Starting /dee2/code/volunteer_pipeline.sh SRR12917532 current disk space = 3093007753216 free memory = 1394617144 SRR12917532 SRAfilesize 2e173733a36475065c27e556a94d5880 SRR12917532.sra SRR12917532.sra file validated SRR12917532 is paired end SRR12917532 is conventional basespace SRR12917532 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917532_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6995 37.0 37.0 37.0 37.0 37.0 2 36.5185 37.0 37.0 37.0 37.0 37.0 3 36.6765 37.0 37.0 37.0 37.0 37.0 4 36.7065 37.0 37.0 37.0 37.0 37.0 5 36.6565 37.0 37.0 37.0 37.0 37.0 6 36.6525 37.0 37.0 37.0 37.0 37.0 7 36.6405 37.0 37.0 37.0 37.0 37.0 8 36.6065 37.0 37.0 37.0 37.0 37.0 9 36.709 37.0 37.0 37.0 37.0 37.0 10-14 36.6687 37.0 37.0 37.0 37.0 37.0 15-19 36.661 37.0 37.0 37.0 37.0 37.0 20-24 36.596000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5586 37.0 37.0 37.0 37.0 37.0 30-34 36.4888 37.0 37.0 37.0 37.0 37.0 35-39 36.4868 37.0 37.0 37.0 37.0 37.0 40-44 36.489999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.42620000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.4273 37.0 37.0 37.0 37.0 37.0 55-59 36.3919 37.0 37.0 37.0 37.0 37.0 60-64 36.348299999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.268 37.0 37.0 37.0 37.0 37.0 70-74 36.2992 37.0 37.0 37.0 37.0 37.0 75-79 36.306 37.0 37.0 37.0 37.0 37.0 80-84 36.274 37.0 37.0 37.0 37.0 37.0 85-89 36.2595 37.0 37.0 37.0 37.0 37.0 90-94 36.262499999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.234399999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1656 37.0 37.0 37.0 37.0 37.0 105-109 36.1211 37.0 37.0 37.0 37.0 37.0 110-114 36.13080000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0758 37.0 37.0 37.0 37.0 37.0 120-124 36.03940000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.961299999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.834 37.0 37.0 37.0 37.0 37.0 135-139 35.831399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.6001 37.0 37.0 37.0 37.0 37.0 145-149 35.46900000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.16275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 3.0 24 2.0 25 5.0 26 7.0 27 4.0 28 7.0 29 15.0 30 14.0 31 36.0 32 46.0 33 93.0 34 120.0 35 313.0 36 2960.0 37 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.5 13.775 6.7250000000000005 40.0 2 19.55 12.525 36.425000000000004 31.5 3 17.424999999999997 16.5 27.425 38.65 4 20.825 21.425 24.925 32.824999999999996 5 24.025 29.725 23.599999999999998 22.650000000000002 6 20.549999999999997 32.7 23.275000000000002 23.474999999999998 7 14.35 29.475 39.35 16.825000000000003 8 16.75 26.275 33.6 23.375 9 18.35 22.725 35.65 23.275000000000002 10-14 19.865 29.54 28.185 22.41 15-19 19.035 28.655 27.845 24.465 20-24 19.605 28.595 27.644999999999996 24.154999999999998 25-29 19.439999999999998 28.415000000000003 28.515 23.630000000000003 30-34 19.45 28.525 27.839999999999996 24.185000000000002 35-39 19.375 28.610000000000003 27.474999999999998 24.54 40-44 20.165 28.389999999999997 27.305 24.14 45-49 19.71 28.615000000000002 26.765 24.91 50-54 19.955000000000002 28.33 27.35 24.365000000000002 55-59 19.935 28.305000000000003 27.46 24.3 60-64 19.91 27.955000000000002 27.865000000000002 24.27 65-69 20.305 28.4 26.91 24.385 70-74 20.79 27.955000000000002 27.750000000000004 23.505000000000003 75-79 19.945 27.905 28.175 23.974999999999998 80-84 20.845 27.435 27.315 24.404999999999998 85-89 20.044999999999998 