Starting /dee2/code/volunteer_pipeline.sh SRR12917531 current disk space = 3092550041600 free memory = 1466140524 SRR12917531 SRAfilesize a7768db50423a6e5b9acd151018161dd SRR12917531.sra SRR12917531.sra file validated SRR12917531 is paired end SRR12917531 is conventional basespace SRR12917531 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6145 37.0 37.0 37.0 37.0 37.0 2 36.576 37.0 37.0 37.0 37.0 37.0 3 36.6075 37.0 37.0 37.0 37.0 37.0 4 36.645 37.0 37.0 37.0 37.0 37.0 5 36.663 37.0 37.0 37.0 37.0 37.0 6 36.7035 37.0 37.0 37.0 37.0 37.0 7 36.5825 37.0 37.0 37.0 37.0 37.0 8 36.6035 37.0 37.0 37.0 37.0 37.0 9 36.605 37.0 37.0 37.0 37.0 37.0 10-14 36.6716 37.0 37.0 37.0 37.0 37.0 15-19 36.6607 37.0 37.0 37.0 37.0 37.0 20-24 36.589 37.0 37.0 37.0 37.0 37.0 25-29 36.5696 37.0 37.0 37.0 37.0 37.0 30-34 36.5375 37.0 37.0 37.0 37.0 37.0 35-39 36.4822 37.0 37.0 37.0 37.0 37.0 40-44 36.4947 37.0 37.0 37.0 37.0 37.0 45-49 36.4372 37.0 37.0 37.0 37.0 37.0 50-54 36.4662 37.0 37.0 37.0 37.0 37.0 55-59 36.4161 37.0 37.0 37.0 37.0 37.0 60-64 36.3283 37.0 37.0 37.0 37.0 37.0 65-69 36.2041 37.0 37.0 37.0 37.0 37.0 70-74 36.3066 37.0 37.0 37.0 37.0 37.0 75-79 36.37050000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.318 37.0 37.0 37.0 37.0 37.0 85-89 36.317899999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.309900000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.242399999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2159 37.0 37.0 37.0 37.0 37.0 105-109 36.149699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1763 37.0 37.0 37.0 37.0 37.0 115-119 36.045 37.0 37.0 37.0 37.0 37.0 120-124 36.0882 37.0 37.0 37.0 37.0 37.0 125-129 35.972899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.919200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8782 37.0 37.0 37.0 37.0 37.0 140-144 35.692499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.57110000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.329 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 4.0 25 3.0 26 7.0 27 11.0 28 7.0 29 15.0 30 17.0 31 24.0 32 41.0 33 62.0 34 119.0 35 343.0 36 3039.0 37 308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.14407203601801 12.056028014007003 8.129064532266133 41.67083541770886 2 19.125 13.3 34.375 33.2 3 17.349999999999998 15.950000000000001 27.975 38.725 4 20.525 21.125 24.224999999999998 34.125 5 24.0 27.825 25.3 22.875 6 21.3 32.925 23.25 22.525000000000002 7 16.400000000000002 30.349999999999998 36.475 16.775000000000002 8 18.075 27.1 30.425 24.4 9 19.125 22.175 35.05 23.65 10-14 19.634999999999998 30.525000000000002 26.979999999999997 22.86 15-19 19.650000000000002 28.105000000000004 27.675 24.57 20-24 19.335 28.77 27.700000000000003 24.195 25-29 19.725 28.71 27.415 24.15 30-34 19.695 28.189999999999998 27.16 24.955 35-39 20.075000000000003 28.26 27.555000000000003 24.11 40-44 20.005 28.139999999999997 27.92 23.935000000000002 45-49 21.04 28.175 27.134999999999998 23.65 50-54 20.645 28.265 27.145000000000003 23.945 55-59 20.075000000000003 28.565 27.565 23.794999999999998 60-64 20.49 27.655 27.474999999999998 24.38 65-69 20.385 28.965000000000003 26.584999999999997 24.065 70-74 20.955 27.655 27.165 24.224999999999998 75-79 21.365000000000002 28.084999999999997 26.43 24.12 80-84 21.535 27.62 27.295 23.549999999999997 85-89 21.385 28.22 26.979999999999997 23.415 90-94 21.65 27.98 26.36 24.01 95-99 21.93 27.175 27.450000000000003 23.445 100-104 21.015 28.375 26.334999999999997 24.275 105-109 22.02 26.985 27.589999999999996 