.0 37.0 37.0 37.0 30-34 36.509699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4702 37.0 37.0 37.0 37.0 37.0 40-44 36.474199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4221 37.0 37.0 37.0 37.0 37.0 50-54 36.40070000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.361900000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.319 37.0 37.0 37.0 37.0 37.0 65-69 36.2744 37.0 37.0 37.0 37.0 37.0 70-74 36.2723 37.0 37.0 37.0 37.0 37.0 75-79 36.3457 37.0 37.0 37.0 37.0 37.0 80-84 36.2963 37.0 37.0 37.0 37.0 37.0 85-89 36.263400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.268100000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1509 37.0 37.0 37.0 37.0 37.0 100-104 36.1095 37.0 37.0 37.0 37.0 37.0 105-109 36.076 37.0 37.0 37.0 37.0 37.0 110-114 36.076499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0303 37.0 37.0 37.0 37.0 37.0 120-124 36.061099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9739 37.0 37.0 37.0 37.0 37.0 130-134 35.9288 37.0 37.0 37.0 37.0 37.0 135-139 35.818400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.723099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5873 37.0 37.0 37.0 37.0 37.0 150-151 35.50775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 4.0 23 4.0 24 2.0 25 2.0 26 4.0 27 5.0 28 10.0 29 13.0 30 20.0 31 28.0 32 55.0 33 70.0 34 130.0 35 286.0 36 3073.0 37 293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 14.499999999999998 6.375 39.050000000000004 2 18.625 10.85 37.824999999999996 32.7 3 16.375 17.150000000000002 28.050000000000004 38.425 4 21.224999999999998 22.05 24.425 32.300000000000004 5 23.150000000000002 28.050000000000004 24.85 23.95 6 20.75 32.35 23.875 23.025000000000002 7 14.424999999999999 29.349999999999998 40.6 15.625 8 17.0 25.525 33.925 23.549999999999997 9 16.525000000000002 24.875 33.925 24.675 10-14 19.205 31.1 27.525 22.17 15-19 19.455 28.525 27.62 24.4 20-24 19.45 28.925 27.595 24.03 25-29 19.78 28.860000000000003 27.939999999999998 23.419999999999998 30-34 19.555 29.015 27.67 23.76 35-39 19.905 29.29 27.105 23.7 40-44 19.59 30.044999999999998 27.065 23.3 45-49 19.72 29.49 27.095000000000002 23.695 50-54 20.47 29.154999999999998 26.685 23.69 55-59 19.975 28.310000000000002 27.284999999999997 24.43 60-64 19.905 28.675 27.134999999999998 24.285 65-69 19.59 28.57 27.33 24.51 70-74 19.86 28.294999999999998 27.575 24.27 75-79 20.73 28.38 27.24 23.65 80-84 19.759999999999998 28.799999999999997 27.48 23.96 85-89 20.635 28.565 26.845000000000002 23.955000000000002 90-94 20.225 28.405 27.395000000000003 23.974999999999998 95-99 19.765 28.825 27.644999999999996 23.765 100-104 20.815 29.01 26.700000000000003 23.474999999999998 105-109 21.490000000000002 28.194999999999997 26.935 23.380000000000003 110-114 21.17 27.834999999999997 27.334999999999997 23.66 115-119 21.029999999999998 28.13 26.655 24.185000000000002 120-124 20.535 28.93 26.56 23.974999999999998 125-129 20.65 27.950000000000003 26.76 24.64 130-134 20.84 27.98 26.939999999999998 24.240000000000002 135-139 20.815 28.13 26.284999999999997 24.77 140-144 21.245 27.715 27.01 24.03 145-149 21.425 28.08 26.495 24.0 150-151 22.125 27.237499999999997 26.05 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 2.0 20 3.0 21 1.5 22 2.0 23 2.5 24 3.0 25 4.5 26 6.0 27 8.5 28 9.0 29 13.0 30 19.0 31 32.0 32 46.0 33 50.0 34 49.5 35 62.0 36 88.5 37 112.0 38 142.0 39 159.5 40 177.5 41 203.0 42 212.0 43 228.0 44 256.0 45 270.0 46 267.0 47 260.0 48 235.0 49 195.0 50 176.0 51 155.5 52 122.0 53 92.5 54 68.5 55 55.5 56 46.0 57 38.5 58 28.0 59 18.0 60 13.0 61 12.5 62 9.5 63 6.5 64 6.5 65 6.0 66 5.0 67 3.5 68 3.0 69 3.5 70 3.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.7804478427089 84.025 2 7.236482796286182 13.25 3 0.9557618787547788 2.625 4 0.027307482250136534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.11249999999999999 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.6624999999999996 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.35 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.137499999999999 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.1625 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.274999999999999 0.0 0.0 0.0 0.0 138-139 8.