28.16 27.355 24.44 90-94 20.244999999999997 27.875 27.51 24.37 95-99 20.419999999999998 28.155 26.884999999999998 24.54 100-104 20.11 28.065 27.595 24.23 105-109 20.43 28.33 26.669999999999998 24.57 110-114 21.025 28.52 25.955000000000002 24.5 115-119 21.51 28.24 26.135 24.115000000000002 120-124 20.875 28.395 26.369999999999997 24.36 125-129 21.060000000000002 28.315 26.729999999999997 23.895 130-134 21.695 28.485 26.009999999999998 23.810000000000002 135-139 21.310000000000002 27.88 26.105 24.705 140-144 21.7 27.894999999999996 26.540000000000003 23.865 145-149 21.165 27.675 26.855 24.305 150-151 22.237499999999997 26.525 26.3 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 1.5 27 3.0 28 5.5 29 11.5 30 16.0 31 19.5 32 21.0 33 25.0 34 40.5 35 56.0 36 75.5 37 97.0 38 127.0 39 174.5 40 208.5 41 215.0 42 217.0 43 245.0 44 268.5 45 270.0 46 278.0 47 263.0 48 245.5 49 232.0 50 183.0 51 150.0 52 137.5 53 99.5 54 71.5 55 58.5 56 42.5 57 31.0 58 23.5 59 16.0 60 10.5 61 11.5 62 8.5 63 4.5 64 2.0 65 5.0 66 6.5 67 4.0 68 2.5 69 0.5 70 1.0 71 1.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.62153163152054 81.65 2 8.18534961154273 14.75 3 0.8879023307436182 2.4 4 0.24972253052164264 0.8999999999999999 5 0.0 0.0 6 0.05549389567147614 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACAGCCTTTTTTCTCCGGGCAAGCCTTGACTTTCTGCGCGCGCCAGTG 6 0.15 No Hit CTAGCGATCTCAGACTCCTTCGCTTTTACAATATCGTCAGTAAAAGATCG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.9124999999999999 0.0 0.0 0.0 0.0 100-101 2.4125 0.0 0.0 0.0 0.0 102-103 2.775 0.0 0.0 0.0 0.0 104-105 3.225 0.0 0.0 0.0 0.0 106-107 3.5625 0.0 0.0 0.0 0.0 108-109 4.012499999999999 0.0 0.0 0.0 0.0 110-111 4.325 0.0 0.0 0.0 0.0 112-113 4.612500000000001 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.225 0.0 0.0 0.0 0.0 120-121 6.7375 0.0 0.0 0.0 0.0 122-123 7.3875 0.0 0.0 0.0 0.0 124-125 8.2625 0.0 0.0 0.0 0.0 126-127 8.95 0.0 0.0 0.0 0.0 128-129 9.6125 0.0 0.0 0.0 0.0 130-131 10.2375 0.0 0.0 0.0 0.0 132-133 10.825 0.0 0.0 0.0 0.0 134-135 11.7 0.0 0.0 0.0 0.0 136-137 12.425 0.0 0.0 0.0 0.0 138-139 13.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917532 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917532_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4275 37.0 37.0 37.0 37.0 37.0 2 36.437 37.0 37.0 37.0 37.0 37.0 3 36.367 37.0 37.0 37.0 37.0 37.0 4 36.4475 37.0 37.0 37.0 37.0 37.0 5 36.4385 37.0 37.0 37.0 37.0 37.0 6 36.3745 37.0 37.0 37.0 37.0 37.0 7 36.4135 37.0 37.0 37.0 37.0 37.0 8 36.547 37.0 37.0 37.0 37.0 37.0 9 36.534 37.0 37.0 37.0 37.0 37.0 10-14 36.4564 37.0 37.0 37.0 37.0 37.0 15-19 36.4528 37.0 37.0 37.0 37.0 37.0 20-24 36.3571 37.0 37.0 37.0 37.0 37.0 25-29 36.2821 37.0 37.0 37.0 37.0 37.0 30-34 36.2605 37.0 37.0 37.0 37.0 37.0 35-39 36.235699999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.229400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1824 37.0 37.0 37.0 37.0 37.0 50-54 36.17 37.0 37.0 37.0 37.0 37.0 55-59 36.181200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.175599999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.128099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.132799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0598 37.0 37.0 37.0 37.0 37.0 80-84 36.0624 37.0 37.0 37.0 37.0 37.0 85-89 36.1074 37.0 37.0 37.0 37.0 37.0 90-94 36.081100000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.0264 37.0 37.0 37.0 37.0 37.0 100-104 