23.405 110-114 21.43 28.1 26.150000000000002 24.32 115-119 21.19 28.07 27.0 23.74 120-124 22.07 28.035 26.31 23.585 125-129 22.38 27.595 25.82 24.205 130-134 22.06 27.875 25.779999999999998 24.285 135-139 21.855 27.145000000000003 27.02 23.98 140-144 22.42 27.21 26.05 24.32 145-149 22.384999999999998 26.755000000000003 26.325 24.535 150-151 22.0625 27.0 25.775 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 2.0 25 3.5 26 3.0 27 5.5 28 8.5 29 10.5 30 13.5 31 21.5 32 28.5 33 39.0 34 50.5 35 64.0 36 81.0 37 94.0 38 106.5 39 129.5 40 159.5 41 201.0 42 226.5 43 232.5 44 262.0 45 286.5 46 278.5 47 250.5 48 230.0 49 202.0 50 179.5 51 169.5 52 133.5 53 102.5 54 85.5 55 66.5 56 54.0 57 43.5 58 33.5 59 24.0 60 18.0 61 12.5 62 9.0 63 5.5 64 4.0 65 25.0 66 26.5 67 5.0 68 0.5 69 0.5 70 1.0 71 1.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48968363136176 84.05 2 6.134800550206328 11.15 3 1.2104539202200826 3.3000000000000003 4 0.08253094910591473 0.3 5 0.055020632737276476 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027510316368638238 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCGATACATCTCGTAT 38 0.95 TruSeq Adapter, Index 12 (97% over 37bp) GCCAAATCCTTTCCAATGAGATTAATGTGCTGGTAAAGGCGTCTTGGAGT 5 0.125 No Hit GGACCCACTTCCACCTTTTCTCCTGCATTAGTCCATGATCACCACTCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6625 0.0 0.0 0.0 0.0 80-81 0.9625 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.1875 0.0 0.0 0.0 0.0 86-87 1.3624999999999998 0.0 0.0 0.0 0.0 88-89 1.5 0.0 0.0 0.0 0.0 90-91 1.65 0.0 0.0 0.0 0.0 92-93 1.9125 0.0 0.0 0.0 0.0 94-95 2.1125 0.0 0.0 0.0 0.0 96-97 2.325 0.0 0.0 0.0 0.0 98-99 2.675 0.0 0.0 0.0 0.0 100-101 2.9125 0.0 0.0 0.0 0.0 102-103 3.3 0.0 0.0 0.0 0.0 104-105 3.65 0.0 0.0 0.0 0.0 106-107 4.0375 0.0 0.0 0.0 0.0 108-109 4.4375 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.4 0.0 0.0 0.0 0.0 114-115 5.824999999999999 0.0 0.0 0.0 0.0 116-117 6.25 0.0 0.0 0.0 0.0 118-119 6.887499999999999 0.0 0.0 0.0 0.0 120-121 7.6 0.0 0.0 0.0 0.0 122-123 8.0375 0.0 0.0 0.0 0.0 124-125 8.575 0.0 0.0 0.0 0.0 126-127 8.9375 0.0 0.0 0.0 0.0 128-129 9.325 0.0 0.0 0.0 0.0 130-131 9.925 0.0 0.0 0.0 0.0 132-133 10.5 0.0 0.0 0.0 0.0 134-135 11.0 0.0 0.0 0.0 0.0 136-137 11.6125 0.0 0.0 0.0 0.0 138-139 12.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAATC 10 0.006830828 145.0 2 >>END_MODULE SRR12917531 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917531_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54075 37.0 37.0 37.0 37.0 37.0 2 36.385 37.0 37.0 37.0 37.0 37.0 3 36.362 37.0 37.0 37.0 37.0 37.0 4 36.4935 37.0 37.0 37.0 37.0 37.0 5 36.5485 37.0 37.0 37.0 37.0 37.0 6 36.379 37.0 37.0 37.0 37.0 37.0 7 36.5255 37.0 37.0 37.0 37.0 37.0 8 36.524 37.0 37.0 37.0 37.0 37.0 9 36.5175 37.0 37.0 37.0 37.0 37.0 10-14 36.449 37.0 37.0 37.0 37.0 37.0 15-19 36.439800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3823 37.0 37.0 37.0 37.0 37.0 25-29 36.1836 37.0 37.0 37.0 37.0 37.0 30-34 36.1724 37.0 37.0 37.0 37.0 37.0 35-39 36.0292 37.0 37.0 37.0 37.0 37.0 40-44 36.08800000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.943900000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.005100000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.015699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0946 37.0 37.0 37.0 37.0 37.0 65-69 35.9957 37.0 37.0 37.0 37.0 37.0 70-74 35.946000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8625 37.0 37.0 37.0 37.0 37.0 80-84 35.9508 37.0 37.0 37.0 37.0 37.0 85-89 36.0072 