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAACT 10 0.006830828 145.0 7 TTTGGAT 10 0.006830828 145.0 8 ACAACTG 10 0.006830828 145.0 8 >>END_MODULE SRR12917530 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917530_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.311 37.0 37.0 37.0 37.0 37.0 2 36.327 37.0 37.0 37.0 37.0 37.0 3 36.33 37.0 37.0 37.0 37.0 37.0 4 36.4585 37.0 37.0 37.0 37.0 37.0 5 36.372 37.0 37.0 37.0 37.0 37.0 6 36.3145 37.0 37.0 37.0 37.0 37.0 7 36.4215 37.0 37.0 37.0 37.0 37.0 8 36.444 37.0 37.0 37.0 37.0 37.0 9 36.38 37.0 37.0 37.0 37.0 37.0 10-14 36.38590000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.334199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2474 37.0 37.0 37.0 37.0 37.0 25-29 36.163900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.11409999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.1178 37.0 37.0 37.0 37.0 37.0 40-44 36.052499999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.99060000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.013600000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.9715 37.0 37.0 37.0 37.0 37.0 60-64 36.006 37.0 37.0 37.0 37.0 37.0 65-69 35.9643 37.0 37.0 37.0 37.0 37.0 70-74 35.9566 37.0 37.0 37.0 37.0 37.0 75-79 35.8986 37.0 37.0 37.0 37.0 37.0 80-84 35.93430000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.909200000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.913599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8349 37.0 37.0 37.0 37.0 37.0 100-104 35.875099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.786 37.0 37.0 37.0 37.0 37.0 110-114 35.7913 37.0 37.0 37.0 37.0 37.0 115-119 35.6459 37.0 37.0 37.0 37.0 37.0 120-124 35.60979999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.567600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4989 37.0 37.0 37.0 37.0 37.0 135-139 35.485 37.0 37.0 37.0 37.0 37.0 140-144 35.270900000000005 37.0 37.0 37.0 34.6 37.0 145-149 35.0911 37.0 37.0 37.0 25.0 37.0 150-151 34.5725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 7.0 16 5.0 17 0.0 18 4.0 19 2.0 20 4.0 21 3.0 22 5.0 23 8.0 24 4.0 25 4.0 26 10.0 27 11.0 28 5.0 29 9.0 30 24.0 31 36.0 32 62.0 33 74.0 34 154.0 35 526.0 36 2800.0 37 234.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.550000000000004 25.25 10.225 25.974999999999998 2 30.3 23.575 28.425 17.7 3 20.45 27.575 33.275 18.7 4 24.4 33.0 23.375 19.225 5 25.8 36.575 21.224999999999998 16.400000000000002 6 20.375 38.775 22.35 18.5 7 22.175 22.900000000000002 36.025 18.9 8 21.6 25.275 28.825 24.3 9 21.95 24.275 29.799999999999997 23.974999999999998 10-14 23.849999999999998 29.345 25.775 21.029999999999998 15-19 23.885 28.53 26.66 20.925 20-24 24.115000000000002 28.275 27.165 20.445 25-29 23.605 27.87 27.544999999999998 20.979999999999997 30-34 23.66 28.444999999999997 26.955000000000002 20.94 35-39 23.735 28.199999999999996 27.200000000000003 20.865000000000002 40-44 23.465 28.275 27.505000000000003 20.755000000000003 45-49 24.02 27.644999999999996 27.16 21.175 50-54 24.015 28.21 27.465 20.31 55-59 24.33 27.950000000000003 27.150000000000002 20.57 60-64 23.895 27.235 28.194999999999997 20.674999999999997 65-69 23.635 28.000000000000004 27.47 20.895 70-74 24.4 27.3 27.55 20.75 75-79 24.08 27.625 27.47 20.825 80-84 24.81 27.229999999999997 27.150000000000002 20.810000000000002 85-89 24.15 27.82 26.96 21.07 90-94 24.224999999999998 27.57 27.785 20.419999999999998 95-99 23.419999999999998 28.365000000000002 27.589999999999996 20.625 100-104 24.29 28.15 26.945000000000004 20.615 105-109 23.830000000000002 27.99 27.495000000000005 20.685000000000002 110-114 25.005 27.700000000000003 26.935 20.36 115-119 24.585 28.13 27.189999999999998 20.095 120-124 25.074999999999996 27.589999999999996 26.6 20.735 125-129 25.180000000000003 28.189999999999998 26.58 20.05 130-134 25.16 27.875 27.08 19.885 135-139 25.945 27.83 26.119999999999997 20.105 140-144 25.61 28.305000000000003 26.334999999999997 19.75 145-149 26.88 27.58 26.035000000000004 19.505 150-151 26.987499999999997 27.175 25.275 20.