35.958099999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.995400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9745 37.0 37.0 37.0 37.0 37.0 115-119 35.8804 37.0 37.0 37.0 37.0 37.0 120-124 35.7131 37.0 37.0 37.0 37.0 37.0 125-129 35.6653 37.0 37.0 37.0 37.0 37.0 130-134 35.5382 37.0 37.0 37.0 37.0 37.0 135-139 35.4591 37.0 37.0 37.0 37.0 37.0 140-144 35.258500000000005 37.0 37.0 37.0 34.6 37.0 145-149 34.938300000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.558499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 1.0 17 3.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 2.0 24 3.0 25 4.0 26 4.0 27 9.0 28 10.0 29 9.0 30 15.0 31 35.0 32 42.0 33 111.0 34 207.0 35 584.0 36 2753.0 37 199.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.45 24.275 11.1 27.175 2 30.875000000000004 24.875 28.325 15.925 3 20.275000000000002 29.075 32.775 17.875 4 22.725 33.45 24.9 18.925 5 26.25 34.925 21.025 17.8 6 21.95 38.65 22.5 16.900000000000002 7 22.15 22.025 37.1 18.725 8 20.875 25.2 31.1 22.825 9 22.825 25.624999999999996 29.975 21.575 10-14 23.880000000000003 29.005 26.215 20.9 15-19 23.990000000000002 28.18 27.345000000000002 20.485 20-24 23.23 28.754999999999995 27.415 20.599999999999998 25-29 23.515 27.925 27.435 21.125 30-34 24.415 27.3 27.810000000000002 20.474999999999998 35-39 24.47 27.950000000000003 27.425 20.155 40-44 23.82 28.265 27.305 20.61 45-49 24.37 28.155 26.974999999999998 20.5 50-54 24.349999999999998 28.18 26.85 20.62 55-59 24.240000000000002 27.52 27.355 20.885 60-64 23.76 27.0 27.544999999999998 21.695 65-69 23.630000000000003 27.755000000000003 27.694999999999997 20.919999999999998 70-74 24.46 27.66 27.32 20.560000000000002 75-79 24.375 27.61 27.04 20.974999999999998 80-84 23.965 27.400000000000002 27.665 20.97 85-89 24.36 26.69 28.244999999999997 20.705000000000002 90-94 23.9 27.474999999999998 27.589999999999996 21.035 95-99 24.52 27.905 26.695 20.880000000000003 100-104 24.81 27.744999999999997 27.245 20.200000000000003 105-109 25.085 27.82 27.065 20.03 110-114 24.94 28.410000000000004 26.095000000000002 20.555 115-119 24.98 28.410000000000004 26.545 20.064999999999998 120-124 25.900000000000002 27.744999999999997 26.76 19.595000000000002 125-129 26.445 27.900000000000002 26.22 19.435 130-134 26.939999999999998 27.38 26.384999999999998 19.295 135-139 26.795 27.515 26.724999999999998 18.965 140-144 27.855 27.42 26.279999999999998 18.445 145-149 28.02 27.62 25.96 18.4 150-151 29.725 26.474999999999998 25.5 18.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 3.0 27 3.0 28 4.0 29 3.0 30 7.0 31 14.5 32 17.5 33 24.0 34 36.0 35 52.0 36 68.0 37 91.5 38 131.5 39 159.0 40 175.5 41 216.0 42 256.5 43 268.0 44 283.5 45 288.5 46 262.5 47 258.5 48 265.0 49 235.0 50 184.5 51 157.0 52 140.0 53 102.5 54 66.0 55 46.5 56 33.0 57 25.5 58 22.5 59 17.5 60 13.5 61 10.0 62 7.0 63 7.0 64 6.0 65 3.5 66 2.0 67 2.5 68 2.5 69 1.5 70 2.5 71 1.5 72 1.