37.0 37.0 37.0 37.0 37.0 90-94 36.033 37.0 37.0 37.0 37.0 37.0 95-99 35.9831 37.0 37.0 37.0 37.0 37.0 100-104 35.9594 37.0 37.0 37.0 37.0 37.0 105-109 35.9304 37.0 37.0 37.0 37.0 37.0 110-114 35.8668 37.0 37.0 37.0 37.0 37.0 115-119 35.804700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6697 37.0 37.0 37.0 37.0 37.0 125-129 35.580200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.468 37.0 37.0 37.0 37.0 37.0 135-139 35.425 37.0 37.0 37.0 37.0 37.0 140-144 35.1663 37.0 37.0 37.0 27.4 37.0 145-149 35.0514 37.0 37.0 37.0 27.4 37.0 150-151 34.435249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 0.0 16 1.0 17 3.0 18 0.0 19 3.0 20 2.0 21 2.0 22 4.0 23 6.0 24 7.0 25 5.0 26 5.0 27 11.0 28 12.0 29 25.0 30 25.0 31 41.0 32 61.0 33 96.0 34 162.0 35 524.0 36 2745.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.83420855213804 20.7551887971993 13.603400850212552 28.80720180045011 2 29.225 24.3 29.15 17.325 3 22.325 27.525 30.675 19.475 4 25.924999999999997 31.6 22.8 19.675 5 25.900000000000002 35.099999999999994 21.65 17.349999999999998 6 21.925 38.6 20.75 18.725 7 22.675 22.55 35.85 18.925 8 21.4 25.324999999999996 28.1 25.174999999999997 9 21.775 25.7 30.4 22.125 10-14 24.595 29.14 25.505 20.76 15-19 24.740000000000002 27.700000000000003 26.665 20.895 20-24 24.6 28.32 26.52 20.560000000000002 25-29 24.72 27.54 27.21 20.53 30-34 24.085 27.725 27.08 21.11 35-39 25.005 27.084999999999997 27.21 20.7 40-44 24.529999999999998 27.295 27.245 20.93 45-49 24.51 27.544999999999998 26.955000000000002 20.990000000000002 50-54 24.51 27.375 27.005000000000003 21.11 55-59 24.72 27.800000000000004 26.905 20.575 60-64 24.715 27.37 27.365000000000002 20.549999999999997 65-69 24.635 26.815 27.075 21.475 70-74 24.42 27.74 26.979999999999997 20.86 75-79 25.424999999999997 27.384999999999998 27.02 20.169999999999998 80-84 25.11 27.6 26.939999999999998 20.349999999999998 85-89 25.145 27.375 26.5 20.979999999999997 90-94 25.595000000000002 27.6 26.82 19.985 95-99 25.575 27.439999999999998 26.99 19.994999999999997 100-104 25.22 27.36 26.88 20.54 105-109 25.715 27.145000000000003 27.235 19.905 110-114 25.455 27.265 26.755000000000003 20.525 115-119 25.979999999999997 26.790000000000003 27.21 20.02 120-124 26.465 27.034999999999997 26.44 20.06 125-129 27.025 27.68 25.679999999999996 19.615 130-134 27.034999999999997 27.195000000000004 26.119999999999997 19.650000000000002 135-139 27.075 27.150000000000002 26.38 19.395 140-144 27.405 27.725 26.11 18.759999999999998 145-149 27.525 27.689999999999998 25.44 19.345000000000002 150-151 28.375 27.0 25.324999999999996 19.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 5.0 29 7.0 30 10.5 31 16.5 32 17.5 33 23.5 34 36.5 35 51.5 36 66.0 37 95.0 38 115.5 39 132.5 40 183.5 41 227.0 42 237.0 43 254.0 44 276.0 45 294.0 46 290.0 47 260.5 48 241.0 49 208.0 50 162.0 51 154.0 52 136.0 53 89.5 54 76.0 55 67.0 56 47.5 57 29.5 58 27.0 59 27.0 60 16.0 61 9.5 62 11.5 63 9.5 64 4.0 65 4.0 66 4.5 67 3.0 68 1.0 69 2.5 70 2.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 1.5 78 1.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 1.0 88 1.5 89 0.5 90 0.5 91 1.0 92 0.5 93 0.5 94 1.0 95 1.0 96 1.0 97 2.0 98 3.5 99 8.0 100 17.