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 1.5 18 1.5 19 0.0 20 1.0 21 1.5 22 0.5 23 0.5 24 2.0 25 3.5 26 4.0 27 3.5 28 7.5 29 9.5 30 8.5 31 14.5 32 23.0 33 32.5 34 41.5 35 59.5 36 81.0 37 98.5 38 132.0 39 165.0 40 188.5 41 232.0 42 250.5 43 240.5 44 265.0 45 274.0 46 263.5 47 260.0 48 230.5 49 194.0 50 167.5 51 153.5 52 134.0 53 93.5 54 65.5 55 56.0 56 49.0 57 33.0 58 25.5 59 20.5 60 14.5 61 14.5 62 10.5 63 9.5 64 7.0 65 3.5 66 2.5 67 4.0 68 3.0 69 2.0 70 1.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.5 76 2.5 77 2.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 1.5 85 1.0 86 0.5 87 0.5 88 1.5 89 1.5 90 0.5 91 1.0 92 1.0 93 1.0 94 1.5 95 1.0 96 1.0 97 2.0 98 2.0 99 1.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.03491543917076 84.35000000000001 2 7.037643207855974 12.9 3 0.872885979268958 2.4 4 0.027277686852154936 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027277686852154936 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.11249999999999999 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 3.0374999999999996 0.0 0.0 0.0 0.0 116-117 3.3375000000000004 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.825 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 6.1875 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.637499999999999 0.0 0.0 0.0 0.0 136-137 8.350000000000001 0.0 0.0 0.0 0.0 138-139 9.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTG 10 0.006830828 145.0 7 TCAAAAT 20 3.5877043E-4 108.75 2 TTTTTTT 40 0.0076550315 18.125 1 >>END_MODULE Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491547 spots for SRR12917530.sra Written 491547 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra Read 491534 spots for SRR12917530.sra Written 491534 spots for SRR12917530.sra SRR ids: ['SRR12917530.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h9tx_gvp SRR12917530.sra spots: 9830693 blocks: [[1, 491534], [491535, 983068], [983069, 1474602], [1474603, 1966136], [1966137, 2457670], [2457671, 2949204], [2949205, 3440738], [3440739, 3932272], [3932273, 4423806], [4423807, 4915340], [4915341, 5406874], [5406875, 5898408], [5898409, 6389942], [6389943, 6881476], [6881477, 7373010], [7373011, 7864544], [7864545, 8356078], [8356079, 8847612], [8847613, 9339146], [9339147, 9830693]] SRR12917530 file size 3319529 SRR12917530 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917530 SRR12917530_1.fastq SRR12917530_2.fastq Input file: SRR12917530_1.fastq Paired file: SRR12917530_2.fastq trimmed: SRR12917530-trimmed-pair1.fastq, SRR12917530-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:54:23 2025 >> started Thu Feb 13 11:54:34 2025 >> done (10.789s) 9830693 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 11064 ( 0.11%) empty read pairs filtered out after trimming by size control 9819567 (99.89%) read pairs available; of these: 1244689 (12.68%) trimmed read pairs available after processing 8574878 (87.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 4 0.00% 21 9 0.00% 22 6 0.00% 23 9 0.00% 24 11 0.00% 25 11 0.00% 26 14 0.00% 27 11 0.00% 28 16 0.00% 29 21 0.00% 30 17 0.00% 31 18 0.00% 32 26 0.00% 33 22 0.00% 34 20 0.00% 35 26 0.00% 36 9 0.00% 37 23 0.00% 38 18 0.00% 39 15 0.00% 40 27 0.00% 41 32 0.00% 42 34 0.00% 43 33 0.00% 44 28 0.00% 45 28 0.00% 46 40 0.00% 47 34 0.00% 48 43 0.00% 49 38 0.00% 50 81 0.00% 51 61 0.00% 52 98 0.00% 53 84 0.00% 54 109 0.00% 55 119 0.00% 56 107 0.00% 57 154 0.00% 58 172 0.00% 59 180 0.00% 60 230 0.00% 61 282 0.00% 62 329 0.00% 63 349 0.00% 64 401 0.00% 65 474 0.00% 66 516 0.01% 67 582 0.01% 68 607 0.01% 