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 1.5 98 2.5 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.34747864425462 82.875 2 7.522733535409204 13.65 3 0.8542298153761366 2.325 4 0.19289060347203085 0.7000000000000001 5 0.0 0.0 6 0.08266740148801323 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATGGCTTGTGGGTTACTGAATTCGGGGGTCTCCTTCTTGATAGTTATG 6 0.15 No Hit ACTCAAAAACCTCTCCCTTAATTCCACAACATGCTCTACGTCCACTTTCA 6 0.15 No Hit GTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.6125 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.7874999999999996 0.0 0.0 0.0 0.0 104-105 3.225 0.0 0.0 0.0 0.0 106-107 3.575 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.35 0.0 0.0 0.0 0.0 112-113 4.612500000000001 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 5.7 0.0 0.0 0.0 0.0 118-119 6.2 0.0 0.0 0.0 0.0 120-121 6.7125 0.0 0.0 0.0 0.0 122-123 7.3625 0.0 0.0 0.0 0.0 124-125 8.225 0.0 0.0 0.0 0.0 126-127 8.875 0.0 0.0 0.0 0.0 128-129 9.5625 0.0 0.0 0.0 0.0 130-131 10.1875 0.0 0.0 0.0 0.0 132-133 10.7625 0.0 0.0 0.0 0.0 134-135 11.625 0.0 0.0 0.0 0.0 136-137 12.35 0.0 0.0 0.0 0.0 138-139 12.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTAAG 10 0.006830828 145.0 1 >>END_MODULE Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578320 spots for SRR12917532.sra Written 578320 spots for SRR12917532.sra Read 578335 spots for SRR12917532.sra Written 578335 spots for SRR12917532.sra SRR ids: ['SRR12917532.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q81zp27m SRR12917532.sra spots: 11566415 blocks: [[1, 578320], [578321, 1156640], [1156641, 1734960], [1734961, 2313280], [2313281, 2891600], [2891601, 3469920], [3469921, 4048240], [4048241, 4626560], [4626561, 5204880], [5204881, 5783200], [5783201, 6361520], [6361521, 6939840], [6939841, 7518160], [7518161, 8096480], [8096481, 8674800], [8674801, 9253120], [9253121, 9831440], [9831441, 10409760], [10409761, 10988080], [10988081, 11566415]] SRR12917532 file size 3909073 SRR12917532 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917532 SRR12917532_1.fastq SRR12917532_2.fastq Input file: SRR12917532_1.fastq Paired file: SRR12917532_2.fastq trimmed: SRR12917532-trimmed-pair1.fastq, SRR12917532-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:54:43 2025 >> started Thu Feb 13 11:54:57 2025 >> done (14.259s) 11566415 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 11827 ( 0.10%) empty read pairs filtered out after trimming by size control 11554516 (99.90%) read pairs available; of these: 2123435 (18.38%) trimmed read pairs available after processing 9431081 (81.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 8 0.00% 21 1 0.00% 22 5 0.00% 23 17 0.00% 24 11 0.00% 25 11 0.00% 26 15 0.00% 27 7 0.00% 28 8 0.00% 29 13 0.00% 30 12 0.00% 31 14 0.00% 32 12 0.00% 33 26 0.00% 34 22 0.00% 35 11 0.00% 36 13 0.00% 37 20 0.00% 38 21 0.00% 39 9 0.00% 40 16 0.00% 41 27 0.00% 42 32 0.00% 43 28 0.00% 44 33 0.00% 45 48 0.00% 46 36 0.00% 47 60 0.00% 48 71 0.00% 49 65 0.00% 50 101 0.00% 51 96 0.00% 52 129 0.00% 53 130 0.00% 54 162 0.00% 55 181 0.00% 56 246 0.00% 57 220 0.00% 58 314 0.00% 59 367 0.00% 60 447 0.00% 61 533 0.00% 62 699 0.01% 63 763 0.01% 64 802 0.01% 65 946 0.01% 66 1127 0.01% 67 1226 0.01% 68 1385 0.01% 69 1585 0.01% 70 1746 0.02% 71 2051 0.02% 72 2351 0.02% 73 2832 0.02% 74 3080 0.03% 75 3589 0.03% 76 3967 0.03% 77 4103 0.04% 78 4560 0.04% 79 4905 0.04% 80 5332 0.05% 81 5932 0.05% 82 6857 0.06% 83 7502 0.06% 84 8307 0.07% 85 9089 0.08% 86 9894 0.09% 87 10085 0.09% 88 10796 0.09% 89 10930 0.09% 90 11766 0.10% 91 12358 0.11% 92 13031 0.11% 93 14251 0.12% 94 15439 0.13% 95 16738 0.14% 96 17264 0.15% 97 18105 0.16% 98 18479 0.16% 99 19171 0.17% 100 19419 0.17% 101 19920 0.17% 102 20660 0.18% 103 22179 0.19% 104 22816 0.20% 105 24057 0.21% 106 25211 0.22% 107 25750 0.22% 108 26698 0.23% 109 26947 0.23% 110 26894 0.23% 111 27285 0.24% 112 28111 0.24% 113 27980 0.24% 114 29908 0.26% 115 30899 0.27% 