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.64544456641055 84.39999999999999 2 6.0373216245883645 11.0 3 1.1525795828759604 3.15 4 0.0823271130625686 0.3 5 0.054884742041712405 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027442371020856202 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 36 0.8999999999999999 No Hit GAATTGCAAGTTGCCTCTCTTTTTTGGCTGACACAGCCCCGGGGGTGACT 5 0.125 No Hit GAACCCAATGTCCAGTGCACTCTGCTTCAATGATTCCACTCAGGACTATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.1625 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88-89 1.475 0.0 0.0 0.0 0.0 90-91 1.625 0.0 0.0 0.0 0.0 92-93 1.8875 0.0 0.0 0.0 0.0 94-95 2.0875 0.0 0.0 0.0 0.0 96-97 2.3 0.0 0.0 0.0 0.0 98-99 2.6500000000000004 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.2750000000000004 0.0 0.0 0.0 0.0 104-105 3.6125 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.387499999999999 0.0 0.0 0.0 0.0 110-111 4.925 0.0 0.0 0.0 0.0 112-113 5.3625 0.0 0.0 0.0 0.0 114-115 5.800000000000001 0.0 0.0 0.0 0.0 116-117 6.225 0.0 0.0 0.0 0.0 118-119 6.887499999999999 0.0 0.0 0.0 0.0 120-121 7.5875 0.0 0.0 0.0 0.0 122-123 8.0125 0.0 0.0 0.0 0.0 124-125 8.55 0.0 0.0 0.0 0.0 126-127 8.9125 0.0 0.0 0.0 0.0 128-129 9.274999999999999 0.0 0.0 0.0 0.0 130-131 9.850000000000001 0.0 0.0 0.0 0.0 132-133 10.425 0.0 0.0 0.0 0.0 134-135 10.899999999999999 0.0 0.0 0.0 0.0 136-137 11.525 0.0 0.0 0.0 0.0 138-139 12.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTTG 10 0.006830828 145.0 5 >>END_MODULE Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617721 spots for SRR12917531.sra Written 617721 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra Read 617714 spots for SRR12917531.sra Written 617714 spots for SRR12917531.sra SRR ids: ['SRR12917531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r4vtdgzl SRR12917531.sra spots: 12354287 blocks: [[1, 617714], [617715, 1235428], [1235429, 1853142], [1853143, 2470856], [2470857, 3088570], [3088571, 3706284], [3706285, 4323998], [4323999, 4941712], [4941713, 5559426], [5559427, 6177140], [6177141, 6794854], [6794855, 7412568], [7412569, 8030282], [8030283, 8647996], [8647997, 9265710], [9265711, 9883424], [9883425, 10501138], [10501139, 11118852], [11118853, 11736566], [11736567, 12354287]] SRR12917531 file size 4176826 SRR12917531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917531 SRR12917531_1.fastq SRR12917531_2.fastq Input file: SRR12917531_1.fastq Paired file: SRR12917531_2.fastq trimmed: SRR12917531-trimmed-pair1.fastq, SRR12917531-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:14:49 2025 >> started Thu Feb 13 12:15:02 2025 >> done (13.448s) 12354287 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 154405 ( 1.25%) empty read pairs filtered out after trimming by size control 12199824 (98.75%) read pairs available; of these: 2171029 (17.80%) trimmed read pairs available after processing 10028795 (82.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 2 0.00% 21 7 0.00% 22 2 0.00% 23 7 0.00% 24 5 0.00% 25 7 0.00% 26 6 0.00% 27 11 0.00% 28 5 0.00% 29 10 0.00% 30 13 0.00% 31 11 0.00% 32 17 0.00% 33 18 0.00% 34 20 0.00% 35 20 0.00% 36 20 0.00% 37 18 0.00% 38 19 0.00% 39 22 0.00% 40 41 0.00% 41 37 0.00% 42 52 0.00% 43 54 0.00% 44 34 0.00% 45 51 0.00% 46 76 0.00% 47 82 0.00% 48 95 0.00% 49 120 0.00% 50 146 0.00% 51 188 0.00% 52 232 0.00% 53 250 0.00% 54 307 0.00% 55 283 0.00% 56 400 0.00% 57 410 0.00% 58 541 0.00% 59 596 0.00% 60 761 0.01% 61 874 0.01% 62 1031 0.01% 63 1238 0.01% 64 1342 0.01% 65 1593 0.01% 66 1628 0.01% 67 1926 0.02% 68 2148 0.02% 69 2541 0.02% 70 2822 0.02% 71 3322 0.03% 72 3727 0.03% 73 4319 0.04% 74 4928 0.04% 75 5292 0.04% 76 5952 0.05% 77 6068 0.05% 78 6495 0.05% 79 7030 0.06% 80 7601 0.06% 81 8308 0.07% 82 9353 0.08% 83 10100 0.08% 84 10992 0.09% 85 12084 0.10% 86 12544 0.10% 87 12945 