69 757 0.01% 70 866 0.01% 71 993 0.01% 72 1204 0.01% 73 1340 0.01% 74 1484 0.02% 75 1683 0.02% 76 1839 0.02% 77 1863 0.02% 78 2122 0.02% 79 2337 0.02% 80 2504 0.03% 81 2851 0.03% 82 3171 0.03% 83 3453 0.04% 84 4001 0.04% 85 4366 0.04% 86 4449 0.05% 87 4827 0.05% 88 5091 0.05% 89 5087 0.05% 90 5341 0.05% 91 5847 0.06% 92 6046 0.06% 93 6662 0.07% 94 7222 0.07% 95 7983 0.08% 96 8334 0.08% 97 8605 0.09% 98 8907 0.09% 99 9178 0.09% 100 9299 0.09% 101 9700 0.10% 102 10344 0.11% 103 10837 0.11% 104 11590 0.12% 105 11984 0.12% 106 12814 0.13% 107 13212 0.13% 108 13417 0.14% 109 13530 0.14% 110 13949 0.14% 111 14182 0.14% 112 14843 0.15% 113 15466 0.16% 114 15834 0.16% 115 16828 0.17% 116 17414 0.18% 117 18545 0.19% 118 18934 0.19% 119 19178 0.20% 120 19325 0.20% 121 19498 0.20% 122 19478 0.20% 123 20127 0.20% 124 20954 0.21% 125 21860 0.22% 126 22958 0.23% 127 23673 0.24% 128 23930 0.24% 129 24675 0.25% 130 25001 0.25% 131 24691 0.25% 132 25316 0.26% 133 25558 0.26% 134 25982 0.26% 135 26799 0.27% 136 27293 0.28% 137 27975 0.28% 138 28666 0.29% 139 29146 0.30% 140 29537 0.30% 141 29764 0.30% 142 30037 0.31% 143 29710 0.30% 144 30543 0.31% 145 31365 0.32% 146 31176 0.32% 147 31948 0.33% 148 32721 0.33% 149 32967 0.34% 150 34114 0.35% 151 8574878 87.32% 9819567 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.3 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCTTTGTTTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTTTTGCATCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=53.21 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=11.6 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.3 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=388.66 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.7 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917530 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:55:20 Started mapping on | Feb 13 11:55:21 Finished on | Feb 13 11:57:06 Mapping speed, Million of reads per hour | 336.67 Number of input reads | 9819567 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8842895 Uniquely mapped reads % | 90.05% Average mapped length | 294.16 Number of splices: Total | 7973737 Number of splices: Annotated (sjdb) | 7809483 Number of splices: GT/AG | 7820340 Number of splices: GC/AG | 119028 Number of splices: AT/AC | 10171 Number of splices: Non-canonical | 24198 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 3.23 Insertion rate per base | 0.03% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247181 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 165276 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.38% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 729491 729491 729491 N_multimapping 247181 247181 247181 N_noFeature 235626 8714691 286408 N_ambiguous 127937 599 50271 UnstrandedReadsAssigned:8479332 PositiveStrandReadsAssigned:127605 NegativeStrandReadsAssigned:8506216 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917530 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917530-trimmed-pair1.fastq SRR12917530-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,819,567 reads, 8,632,914 reads pseudoaligned [quant] estimated average fragment length: 251.971 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR12917530.ke.tsv 34699 SRR12917530.se.tsv 87100 total ==> SRR12917530.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.03 255 13.4824 Potri.005G024800.1.v4.1 1035 784.029 148 17.636 Potri.004G059700.1.v4.1 961 710.149 54 7.10419 Potri.007G009000.2.v4.1 1416 1165.03 0 0 Potri.003G141000.2.v4.1 2943 2692.03 432 14.9925 Potri.016G087400.1.v4.1 270 89.1264 1048.65 1099.25 Potri.015G069301.1.v4.1 564 325.833 0 0 Potri.010G195200.1.v4.1 1773 1522.03 35 2.1484 Potri.012G127500.1.v4.1 977 726.077 8692 1118.43 ==> SRR12917530.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 230 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12917530 completed mapping pipeline successfully