116 31329 0.27% 117 32670 0.28% 118 33417 0.29% 119 33743 0.29% 120 34524 0.30% 121 34448 0.30% 122 34377 0.30% 123 35012 0.30% 124 36204 0.31% 125 36882 0.32% 126 38104 0.33% 127 38926 0.34% 128 39181 0.34% 129 40712 0.35% 130 40562 0.35% 131 41213 0.36% 132 40781 0.35% 133 41344 0.36% 134 40887 0.35% 135 41906 0.36% 136 42428 0.37% 137 43356 0.38% 138 43955 0.38% 139 45200 0.39% 140 45164 0.39% 141 45730 0.40% 142 45886 0.40% 143 45420 0.39% 144 45905 0.40% 145 47007 0.41% 146 46220 0.40% 147 47194 0.41% 148 46955 0.41% 149 47076 0.41% 150 48337 0.42% 151 9431081 81.62% 11554516 reads passed initial QC criterion=sequence-density sequence-density=1.42 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=1.42 prefix-fanout=2.0 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=26.06 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=5.0 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAAAAACAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAACCTGTCTAACACTAGCTCTCTGTCTGCAACTACTACTAGTATCTAGC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=1.05 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCAGATAAATGCCTGCCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=200.58 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=9.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAACACTGACGCTATTTCTGCTGTTTGTCAAGATGGGGTTCTGACTGTTACTGTTGAGAAATTACCACCTCCTGAGCCTAAGAAGCCTAAGACTAT SRR12917532 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:55:40 Started mapping on | Feb 13 11:55:40 Finished on | Feb 13 11:57:04 Mapping speed, Million of reads per hour | 495.19 Number of input reads | 11554516 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10856282 Uniquely mapped reads % | 93.96% Average mapped length | 290.68 Number of splices: Total | 10142371 Number of splices: Annotated (sjdb) | 9937727 Number of splices: GT/AG | 9968277 Number of splices: GC/AG | 134117 Number of splices: AT/AC | 10587 Number of splices: Non-canonical | 29390 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312892 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 113366 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385342 385342 385342 N_multimapping 312892 312892 312892 N_noFeature 231193 10719166 288430 N_ambiguous 167123 680 86872 UnstrandedReadsAssigned:10457966 PositiveStrandReadsAssigned:136436 NegativeStrandReadsAssigned:10480980 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917532 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917532-trimmed-pair1.fastq SRR12917532-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,554,516 reads, 10,524,140 reads pseudoaligned [quant] estimated average fragment length: 232.112 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR12917532.ke.tsv 34699 SRR12917532.se.tsv 87100 total ==> SRR12917532.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.89 277 12.6403 Potri.005G024800.1.v4.1 1035 803.888 193 19.5766 Potri.004G059700.1.v4.1 961 730.032 17 1.89882 Potri.007G009000.2.v4.1 1416 1184.89 0 0 Potri.003G141000.2.v4.1 2943 2711.89 311 9.35115 Potri.016G087400.1.v4.1 270 97.7271 1117 931.997 Potri.015G069301.1.v4.1 564 344.481 0 0 Potri.010G195200.1.v4.1 1773 1541.89 55 2.90862 Potri.012G127500.1.v4.1 977 745.989 4178 456.681 ==> SRR12917532.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 98 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 27 SRR12917532 completed mapping pipeline successfully