0.11% 88 13657 0.11% 89 13545 0.11% 90 14076 0.12% 91 15113 0.12% 92 15642 0.13% 93 16600 0.14% 94 17859 0.15% 95 18845 0.15% 96 19566 0.16% 97 20329 0.17% 98 20701 0.17% 99 20939 0.17% 100 21696 0.18% 101 21580 0.18% 102 22601 0.19% 103 23584 0.19% 104 24283 0.20% 105 25178 0.21% 106 26343 0.22% 107 26852 0.22% 108 27415 0.22% 109 27513 0.23% 110 27619 0.23% 111 28034 0.23% 112 28558 0.23% 113 29087 0.24% 114 30225 0.25% 115 30528 0.25% 116 32190 0.26% 117 32849 0.27% 118 33446 0.27% 119 33967 0.28% 120 34239 0.28% 121 34384 0.28% 122 34633 0.28% 123 34958 0.29% 124 35147 0.29% 125 36216 0.30% 126 37206 0.30% 127 37838 0.31% 128 38158 0.31% 129 38714 0.32% 130 39551 0.32% 131 39953 0.33% 132 40166 0.33% 133 40034 0.33% 134 40220 0.33% 135 40881 0.34% 136 41266 0.34% 137 41623 0.34% 138 42079 0.34% 139 43278 0.35% 140 43079 0.35% 141 43690 0.36% 142 43384 0.36% 143 43330 0.36% 144 44064 0.36% 145 44319 0.36% 146 43962 0.36% 147 44550 0.37% 148 45110 0.37% 149 45459 0.37% 150 45908 0.38% 151 10028795 82.20% 12199824 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=6.24 fanout-score-rank=17 prefix-density=0.52 prefix-fanout=3.4 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=86.89 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=14.2 sequence=TCCTTCTTCACAATG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=33 prefix-density=0.40 prefix-fanout=2.3 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=443.14 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=18.1 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTT SRR12917531 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:15:44 Started mapping on | Feb 13 12:15:45 Finished on | Feb 13 12:17:28 Mapping speed, Million of reads per hour | 426.40 Number of input reads | 12199824 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11131449 Uniquely mapped reads % | 91.24% Average mapped length | 290.34 Number of splices: Total | 10149444 Number of splices: Annotated (sjdb) | 9938094 Number of splices: GT/AG | 9950304 Number of splices: GC/AG | 155299 Number of splices: AT/AC | 13878 Number of splices: Non-canonical | 29963 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297333 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 240160 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 771042 771042 771042 N_multimapping 297333 297333 297333 N_noFeature 267054 10978377 335725 N_ambiguous 143670 554 59113 UnstrandedReadsAssigned:10720725 PositiveStrandReadsAssigned:152518 NegativeStrandReadsAssigned:10736611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917531 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917531-trimmed-pair1.fastq SRR12917531-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,199,824 reads, 10,936,439 reads pseudoaligned [quant] estimated average fragment length: 238.074 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR12917531.ke.tsv 34699 SRR12917531.se.tsv 87100 total ==> SRR12917531.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.93 400 18.4365 Potri.005G024800.1.v4.1 1035 797.926 189 19.443 Potri.004G059700.1.v4.1 961 724.059 40 4.53471 Potri.007G009000.2.v4.1 1416 1178.93 0 0 Potri.003G141000.2.v4.1 2943 2705.93 461 13.9845 Potri.016G087400.1.v4.1 270 97.9244 1406 1178.58 Potri.015G069301.1.v4.1 564 340.12 0 0 Potri.010G195200.1.v4.1 1773 1535.93 48 2.56528 Potri.012G127500.1.v4.1 977 740.004 11535 1279.52 ==> SRR12917531.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917531 completed mapping pipeline successfully